ID: 920416012

View in Genome Browser
Species Human (GRCh38)
Location 1:205799818-205799840
Sequence GTCCAATGTTGGCCTGGGAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 152}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920416001_920416012 18 Left 920416001 1:205799777-205799799 CCCAGTGATCATCCGCCAGAGCT 0: 1
1: 0
2: 0
3: 5
4: 60
Right 920416012 1:205799818-205799840 GTCCAATGTTGGCCTGGGAAAGG 0: 1
1: 0
2: 0
3: 11
4: 152
920416005_920416012 6 Left 920416005 1:205799789-205799811 CCGCCAGAGCTCCTTGGGTGTGT 0: 1
1: 0
2: 0
3: 24
4: 176
Right 920416012 1:205799818-205799840 GTCCAATGTTGGCCTGGGAAAGG 0: 1
1: 0
2: 0
3: 11
4: 152
920416000_920416012 25 Left 920416000 1:205799770-205799792 CCATGTTCCCAGTGATCATCCGC 0: 1
1: 0
2: 1
3: 8
4: 74
Right 920416012 1:205799818-205799840 GTCCAATGTTGGCCTGGGAAAGG 0: 1
1: 0
2: 0
3: 11
4: 152
920416002_920416012 17 Left 920416002 1:205799778-205799800 CCAGTGATCATCCGCCAGAGCTC 0: 1
1: 0
2: 0
3: 5
4: 69
Right 920416012 1:205799818-205799840 GTCCAATGTTGGCCTGGGAAAGG 0: 1
1: 0
2: 0
3: 11
4: 152
920416007_920416012 -5 Left 920416007 1:205799800-205799822 CCTTGGGTGTGTCCATGTGTCCA 0: 1
1: 0
2: 6
3: 83
4: 1282
Right 920416012 1:205799818-205799840 GTCCAATGTTGGCCTGGGAAAGG 0: 1
1: 0
2: 0
3: 11
4: 152
920416006_920416012 3 Left 920416006 1:205799792-205799814 CCAGAGCTCCTTGGGTGTGTCCA 0: 1
1: 0
2: 2
3: 19
4: 186
Right 920416012 1:205799818-205799840 GTCCAATGTTGGCCTGGGAAAGG 0: 1
1: 0
2: 0
3: 11
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920416012 Original CRISPR GTCCAATGTTGGCCTGGGAA AGG Exonic
901056661 1:6451502-6451524 ATCCAATCTTGGCTTAGGAAAGG + Intronic
904481193 1:30794589-30794611 GATCAATGCTGGCCTGGGAATGG + Intergenic
905611926 1:39360544-39360566 GTTCAATGTAGGACTGGGCATGG + Intronic
906731651 1:48086740-48086762 GATCAATGGTTGCCTGGGAAGGG - Intergenic
907897044 1:58701826-58701848 CTCCCATGGTGGCCTGAGAATGG - Intergenic
908365267 1:63416284-63416306 GTCCTATGATGGTGTGGGAAAGG + Intronic
911163944 1:94708844-94708866 GACCAATGTGGGCCTGGGATGGG + Intergenic
915956092 1:160221168-160221190 GACAAATGCTGGCCTGGGAGAGG + Intronic
920416012 1:205799818-205799840 GTCCAATGTTGGCCTGGGAAAGG + Exonic
921082521 1:211754163-211754185 CTCCAATGTTTGCCAGGGTAGGG + Intronic
921110417 1:212031166-212031188 CTGCAATGTTGACCTTGGAAAGG - Intronic
922655801 1:227382577-227382599 GTCCAAGACTGGCCTGGGCATGG - Intergenic
1065008659 10:21402511-21402533 GTTCAGCGGTGGCCTGGGAATGG - Intergenic
1067156319 10:43783866-43783888 GTCCACTGTTGGCTTGGACAAGG + Intergenic
