ID: 920412731

View in Genome Browser
Species Human (GRCh38)
Location 1:205774916-205774938
Sequence CTGTTCAAAGTGCTGGTGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 225}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920412731_920412740 5 Left 920412731 1:205774916-205774938 CCCACCACCAGCACTTTGAACAG 0: 1
1: 0
2: 0
3: 22
4: 225
Right 920412740 1:205774944-205774966 CGCGGCTGCCCATGGCTAGCGGG 0: 1
1: 0
2: 2
3: 8
4: 105
920412731_920412744 19 Left 920412731 1:205774916-205774938 CCCACCACCAGCACTTTGAACAG 0: 1
1: 0
2: 0
3: 22
4: 225
Right 920412744 1:205774958-205774980 GCTAGCGGGGTGTGCGTTTTAGG 0: 1
1: 0
2: 0
3: 3
4: 22
920412731_920412747 26 Left 920412731 1:205774916-205774938 CCCACCACCAGCACTTTGAACAG 0: 1
1: 0
2: 0
3: 22
4: 225
Right 920412747 1:205774965-205774987 GGGTGTGCGTTTTAGGGAGGCGG 0: 1
1: 0
2: 3
3: 26
4: 338
920412731_920412739 4 Left 920412731 1:205774916-205774938 CCCACCACCAGCACTTTGAACAG 0: 1
1: 0
2: 0
3: 22
4: 225
Right 920412739 1:205774943-205774965 TCGCGGCTGCCCATGGCTAGCGG 0: 1
1: 0
2: 1
3: 124
4: 628
920412731_920412741 6 Left 920412731 1:205774916-205774938 CCCACCACCAGCACTTTGAACAG 0: 1
1: 0
2: 0
3: 22
4: 225
Right 920412741 1:205774945-205774967 GCGGCTGCCCATGGCTAGCGGGG 0: 1
1: 0
2: 0
3: 8
4: 114
920412731_920412748 27 Left 920412731 1:205774916-205774938 CCCACCACCAGCACTTTGAACAG 0: 1
1: 0
2: 0
3: 22
4: 225
Right 920412748 1:205774966-205774988 GGTGTGCGTTTTAGGGAGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 148
920412731_920412745 20 Left 920412731 1:205774916-205774938 CCCACCACCAGCACTTTGAACAG 0: 1
1: 0
2: 0
3: 22
4: 225
Right 920412745 1:205774959-205774981 CTAGCGGGGTGTGCGTTTTAGGG 0: 1
1: 0
2: 0
3: 1
4: 18
920412731_920412738 -3 Left 920412731 1:205774916-205774938 CCCACCACCAGCACTTTGAACAG 0: 1
1: 0
2: 0
3: 22
4: 225
Right 920412738 1:205774936-205774958 CAGGTGGTCGCGGCTGCCCATGG 0: 1
1: 0
2: 1
3: 20
4: 133
920412731_920412746 23 Left 920412731 1:205774916-205774938 CCCACCACCAGCACTTTGAACAG 0: 1
1: 0
2: 0
3: 22
4: 225
Right 920412746 1:205774962-205774984 GCGGGGTGTGCGTTTTAGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920412731 Original CRISPR CTGTTCAAAGTGCTGGTGGT GGG (reversed) Exonic
900490223 1:2944391-2944413 CTGCTCACAGTGCTGGAGGCTGG + Intergenic
900835352 1:4999153-4999175 CTGTTCCCAGTAGTGGTGGTGGG + Intergenic
901582745 1:10258966-10258988 CTGTTCTAAGTCCTGGAGATGGG + Intronic
903542472 1:24104802-24104824 CTTCCCAAAGTGCTGGAGGTGGG + Intronic
904443025 1:30544109-30544131 CAGTTCGAATTGCAGGTGGTTGG - Intergenic
904948464 1:34216458-34216480 CTGAACAAAGTGCTGGTGTTGGG + Intronic
905159731 1:36021226-36021248 CTGTTCAAAGTAATGGCGGCTGG - Intronic
905645702 1:39623778-39623800 ATATGCAAAGTGCTGGAGGTGGG + Intergenic
