ID: 920415036

View in Genome Browser
Species Human (GRCh38)
Location 1:205793439-205793461
Sequence GGTTCCAGTGCAGCACGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 161}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920415036_920415042 4 Left 920415036 1:205793439-205793461 CCACCACGTGCTGCACTGGAACC 0: 1
1: 0
2: 1
3: 7
4: 161
Right 920415042 1:205793466-205793488 AGCAATGGAATGTGGCAGCTTGG 0: 1
1: 0
2: 1
3: 19
4: 213
920415036_920415043 18 Left 920415036 1:205793439-205793461 CCACCACGTGCTGCACTGGAACC 0: 1
1: 0
2: 1
3: 7
4: 161
Right 920415043 1:205793480-205793502 GCAGCTTGGCTAACTGCTGCAGG 0: 1
1: 0
2: 0
3: 16
4: 161
920415036_920415039 -4 Left 920415036 1:205793439-205793461 CCACCACGTGCTGCACTGGAACC 0: 1
1: 0
2: 1
3: 7
4: 161
Right 920415039 1:205793458-205793480 AACCCACTAGCAATGGAATGTGG 0: 1
1: 0
2: 0
3: 7
4: 118
920415036_920415044 19 Left 920415036 1:205793439-205793461 CCACCACGTGCTGCACTGGAACC 0: 1
1: 0
2: 1
3: 7
4: 161
Right 920415044 1:205793481-205793503 CAGCTTGGCTAACTGCTGCAGGG 0: 1
1: 0
2: 2
3: 23
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920415036 Original CRISPR GGTTCCAGTGCAGCACGTGG TGG (reversed) Intronic
900090349 1:917602-917624 GGTCCCAGTGCTGCAGGTGTGGG + Intergenic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900857960 1:5201137-5201159 GATTCCAGTGCTGCCCATGGGGG + Intergenic
902215127 1:14929984-14930006 GGTGCCACTGCAGCACATGACGG - Intronic
904600758 1:31671426-31671448 GGTTCCAGGGCATCCGGTGGTGG + Intronic
909034609 1:70582722-70582744 GGTACCTGTGCAGGACGTGCAGG + Intergenic
909098978 1:71326836-71326858 GGTACAAGTGCAGGACGTGCAGG + Intergenic
910549526 1:88460196-88460218 GGTTACAGTGTAGCTAGTGGGGG - Intergenic
910846938 1:91612887-91612909 TGTCACTGTGCAGCACGTGGAGG - Intergenic
911555866 1:99343656-99343678 GGTTCATGTGCAGAACGTGCAGG - Intergenic
918593443 1:186265490-186265512 GGTACAAGTGCAGAACGTGCAGG + Intergenic
920054901 1:203184628-203184650 GGTTCCTGTGGAGCACAGGGAGG + Exonic
920415036 1:205793439-205793461 GGTTCCAGTGCAGCACGTGGTGG - Intronic
921754390 1:218836973-218836995 GGTTTCAGTGCTGGGCGTGGTGG - Intergenic
922938175 1:229436933-229436955 GGTTCCACAGCAGCCAGTGGAGG + Intergenic
923167410 1:231379241-231379263 TGTGCCACTGCAGCAGGTGGTGG - Intronic
923428618 1:233897053-233897075 GGTTCCCCTGTAGCACTTGGTGG + Intergenic
924469220 1:244325131-244325153 GATTCCAGCACAGCACGTCGTGG + Intergenic
1062810226 10:457933-457955 GGCCCCAGAGCAGCACGTGATGG + Intronic
1063438116 10:6050777-6050799 GATCCCAGTGCAGGACGAGGAGG + Intronic
1064466084 10:15583472-15583494 GGTACCTGTGCAGAACGTGCAGG - Intronic