1067804311 10:49382551-49382573 GCCCAATCTAGGCCTGGGCAAGG - Intronic
1070215628 10:74377466-74377488 GTCCCATGTTCGCTTTGGAATGG + Intronic
1075255525 10:120923572-120923594 GGCCCATGTTGCCATGGGAATGG + Intergenic
1075564402 10:123493064-123493086 GTCCAAGGCTGGACTGGGCATGG + Intergenic
1080583714 11:33663906-33663928 GGCAATTGTTGGGCTGGGAAAGG + Intronic
1081778113 11:45690952-45690974 GTCCAAGTTAGGCCTGGGCATGG - Intergenic
1082826540 11:57583899-57583921 GTCCTTTGTTGGCCTTTGAATGG - Intergenic
1082926810 11:58557042-58557064 GGCAAATGTTGGCCAGGGTATGG + Intronic
1083310994 11:61783719-61783741 GTCCAAGGGTAGCCTGGAAAGGG - Intronic
1085296437 11:75434277-75434299 GTCCAATGTAGGGCTGGGAGTGG - Intergenic
1086950440 11:92885288-92885310 GTGGAATGATGGCCTGGTAATGG - Intronic
1088905138 11:114149799-114149821 TTCTAATGTTGGCTGGGGAATGG - Intronic
1089119164 11:116120076-116120098 GTCCATTATTGGCGTGGGAAGGG + Intergenic
1090614199 11:128500048-128500070 GTTCAAAGTTAGCCCGGGAAGGG + Intronic
1091030288 11:132180854-132180876 GGCCTATGTTGGCCTGGGGCTGG - Intronic
1092985087 12:13837483-13837505 GTCCAATGCTTGGCTGAGAAGGG - Intronic
1093056475 12:14560951-14560973 GTCAAACGTTGCCCTAGGAAGGG + Intronic
1097997096 12:65899559-65899581 GAGGAATTTTGGCCTGGGAAAGG + Intronic
1098085071 12:66833612-66833634 GTCCAGTGTTGGGTGGGGAAGGG - Intergenic
1100433394 12:94550452-94550474 GTCCAATTTTGTTGTGGGAAAGG + Intergenic
1101430380 12:104621874-104621896 GTCCAAAGGAGGCCTGGGAGAGG + Intronic
1103229113 12:119313161-119313183 GTCCAAGGTTGGACAGGTAATGG + Intergenic
1107205745 13:37785243-37785265 ATTCAATGTTGGCCTTGGAAAGG + Intronic
1107560926 13:41556736-41556758 GCCCAATATTGGGCTGGGCATGG + Intergenic
1109947016 13:69448138-69448160 ATCCAATGAGGGCCTGAGAAGGG + Intergenic
1110549481 13:76796201-76796223 GCACATTGTAGGCCTGGGAATGG - Intergenic
1110680768 13:78309356-78309378 GTTCAATGTATACCTGGGAAGGG - Intergenic
1112559316 13:100498156-100498178 TTCCAATGTTGGGCTGGGTGTGG - Intronic
1118057363 14:62094005-62094027 CTCCATTGTTGGCATGGAAAGGG + Intronic
1123114742 14:105889626-105889648 GTGCAGAGTTGGCCTGGGAGGGG + Intergenic
1123116911 14:105899027-105899049 GTGCAGGGTTGGCCTGGGAGGGG + Intergenic
1123121191 14:105917892-105917914 GTGCAGGGTTGGCCTGGGAGGGG + Intergenic
1123403894 15:20009461-20009483 GTGCAGGGTTGGCCTGGGAGGGG + Intergenic
1123477009 15:20597502-20597524 GTCCAGTGTTGACCTGGGAGGGG - Intergenic
1123513234 15:21016107-21016129 GTGCAGGGTTGGCCTGGGAGGGG + Intergenic
1123641004 15:22402862-22402884 GTCCAGTGTTGACCTGGGAGGGG + Intergenic