908255314 1:62298587-62298609 CGGTTTCAAGTGCTGGTGCTAGG - Intronic
908599833 1:65726672-65726694 CAGTGCAAAGTGCTGTTGCTGGG + Intergenic
911230594 1:95357234-95357256 CTGTTCTATGTGCTGCCGGTGGG + Intergenic
915102923 1:153513720-153513742 CTGGACAAGGGGCTGGTGGTTGG - Intergenic
915283568 1:154838820-154838842 CTGTGCAAGGTGCTGGGGGTGGG - Intronic
915437681 1:155921130-155921152 CTGTTTAAAGTGGGGATGGTGGG - Intronic
917155164 1:171989776-171989798 CTGTTTAAAGTGATTGTGGAAGG + Intronic
917687819 1:177435501-177435523 TTCTTCAAAGTGCTGTTGCTTGG + Intergenic
920412731 1:205774916-205774938 CTGTTCAAAGTGCTGGTGGTGGG - Exonic
921108342 1:212007069-212007091 CTGTTCACAGTACTGATTGTTGG - Intronic
921162867 1:212485448-212485470 CTATTTCAAGTTCTGGTGGTGGG + Intergenic
924690998 1:246350321-246350343 ATGCTCTAAGTCCTGGTGGTTGG - Intronic
1064281421 10:13954808-13954830 CCTTTCAGAGTGCTGGTGTTTGG + Intronic
1066479458 10:35781479-35781501 TTGTTCACAGTTCTGGAGGTTGG - Intergenic
1067227287 10:44384515-44384537 CTGCGCACAGTGCTGGAGGTCGG - Intronic
1067469074 10:46523306-46523328 CTGTTCACAGGGGTGGGGGTGGG - Intergenic
1070204855 10:74247578-74247600 CTGTTAAAGGAGCTGATGGTTGG - Intronic
1074913997 10:117938382-117938404 CAGTCCACAGTGCTGGTGTTAGG - Intergenic
1075063275 10:119271776-119271798 CTAATCAAAGTGCTGGAGCTGGG - Intronic
1076098273 10:127752063-127752085 ATGGTGAAAGTGCTGGTAGTGGG + Intergenic
1077018734 11:408065-408087 CTCTTCAGAGAGCTGGTGATGGG - Exonic
1079531802 11:21463216-21463238 TTTTACAAAGTGCTGGAGGTGGG - Intronic
1080104721 11:28499978-28500000 TTGTTTAAAGGGCAGGTGGTTGG + Intergenic
1080124450 11:28715924-28715946 CTGTCAAGAGTGCTGGTGGACGG - Intergenic
1085184603 11:74564895-74564917 TTGGTCTCAGTGCTGGTGGTGGG - Intronic
1085311576 11:75520089-75520111 CTGTTCACAGGGAAGGTGGTGGG + Intronic
1086250989 11:84814232-84814254 CTGCTCAACGTGCTGGGTGTAGG - Intronic
1086285377 11:85243126-85243148 CTGTTTCAACTGTTGGTGGTAGG - Intronic
1086329421 11:85738792-85738814 CTGAGCCAAGTGCTGATGGTTGG + Intronic
1086561590 11:88175338-88175360 CTGTACAAGTTGCTGGTGATTGG - Exonic
1087916941 11:103822053-103822075 CTGTTCTATATGCTGGAGGTAGG + Intergenic
1088977142 11:114825856-114825878 TTGTTCAAATTGCTGTTGCTGGG + Intergenic
1089692587 11:120196109-120196131 CTGTGCAAAGAGCTGGTCGGGGG - Intergenic
1094220034 12:27982892-27982914 ATGTACAATGTGCTGATGGTTGG - Intergenic
1097465665 12:59921368-59921390 CTTGCCAAACTGCTGGTGGTGGG + Intergenic
1102300772 12:111769464-111769486 CTGTTCACAGTGCTCTTGGAGGG - Intronic
1103073038 12:117960531-117960553 CTGCTCACATGGCTGGTGGTTGG - Intronic
1103750139 12:123152457-123152479 CTTTTTACAGTGCTGCTGGTGGG - Intronic
1104741091 12:131175039-131175061 ATAGTCAAAGTGCTGGTGGTGGG + Intergenic
1106123278 13:26879833-26879855 CTGTTCTTAGTGCTGGTGGAAGG - Intergenic