1065367705 10:24952167-24952189 GCCTCCAGAGCAGCACGCGGGGG + Intronic
1065538031 10:26733645-26733667 GGTTCCAGTGGATGAGGTGGAGG + Intronic
1070471884 10:76788801-76788823 GGTACATGTGCAGCATGTGGAGG + Intergenic
1072516271 10:96186213-96186235 GGTTGGAGTGCAGCCCATGGAGG - Intronic
1072890049 10:99315941-99315963 GGTCCGAGAGCAGCAGGTGGCGG - Intergenic
1073104915 10:101027038-101027060 GGCTGCAGTGGAGCACCTGGGGG - Intronic
1075978898 10:126720292-126720314 GGTTCCAGGACAGCATCTGGTGG - Intergenic
1076619579 10:131778639-131778661 GGGGCCAGTGCAGCTGGTGGTGG + Intergenic
1077383500 11:2258346-2258368 GGTACCAGTGCAGGATGTGCAGG + Intergenic
1077554811 11:3220798-3220820 GGTGCCAGTGCCTCACCTGGGGG + Intergenic
1078259891 11:9695707-9695729 GATACCTGTGCAGCACGTGCAGG - Intronic
1081126387 11:39328688-39328710 GGTACCAGTGCACAACGTGCAGG + Intergenic
1083504994 11:63148398-63148420 GTTTCCACTGCAGAAGGTGGAGG + Intronic
1084518706 11:69650119-69650141 GGCACCTGTGCGGCACGTGGTGG + Intronic
1088367094 11:109051188-109051210 GGTCCAAGTGCAGAACGTGCAGG - Intergenic
1089753367 11:120667694-120667716 GGTACCTGGGCAGCTCGTGGTGG + Intronic
1092100906 12:5883061-5883083 GTTTCCAATGGGGCACGTGGTGG - Intronic
1092841946 12:12550849-12550871 GGTACATGTGCAGCACGTGCAGG - Intronic
1096613201 12:52816473-52816495 GGTCACACAGCAGCACGTGGTGG + Intergenic
1097033398 12:56105348-56105370 GGCTCCAGCAAAGCACGTGGTGG - Intronic
1097170577 12:57110568-57110590 GGAGCCAGTTCAGCACGAGGAGG + Intronic
1098835838 12:75423602-75423624 GGTACCTGTGCAGAACGTGCAGG + Intronic
1103557328 12:121774661-121774683 GGTTCCAGTCCTGGATGTGGCGG + Exonic
1104154706 12:126120253-126120275 GGTGCCAGTCCAGCAGCTGGGGG - Intergenic
1108199071 13:48024895-48024917 GGTACAAGTGCAGAACGTGCAGG - Intergenic
1108601640 13:52000052-52000074 GGGGCCACTGCAGCACTTGGAGG - Intronic
1108680521 13:52776333-52776355 GGTTCCTGTGCAGAGCGGGGTGG - Intergenic
1110510980 13:76350159-76350181 GGTACCTGTGCAGAACGTGCAGG + Intergenic
1118324472 14:64771896-64771918 GCTTCCAGTGCAGCAGGGAGAGG - Intronic
1120226410 14:81795589-81795611 GGTACATGTGCAGAACGTGGAGG - Intergenic
1120254796 14:82105551-82105573 GGTCCCTGTGCAGTACTTGGTGG + Intergenic
1122143302 14:99675008-99675030 GGTTGCAGGGCAGCACAGGGTGG + Intronic
1122611615 14:102987218-102987240 AGTTACAGAGCAGCACGTGCTGG + Intronic
1122929119 14:104925383-104925405 GGTTCCATTGCAGGAGGAGGTGG + Intronic
1124968414 15:34458939-34458961 GGTACATGTGCAGAACGTGGAGG + Intergenic
1126782946 15:52154062-52154084 CATTCCAGTGCACCAGGTGGCGG - Exonic
1127335281 15:57978647-57978669 GGTCCCTGTGCAGTACTTGGAGG + Intronic