1126846657 15:52766606-52766628 CACCCATGCTGGCCTGGGAAAGG + Intronic
1127746158 15:61976458-61976480 GACCAATGTTGTCCAGGGACTGG + Intronic
1129233653 15:74210712-74210734 GTGCAATATTGGGCTGGGGACGG - Intronic
1130850458 15:87788604-87788626 GTCCAAAGTTGGCTTAGCAATGG - Intergenic
1132501939 16:288387-288409 GTTCACTGTTGCCCTGGGAGGGG - Intronic
1134123940 16:11603536-11603558 CTCCAGTTTTAGCCTGGGAATGG + Intronic
1137267423 16:46880680-46880702 GTCCAACGTTGGCCTGGACCAGG - Intergenic
1137772719 16:51030035-51030057 GTCTAATGCAGGCATGGGAAGGG + Intergenic
1142131156 16:88432085-88432107 GCCCCATCTTTGCCTGGGAAGGG + Exonic
1142670011 17:1483713-1483735 GGCCAATGTAGGTCTGGGATCGG + Exonic
1145248826 17:21286385-21286407 GCCCTATGTGGGCCTGGGGAGGG + Intronic
1151406090 17:73887361-73887383 GTCCAAAGTTCCACTGGGAAAGG + Intergenic
1151896224 17:76982653-76982675 GTCCCATGTCAGCCTGGAAATGG - Intergenic
1152275412 17:79353824-79353846 GTGCAAGGTTCGCCTGGGGAAGG - Intronic
1152349258 17:79774674-79774696 TTCCCATGTTGGCCTGGGAGGGG - Intergenic
1153655862 18:7281629-7281651 GTCCAATCTTGTCCAAGGAAGGG - Intergenic
1153755674 18:8280497-8280519 GACCAAGGTTGGGCTGGGCAAGG + Intronic
1155132534 18:22952680-22952702 TTCCATTGCTGACCTGGGAAAGG - Intronic
1158973908 18:62693086-62693108 GGCCAAGGTGGGCCTGAGAATGG + Intergenic
1159195377 18:65107406-65107428 GTCGAATGATGGGCTGAGAAAGG + Intergenic
1161650715 19:5482807-5482829 ATCCAATGTGGGGTTGGGAAAGG + Intergenic
1163264412 19:16209993-16210015 GTTCAATGGTGGCCAGGAAATGG - Intronic
1202711717 1_KI270714v1_random:22829-22851 ATCCAATCTTGGGTTGGGAAGGG - Intergenic
925621435 2:5797320-5797342 GTTCAGTGTTGGCTTTGGAATGG - Intergenic
926247695 2:11133070-11133092 GTTGACTGTTGTCCTGGGAACGG - Exonic
926541265 2:14183225-14183247 GGCCACGGGTGGCCTGGGAAAGG - Intergenic
929174051 2:38959663-38959685 GTCCACTCTCCGCCTGGGAACGG + Intronic
932429841 2:71667661-71667683 GGCCATGGTTGGCCTGGGAGGGG + Intronic
933416944 2:81998370-81998392 GGCCAATGGTTGCCTGGCAAAGG - Intergenic
934900726 2:98157862-98157884 GTTCAATGTTGCCCTGGGAGAGG - Intronic
935225506 2:101048649-101048671 GTCCATTCATGGCCTGTGAACGG - Intronic
939767072 2:146264106-146264128 GTCCAAAGTTTGGCTGGAAATGG - Intergenic
940974391 2:159926999-159927021 GCCCAGTGTGGGGCTGGGAAAGG - Intergenic
943629393 2:190233865-190233887 ATCAAATGTTGGGCTGGGTATGG + Intronic
943643922 2:190387777-190387799 CTACAATGTTGGCATTGGAAGGG - Intergenic
948863376 2:240763615-240763637 GTACAAGGCTGGCCTGGGGAGGG - Intronic