1106314029 13:28577934-28577956 ATCTTCAAAGAGCTGGCGGTGGG - Intergenic
1108418762 13:50227801-50227823 CTGTGGAAACTGCTGGTGGGTGG + Intronic
1108573334 13:51770908-51770930 CTTATCACAGTGCTGGTGGTAGG - Intronic
1108762793 13:53589982-53590004 CTGCTTAAAGTCCTGGAGGTGGG + Intergenic
1109918742 13:69027335-69027357 TTGTTCAAAGTCCTTGTGGGTGG + Intergenic
1112312340 13:98330118-98330140 CTGTGCAAAGGCCTGGAGGTGGG + Intronic
1112924322 13:104655291-104655313 CTGCTCAGAGAGCAGGTGGTGGG + Intergenic
1113427943 13:110225239-110225261 CTGTTCGAAGTGCTGGGGGGAGG - Intronic
1114477675 14:23008863-23008885 CTGTTCATGGTGATGGTGATGGG - Intronic
1120286686 14:82511442-82511464 CTGTTCAACCAACTGGTGGTGGG - Intergenic
1121083099 14:91124534-91124556 CTGAAGAAAGTGCTGGTGGAAGG + Intronic
1121315382 14:92958260-92958282 CTGTACAAGGTGTTCGTGGTTGG - Exonic
1121812204 14:96901075-96901097 CTGTTTAAAGTGAGGGTGGGTGG + Intronic
1124055461 15:26237548-26237570 CTGTTCAAAGTTGTCTTGGTTGG + Intergenic
1125434684 15:39632072-39632094 ATGTTCAATGTGGTGGTTGTCGG + Intronic
1125502232 15:40246951-40246973 CTGCCCAAAGTGTTGGAGGTGGG + Intronic
1126806814 15:52358713-52358735 CTGTTCCATGTGGTGGTGGTCGG - Intronic
1127301179 15:57655259-57655281 GTGTTCAAAGTCCTGGAGGCGGG + Intronic
1129182348 15:73885257-73885279 TGGTTCAAAGTAGTGGTGGTGGG + Intronic
1130065829 15:80604371-80604393 CTGTTCATGGAGCAGGTGGTGGG - Intergenic
1130770273 15:86917110-86917132 GTGTTTAAAGTGCTGTTGGAAGG + Intronic
1131692042 15:94837681-94837703 CCTTTCAAAGTGCTGGTGAGAGG - Intergenic
1133246879 16:4455014-4455036 CTGTTCCAACTCCTGGGGGTGGG - Intronic
1133281859 16:4671194-4671216 CTGTTCCAGGTGCTGCTGGTTGG + Intronic
1134083151 16:11338342-11338364 CTGCTCATAGTTCTGGAGGTGGG + Intronic
1134902726 16:17953242-17953264 CTGTTCACAGTTCTGGAGGCTGG + Intergenic
1136466412 16:30447035-30447057 CTGTTCATTGGGCTGGTGGTGGG + Intergenic
1140212931 16:72985021-72985043 GTGTTCGTAGTGGTGGTGGTAGG - Intronic
1141302603 16:82831403-82831425 TTTTTTAAAGTGCTGGGGGTTGG + Intronic
1141464591 16:84197338-84197360 CTGTTCACAGGGCTGGAGGCAGG + Intergenic
1143585355 17:7847933-7847955 CTGTTGCTACTGCTGGTGGTTGG - Exonic
1144078883 17:11744318-11744340 CTGGTCACAGTGCTGCTAGTAGG - Intronic
1147378073 17:40034862-40034884 CTGTGCTAGGTGCTGGGGGTGGG - Intronic
1147548601 17:41422288-41422310 CTGTTCCACATCCTGGTGGTTGG + Exonic
1150731013 17:67693909-67693931 CTTTTCTAAGGTCTGGTGGTAGG - Intronic
1152371783 17:79892864-79892886 TTGGACAAAGTGCTGGGGGTTGG - Intergenic
1153207042 18:2714855-2714877 GTTTTCAAAGTGCTGGGGGTAGG - Intronic
1156036845 18:32773589-32773611 CATTTCACAGTGCTGGGGGTGGG - Exonic
1157285057 18:46372104-46372126 CTGATGACAGTGCTGGTGGCTGG + Intronic
1158115297 18:53988883-53988905 TTCTTCATAGTGCTTGTGGTAGG - Intergenic