1129270956 15:74419016-74419038 GGTTCCAGTGTGCCATGTGGAGG - Intronic
1129980129 15:79861381-79861403 GTTTCCAGGGCATCACATGGAGG + Intronic
1132165701 15:99587090-99587112 GGTACATGTGCAGAACGTGGTGG + Intronic
1135054119 16:19216415-19216437 GGTACCTGTGCAGAACGTGCAGG + Intronic
1138420023 16:56892937-56892959 GGGTCCACTGCAGGAGGTGGGGG - Exonic
1139557081 16:67719181-67719203 GTTTCCAGTGCAGCGCGGAGTGG - Exonic
1139692392 16:68649640-68649662 GGTCCCTGTGCAGTACTTGGAGG + Intronic
1139825621 16:69754886-69754908 GGCTCCAGTGGAGCACGTTGTGG - Exonic
1140388175 16:74561055-74561077 GGTTGCATGGCAGCACCTGGGGG + Intronic
1140649012 16:77066369-77066391 GGTACCTGTGCAGGACGTGCAGG + Intergenic
1141128091 16:81415550-81415572 GGTACCTGTGCAGAACGTGCAGG + Intergenic
1141624657 16:85254882-85254904 GGTCCCAGTGCTGGAGGTGGAGG + Intergenic
1142091553 16:88214537-88214559 GGGTACAGTGCAGAACGTGCAGG + Intergenic
1142637418 17:1266768-1266790 GATGCCAGTGTAGGACGTGGAGG + Intergenic
1143139272 17:4731849-4731871 CGCTTCAGTGCAACACGTGGAGG + Exonic
1145930771 17:28683684-28683706 GGTTCCACTCCTGCACCTGGTGG - Exonic
1146488880 17:33265628-33265650 GGTTCATGTGCAGGACGTGCAGG - Intronic
1149695231 17:58611309-58611331 GTTCCCAGTGCTGCACATGGAGG - Exonic
1150997131 17:70331527-70331549 GGTACATGTGCAGAACGTGGAGG - Intergenic
1152616811 17:81341663-81341685 GGCTCCAGTGGAGGACGCGGTGG + Intergenic
1159742083 18:72184605-72184627 GGATTCAGTGCAGCATGTGAAGG - Intergenic
1160816623 19:1038960-1038982 GGTCCCTGTGCAGTACTTGGCGG - Exonic
1162311945 19:9913302-9913324 GGTTCCAGGGTCGGACGTGGAGG - Intronic
1168406814 19:56114785-56114807 GGTACCAGGGCAGCAGGTGCTGG - Intronic
928501448 2:31900639-31900661 GGATACAGTGCAGAACGTGCAGG - Intronic
930753944 2:54957587-54957609 GTTTCCAGAGCAGCAGGTGCTGG - Intronic
932407737 2:71525013-71525035 GGTTCTAGTTCAGCAGGTGTGGG - Intronic
933760783 2:85670593-85670615 GGTTACAGTGCAGCACAGGTTGG + Intergenic
934855013 2:97724306-97724328 GGTTGCAGGGCAGCCCGTCGGGG - Exonic
937492008 2:122379704-122379726 GGTACATGTGCAGAACGTGGTGG + Intergenic
940240668 2:151559898-151559920 GGTACACGTGCAGAACGTGGAGG - Intronic
942211581 2:173676628-173676650 GGTTGCAGTGGAGCCCGTGGTGG + Intergenic
942380646 2:175386839-175386861 GGTTCAAGGGCAGCACCAGGTGG + Intergenic
942506772 2:176650284-176650306 GGTTTCAGTTCAGCCCCTGGTGG + Intergenic
943291570 2:186078749-186078771 GGTACCTGTGCACCACGTGCAGG - Intergenic
943331877 2:186569610-186569632 GGTACCTGTGCAGGACGTGCAGG - Intergenic
944807472 2:203296682-203296704 GGTTCATGTGCAGAACGTGCAGG + Intronic
946902596 2:224386209-224386231 TGTTCCATTTCAGCATGTGGAGG - Intronic
1169194882 20:3677702-3677724 GGGTCCAGTGAAGCAGGTGTCGG - Intronic
1169843062 20:9960824-9960846 GGTACATGTGCAGAACGTGGAGG - Intergenic
1170628852 20:18050921-18050943 GGTTACAGTGGAGCAGGGGGAGG + Intronic
1170872251 20:20217054-20217076 GGTTCAAGTGAAGGACTTGGAGG - Intronic
1173600228 20:44289696-44289718 GGATACAGAGGAGCACGTGGAGG + Intergenic
1175714785 20:61248085-61248107 GGGTACAGTGCAGCCAGTGGGGG + Intergenic
1175926085 20:62472292-62472314 GGTCCCAGTGGAGCAGGTGGTGG - Intronic
1176257145 20:64158533-64158555 GGGGCCAGTGGAGCAGGTGGGGG - Intronic
1177719986 21:24893380-24893402 GGTACAAGTGCAGAACGTGCAGG + Intergenic
1181372000 22:22426038-22426060 GTTTCCAGTGCAGGAGATGGTGG - Intergenic
1181491129 22:23261483-23261505 GGCTCCACTGCTGCACGCGGGGG - Exonic
1182397183 22:30045194-30045216 GGTCCCTGTGCAGTACTTGGTGG + Intergenic
1185298762 22:50068196-50068218 GGTCCCTGTGAAGCAGGTGGTGG + Intronic
949682779 3:6534906-6534928 GGTACCTGTGCAGAACGTGCAGG + Intergenic
954581358 3:51704483-51704505 GGTCACAGAGCAGGACGTGGAGG - Intergenic
954708640 3:52494196-52494218 CGTGCCAGGGCTGCACGTGGTGG - Intergenic
959690906 3:109197173-109197195 GGATACAGTGCAGAACGTGCAGG + Intergenic
961214314 3:125147792-125147814 GGTTCCAATGCCGCAGGTTGGGG - Intronic
968780874 4:2580452-2580474 GGTACATGTGCAGCACGTGCAGG - Intronic
970120013 4:12743328-12743350 GGTACATGTGCAGAACGTGGAGG + Intergenic
971834927 4:31750494-31750516 GGTACAAGTGCAGAACGTGCAGG + Intergenic
975736901 4:77389707-77389729 GGTTCCAGGGCAGCAGGAGGAGG + Intronic
978326257 4:107560604-107560626 GACTCCAGCACAGCACGTGGTGG - Intergenic
979157189 4:117410917-117410939 GGCACCAGGGCATCACGTGGTGG - Intergenic
980866604 4:138560706-138560728 GGCTCCAGTGGAGCAAGTTGTGG + Intergenic
981458044 4:144979131-144979153 GGTACCTGTGCAGGATGTGGAGG + Intronic
982601711 4:157459496-157459518 GGTACCTGTGCAGAACGTGCAGG - Intergenic
983023446 4:162708126-162708148 GTTTCCATTGCAGTACTTGGAGG + Intergenic
984676751 4:182557737-182557759 GGTGACAGTGCAGCAGCTGGAGG - Intronic
987688140 5:21231355-21231377 GGTACAAGTGCAGAACGTGCAGG - Intergenic
989138787 5:38181779-38181801 GGTACATGTGCAGAACGTGGAGG - Intergenic
992865426 5:80952828-80952850 GGGTCCAGTGCAGCACAGAGTGG - Intergenic
993637858 5:90367086-90367108 GTTTCCAGGGCAACCCGTGGAGG - Intergenic
998194517 5:140056102-140056124 CTTTCCAGTGGTGCACGTGGAGG - Intergenic
999071888 5:148752268-148752290 GGTTCATGTGCAGAACGTGCAGG + Intergenic
1000430394 5:161144570-161144592 GGTTCAAGTGCAGGATGTGCAGG - Intergenic
1002000027 5:176192198-176192220 CGTTCCAGGGAAGCACCTGGGGG - Intergenic