1159282507 18:66305017-66305039 CTGTTAACAGGGCTGGAGGTAGG - Intergenic
1163248518 19:16111923-16111945 CTGTTCAAGCTGCTGCTGATCGG + Exonic
1163702617 19:18793756-18793778 CTGGTCACAGTGCTGGGGCTTGG + Intergenic
1163704273 19:18803283-18803305 CTTTCCAAATTGCTGCTGGTGGG + Intergenic
1164965222 19:32477605-32477627 GTCTTCATAGTGCGGGTGGTTGG - Exonic
1166136442 19:40780024-40780046 CTCTTCAAATTCCTGGTGATTGG + Exonic
1166461005 19:42988162-42988184 CTGTTGAGGGTGGTGGTGGTGGG + Intronic
1166478294 19:43148142-43148164 CTGTTGAGGGTGGTGGTGGTGGG + Intronic
924977506 2:191678-191700 CTGTGCACAGTGCTGGTGGGAGG - Intergenic
927053192 2:19349559-19349581 GTTTTCACAGTGCTGGAGGTGGG + Intergenic
927429683 2:23016971-23016993 CTATTCAGAGGGCTGGGGGTGGG - Intergenic
927460775 2:23296518-23296540 CTGTTCGCAGTGCTGCTGGGAGG + Intergenic
928391439 2:30913725-30913747 CTTTTCAAACTGTTGGTGTTGGG + Intronic
930002951 2:46873588-46873610 CTGTGCAATGGGGTGGTGGTGGG - Intergenic
930212482 2:48655590-48655612 CTGATCAAAGTACTGGTGGCAGG - Intronic
930924800 2:56804063-56804085 GTGTTAGAAGTGGTGGTGGTTGG + Intergenic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
935735821 2:106105951-106105973 CTGTTCACAGAGCTGCTGGCAGG - Intronic
935753000 2:106255487-106255509 ATGTGCCCAGTGCTGGTGGTAGG - Intergenic
935913420 2:107923020-107923042 ATGTGCCCAGTGCTGGTGGTAGG - Intergenic
939433305 2:142139840-142139862 TTCTTTAAAGTGGTGGTGGTGGG - Intergenic
940010027 2:149042627-149042649 CTGTTCTAGGTGCTGGGGATTGG + Intronic
940781402 2:157937577-157937599 CTTTTCACAGTTCTGGAGGTTGG + Intronic
940781420 2:157937704-157937726 CTTTTCACAGTTCTGGAGGTTGG + Intronic
940781438 2:157937831-157937853 CTTTTCACAGTTCTGGAGGTTGG + Intronic
943425319 2:187724599-187724621 CTGTTGAAAGTTCTGCTGTTGGG + Intergenic
946162062 2:217841365-217841387 CTGTTCCCTGTGCTGTTGGTGGG - Intronic
946394275 2:219435341-219435363 GTGCTCACAGTGCTGGAGGTCGG + Exonic
947170337 2:227304552-227304574 CTTTTCAAAATACTGGTGTTTGG + Intronic
948579219 2:238972533-238972555 CTCTCCAAAGTGCTGTTAGTGGG - Intergenic
948705631 2:239790511-239790533 GTGTGCCAAGTGCTGGTCGTGGG - Intronic
948723936 2:239920313-239920335 CTGTACAAACTGCTGCTGATGGG - Intronic
1168873117 20:1147782-1147804 CTGAGCAAAGTGGTGGTGATGGG - Intronic
1169631572 20:7638281-7638303 CAACTCAAAGTGGTGGTGGTTGG - Intergenic
1172104366 20:32507560-32507582 TTGATCAAAATGCAGGTGGTGGG - Intronic
1172655449 20:36534096-36534118 ATGTTAAAAGTACTGGTGGCTGG + Intergenic
1172847009 20:37935522-37935544 CTGTGCAAAGGCCTGGAGGTGGG - Intronic
1172949712 20:38715114-38715136 CACTTCACAGTGCTGGTGGGAGG - Intergenic
1173473692 20:43343319-43343341 ATGTTCACAGTGCAGGGGGTAGG - Intergenic
1174520763 20:51128875-51128897 CTGTTCCATAGGCTGGTGGTAGG + Intergenic