1004336767 6:14771228-14771250 GGTTCCACTGCAGCATGTGGGGG - Intergenic
1005083697 6:21981906-21981928 GGTTCCAGAGCAGGAAGAGGAGG - Intergenic
1005602944 6:27446329-27446351 GGTTCCAGAGCAGCACTCTGTGG + Intergenic
1005799686 6:29408515-29408537 GGTACCTGTGCAGAACGTGCAGG - Intronic
1007173614 6:39881671-39881693 GGTTGGAGTGCAGCATGTAGCGG - Intronic
1007409855 6:41655194-41655216 GGTTTCATTGCAGCAGGAGGAGG + Intergenic
1009746692 6:67825589-67825611 AATTCCAGTGCAGCACCTGCGGG - Intergenic
1014110027 6:117609942-117609964 GTTTCCAGTGGAGAACATGGTGG + Intergenic
1015749876 6:136549736-136549758 GGGCCCAGTGCAGCACGGTGGGG - Intronic
1018176574 6:161183201-161183223 GGCTCCACATCAGCACGTGGTGG - Intronic
1018282435 6:162201155-162201177 GGGTACAGTGCAGCACCTGCAGG - Exonic
1018908796 6:168090123-168090145 GGTCCCAGTGGTGGACGTGGAGG - Intergenic
1018926499 6:168210760-168210782 GGCCCGAGAGCAGCACGTGGAGG - Intergenic
1019703144 7:2483962-2483984 GGTTACAGAGCAGCACGCCGAGG - Intergenic
1022688858 7:32625199-32625221 GGTACATGTGCAGCAAGTGGAGG - Intergenic
1023364145 7:39446214-39446236 GCCTCCATTGCAGCACGGGGTGG + Intronic
1028256905 7:88610310-88610332 GGCTCCAGTGCTGTAAGTGGTGG + Intergenic
1028805392 7:95020494-95020516 GGTACATGTGCAGCACGTGCAGG + Intronic
1029112706 7:98221978-98222000 GCTTCCTGTGCAGCTCATGGTGG + Intronic
1038671489 8:29586632-29586654 TTTTCCAGTGCAGAACTTGGGGG - Intergenic
1045632395 8:104140706-104140728 GGTCCCAAGGCAGCAAGTGGGGG - Intronic
1046488776 8:114919663-114919685 GGTACCTGTGCAGGACGTGCAGG - Intergenic
1047390976 8:124451122-124451144 GCTTCCAGAGCAGCACCTGCAGG + Exonic
1049983451 9:925838-925860 TGTTCCAGTGTGGCACGTGGAGG + Intronic
1050416019 9:5418604-5418626 GGTTCCTGGGCAGCAGGTGGCGG + Intronic
1052221010 9:26022508-26022530 GGTACATGTGCAGCACGTGCAGG + Intergenic
1054790054 9:69248203-69248225 GGAGCCGGTGCAGCACGAGGAGG + Exonic
1058262171 9:102848019-102848041 GGTACCTGTGCAGAACGTGCAGG - Intergenic
1061929160 9:133823577-133823599 AGTTCCAGAACAGCACGAGGAGG + Intronic
1185511871 X:669841-669863 GGTACAAGTGCAGAACGTGCAGG - Intergenic
1191945031 X:66524314-66524336 GGTACAAGTGCACAACGTGGAGG + Intergenic
1195914770 X:109925298-109925320 TGTGCCACTGCAGCAGGTGGTGG + Intergenic
1197865748 X:131014859-131014881 GGTCCCAGTGCAGCAATGGGGGG + Intergenic
1199919341 X:152381589-152381611 GGTACATGTGCAGAACGTGGAGG + Intronic
1200328346 X:155265959-155265981 GGTACCTGTGCAGAACGTGCAGG - Intergenic
1200876610 Y:8162716-8162738 GTTTCCACTGCAGAACGTGGTGG - Intergenic
1202103584 Y:21337542-21337564 GTTTCCACTGCAGAACGTGATGG - Intergenic