1174744555 20:53048565-53048587 CAAATCAAAGAGCTGGTGGTAGG - Intronic
1175595037 20:60224210-60224232 CTGTTCAAAGGGATGGAGGCTGG - Intergenic
1176088926 20:63310372-63310394 CTGTTCCAGGTGGTGGTGGAGGG + Exonic
1176997552 21:15574387-15574409 CTTTTCAAAGAGCTGGTGCTTGG - Intergenic
1178644098 21:34370726-34370748 CTCTACAATGTACTGGTGGTAGG - Exonic
1181003970 22:20000874-20000896 CTGTTCACAGTGCTGGAGGCTGG - Intronic
1181473033 22:23152468-23152490 CTCTCCAAGGTGGTGGTGGTTGG + Exonic
1184365898 22:44051160-44051182 CTTTTCCACGAGCTGGTGGTAGG - Intronic
949192924 3:1271515-1271537 CTGTTGTATGTGCTGGTGGGCGG + Intronic
953329821 3:42043501-42043523 CTGCTCACAGGGCTGGGGGTAGG - Intronic
954929593 3:54269580-54269602 CTTTACACAGTGATGGTGGTTGG - Intronic
955536349 3:59927901-59927923 GTGTTCAAAGAGATGGTGGAAGG - Intronic
956887959 3:73579282-73579304 CTGTTCATAGTTCTGGAGGCTGG - Intronic
957958756 3:87223281-87223303 TTGTTCACAGTTCTGGAGGTTGG - Intergenic
959556540 3:107725991-107726013 CTGTTCATACTGATGGTGGGAGG - Intronic
960338901 3:116451190-116451212 CTCTTCAAAGAGGTGTTGGTTGG - Intronic
960704783 3:120471502-120471524 CTATTCAAAGTGTTGTTGGTGGG - Intergenic
961754778 3:129121416-129121438 CTGTTCAAGCTGGTGCTGGTGGG - Exonic
961857933 3:129891903-129891925 CAGTTTAAAGTAATGGTGGTTGG + Intronic
962968948 3:140381109-140381131 CTGTTCTAACTTCTGGTGATTGG + Intronic
963073401 3:141323814-141323836 CTGTTCTAGGTGATGGTGCTGGG - Intergenic
963213011 3:142715274-142715296 CCTTTCAAAGTGCTGGGGGTGGG - Intergenic
964624317 3:158744696-158744718 CTGTGTAAAGTGCTGGGTGTGGG + Intronic
965783137 3:172309197-172309219 CTGATCAAAGTGCTCCAGGTGGG + Intronic
965971788 3:174566814-174566836 CTTTTCAAATCGCTGGTGTTTGG + Intronic
967054337 3:185815761-185815783 CTGTTTATGGTGCTGGTGGGAGG - Intronic
967131798 3:186477313-186477335 TTTTTCAAAGTGCTGCTGGAGGG + Intergenic
967741797 3:193010992-193011014 CTGTCCAAACTGCTGCTAGTTGG + Intergenic
967743442 3:193028497-193028519 CTTTACAAAGTGCTGGTGCCTGG - Intergenic
968269700 3:197394001-197394023 CTCTACAAAATGCTGGTTGTTGG - Intergenic
970231889 4:13919443-13919465 CTGGTAGAAGTGCTGGAGGTGGG - Intergenic
970626681 4:17893198-17893220 CTGTTGAAAGTTATGGTAGTAGG - Intronic
971582361 4:28358211-28358233 CTGTCAAGAGTGCTGGTGGTGGG - Intergenic
972013267 4:34211464-34211486 ATTTTCCAAGAGCTGGTGGTGGG - Intergenic
974231267 4:59117644-59117666 CTGTTCAATGTGATGGTGTTAGG + Intergenic
974276665 4:59729255-59729277 CTGTTCAAGGTGGTGGTGCAAGG + Intergenic
984204465 4:176769200-176769222 TTGTTCATAGTTCTGGAGGTTGG - Intronic
984691895 4:182735493-182735515 CTGTTCTATGTGGAGGTGGTGGG + Intronic
986178941 5:5375869-5375891 CTGCTCAGGTTGCTGGTGGTGGG - Intergenic
988442119 5:31244920-31244942 CTGTTCAAGCTGCTGTTTGTGGG - Intronic
991566563 5:68010899-68010921 CTGCTCAATGTGGTGGTGGTAGG - Intergenic
991618571 5:68521323-68521345 TTGTTAATAGTGATGGTGGTGGG - Intergenic
992710777 5:79453346-79453368 CTGACCAACGTGCTGGTAGTTGG + Intronic
993116538 5:83726131-83726153 CTGTTCTCAGTGCTTGTGATAGG - Intergenic
995364892 5:111347467-111347489 CTTTTCAAATTGCTTGTGGCAGG + Intronic
999163176 5:149522900-149522922 CTGTACTTAGTGCTGGGGGTTGG - Intronic
1000035682 5:157445908-157445930 CTATTCAAAGCGCTTCTGGTAGG - Intronic
1001145772 5:169183112-169183134 CACTCCAATGTGCTGGTGGTTGG - Intronic
1002070043 5:176673802-176673824 CTGTCCAAAGTGTCTGTGGTGGG + Intergenic
1002091438 5:176809095-176809117 CTGCTCCAGGTGCTGGTTGTCGG - Intergenic
1004141978 6:13026604-13026626 CTGTTCATGGTGGTGGTGGGTGG + Intronic
1004667833 6:17764738-17764760 CTGGTAATACTGCTGGTGGTAGG + Exonic
1005429151 6:25736096-25736118 CTGTTGAAAGAGAAGGTGGTGGG + Intergenic
1006073687 6:31515808-31515830 CTGTTAGAAGTGCTGGAGTTGGG + Intergenic
1007798843 6:44374929-44374951 CTGATAAAACTGCTGGGGGTAGG - Intronic
1012904235 6:105045790-105045812 CTTTTCAAAGTCCAGTTGGTAGG + Intronic
1014550549 6:122785416-122785438 CTTCCCAAAGTGCTGGTGCTGGG - Intergenic
1015372147 6:132466231-132466253 CTGTTTCAAGTGCTGCTGTTAGG - Intronic
1016231444 6:141810157-141810179 CTTTTCTAGGTTCTGGTGGTGGG - Intergenic
1016658135 6:146543944-146543966 CTCTTCAAGGTGCTGGTGATCGG + Exonic
1017289743 6:152722125-152722147 CTGTGGGAAGTGCTGATGGTGGG - Exonic
1017367618 6:153663316-153663338 ATGTTCAATGTCCTGGTGTTTGG - Intergenic
1017828739 6:158104611-158104633 ATGTTTAAAATGCTGCTGGTAGG + Intergenic
1020234105 7:6342113-6342135 CTGTTCTAGGTGCTGGTATTAGG + Intronic
1023590758 7:41778454-41778476 ATGTTGCAATTGCTGGTGGTGGG + Intergenic
1023644843 7:42299972-42299994 TTTTTCACAGGGCTGGTGGTCGG - Intergenic
1025105904 7:56171848-56171870 CTGTTCAAAGAGGGAGTGGTCGG - Intergenic
1031146368 7:118001801-118001823 CTGTTCACAGTTCTGGAGGCTGG + Intergenic
1032462370 7:132121681-132121703 CTGCTCAAGGTCATGGTGGTTGG + Intergenic
1033571354 7:142631953-142631975 CTGTTCACACTGCTGGAGGGTGG - Intergenic
1036332199 8:7838343-7838365 CTATTCAAAGTGGGGGTGGCGGG - Intronic
1037427980 8:18777797-18777819 CTGTGGATAGTGGTGGTGGTGGG - Intronic
1037517791 8:19650917-19650939 CTGTTCAAAGTGCTGGAAAGAGG + Intronic
1038425262 8:27460517-27460539 CTGTGCTAGGTGCTGGGGGTGGG + Exonic
1039978000 8:42383495-42383517 CTGTGCAATGTGCTGGTGCAGGG + Intergenic
1040063760 8:43127719-43127741 CTGGTGTAAGTGCTGGTAGTGGG + Intergenic
1040574753 8:48641956-48641978 CTTCTCAAGTTGCTGGTGGTGGG + Intergenic
1041035917 8:53790419-53790441 CTGTATAAAGGGCTGGTCGTGGG - Intronic
1041773312 8:61496333-61496355 CTGTCCAAGGTGCTGGAGGGAGG + Intronic
1044898120 8:96914746-96914768 CTGTTCGGTGTGCTGGAGGTGGG - Intronic
1046471339 8:114678807-114678829 CTGTTGAGAGTGCTGTTGATAGG - Intergenic
1049301152 8:141871553-141871575 CAGGTGAGAGTGCTGGTGGTGGG + Intergenic
1050073112 9:1837240-1837262 CTTTCCAAAGTGCCTGTGGTGGG + Intergenic
1052345843 9:27408668-27408690 CTGCTTAAGGTCCTGGTGGTTGG + Intronic
1052603574 9:30671134-30671156 CTGTTCATTCTGCTGGTGCTGGG - Intergenic
1056501590 9:87214998-87215020 CTTTTCTAATTGCTGGTTGTAGG - Intergenic
1056650110 9:88451959-88451981 CTGTTCAAATTGCAGGAGGGGGG - Intronic
1061135732 9:128732214-128732236 ATGTTCAAAGTGACTGTGGTAGG + Intronic
1061418328 9:130460131-130460153 CTGGTCAGGGTGCTGATGGTGGG + Intronic
1061490114 9:130939769-130939791 CTTTTAAAAGTGCTGCTGGTGGG - Intergenic
1186188376 X:7043724-7043746 CTGTTGAGGGTGGTGGTGGTGGG + Intergenic
1187033473 X:15512556-15512578 CATTTCAATGAGCTGGTGGTGGG - Intronic
1187276017 X:17817195-17817217 CTGTGCACAGTGCTGGGGGCAGG + Intronic
1187673451 X:21691755-21691777 TTTTTCAAAGTGCTGGAGGCTGG + Intergenic
1189453148 X:41158426-41158448 ATATTCAAAGTGCTGGGGTTGGG + Intronic
1189469740 X:41304415-41304437 GTGGTCAAAGGGCTGGCGGTGGG + Intergenic
1194063498 X:89234155-89234177 CTGTTCTAGGTGCTGGTGATTGG - Intergenic
1195342189 X:103917113-103917135 TTGTTCACAGTTCTGGAGGTTGG + Intergenic
1195712729 X:107787188-107787210 CTGTTCAAAGTGTTGTCCGTGGG - Intronic
1195882880 X:109611009-109611031 TTTTTCCAGGTGCTGGTGGTAGG - Intergenic
1197609323 X:128621513-128621535 ATGTTCAAAGTGTTAGAGGTAGG - Intergenic
1197662132 X:129185718-129185740 CTATTCAAAGTGCAGTTGATGGG + Intergenic
1198037767 X:132818857-132818879 CTGCTGAATGTGCTGGGGGTTGG - Intronic
1200693059 Y:6328098-6328120 CTTTTCAAAGTGGTGGTAGGCGG + Intergenic
1200717671 Y:6568262-6568284 CTGTTCTAGGTGCTGGTTATTGG - Intergenic
1200873852 Y:8131694-8131716 CTTTTCAAAGTGATGGTAGGTGG + Intergenic
1200952246 Y:8909929-8909951 CTTTTCAAAGTGGTGGTAGGCGG + Intergenic
1201017169 Y:9617259-9617281 CTTTTCAAAGTGGTGGTAGGTGG - Intergenic
1201042213 Y:9846628-9846650 CTTTTCAAAGTGGTGGTAGGCGG - Intergenic
1201059290 Y:10030498-10030520 CTTTTCAAAGTGGTGGTAGACGG - Intergenic
1202118080 Y:21493565-21493587 CTTTTCAAAGTGGTGGTAGGCGG + Intergenic
1202120526 Y:21517103-21517125 CTTTTCAAAGTGGTGGTAGGCGG + Exonic
1202122977 Y:21540644-21540666 CTTTTCAAAGTGGTGGTAGGCGG + Exonic
1202156028 Y:21888737-21888759 CTTTTCAAAGTGGTGGTAGGCGG - Exonic
1202158476 Y:21912278-21912300 CTTTTCAAAGTGGTGGTAGGCGG - Exonic
1202184930 Y:22177203-22177225 CTTTTCAAAGTGGTGGTAGGCGG - Exonic
1202206430 Y:22409198-22409220 CTTTTCAAAGTGGTGGTAGGCGG + Exonic
1202240810 Y:22766706-22766728 CTTTTCAAAGTGATGGTAGGTGG - Intergenic
1202393796 Y:24400449-24400471 CTTTTCAAAGTGATGGTAGGTGG - Intergenic
1202476989 Y:25269643-25269665 CTTTTCAAAGTGATGGTAGGTGG + Intergenic