948867962 2:240784870-240784892 GCCCAATGCTGGCCTGTGCAGGG - Intronic
1170861933 20:20113462-20113484 GTACAGTGTGGGCCTAGGAATGG - Intronic
1171085110 20:22231275-22231297 GTGCAATGCTGGCCTAGGCAAGG + Intergenic
1171845820 20:30273931-30273953 CTCCAATGTGGCTCTGGGAATGG - Intergenic
1172055294 20:32150528-32150550 GTCCAAGGTGGGCCTGGGGCTGG + Intronic
1174233609 20:49068705-49068727 GTTCAATAGTGGCCTTGGAAAGG - Exonic
1175306072 20:57976429-57976451 CTCCCAGGTTGGCCTAGGAAAGG + Intergenic
1180112708 21:45671157-45671179 TTTCAATGCTGTCCTGGGAAAGG + Intronic
1183984388 22:41561597-41561619 CTGGAATGTTGGGCTGGGAAGGG + Intronic
1184937976 22:47739005-47739027 GTTCAATTTTGGTCTAGGAATGG + Intergenic
1185300046 22:50074778-50074800 GTCCAGTGTTGCCGTGGCAATGG - Intronic
950215654 3:11156356-11156378 GGCCAATGCTGGGCTGGGAGTGG + Intronic
951150809 3:19287872-19287894 GTCGAATGTGGGGCTGGGCATGG - Intronic
952359429 3:32615091-32615113 GTGCAATATGAGCCTGGGAAGGG - Intergenic
953636935 3:44671844-44671866 GTCCACTGATGGCCTTGGGAGGG - Intergenic
954649249 3:52150222-52150244 GTCCAAGGCTAGCATGGGAAGGG - Intronic
956263737 3:67374800-67374822 GTCCAATTTTGTTGTGGGAAAGG - Intronic
957518270 3:81285088-81285110 GATCAATGTTTGCCTGGGATGGG + Intergenic
960550141 3:118966867-118966889 TTCCAAAGATGTCCTGGGAATGG - Intronic
961587664 3:127947279-127947301 GTCCAATCAGGGCCTGGGATGGG + Intronic
962753859 3:138453543-138453565 CTCCAATGATGGCTTTGGAAGGG + Intronic
965691453 3:171361184-171361206 GTCTGATGTTGGGCTGGGGAAGG - Intronic
966225145 3:177590232-177590254 GTCAGATGTTGTCCTGGGAGTGG + Intergenic
967194455 3:187014475-187014497 CCCCAGTGCTGGCCTGGGAAAGG - Intronic
967491335 3:190094565-190094587 GGACAATGGTGGCCTTGGAAAGG + Intronic
969690572 4:8701897-8701919 GCCCGATGCTGGCCTGGGAGTGG + Intergenic
969946404 4:10787853-10787875 GTCTAGTGTTGGGCTGGGCATGG + Intergenic
971583531 4:28374914-28374936 GTGGAATGTTGGCTTGGAAATGG + Intronic
981217004 4:142182014-142182036 GTGCAATGTTAGCTTAGGAAGGG - Intronic
988254864 5:28808809-28808831 GTACTATGTCGGCCTGGCAAAGG + Intergenic
990538360 5:56746915-56746937 GTCCAATTTTGGGATGGAAAGGG - Intergenic
993093617 5:83457485-83457507 GTCCAGTGTTGGGGAGGGAAAGG + Intergenic
995732341 5:115259277-115259299 ATCCAATGAAGGTCTGGGAAGGG + Intronic
1000154597 5:158538466-158538488 GTCCAGGGTGTGCCTGGGAAAGG - Intergenic
1003076611 6:2988567-2988589 GTCGCCTGGTGGCCTGGGAAGGG + Intronic
1006574530 6:35035012-35035034 GGCAAATGTTGGCTTGGGAACGG + Intronic
1007264400 6:40586222-40586244 TTCTAAGGTTGGCCTGGGCAGGG - Intronic
1009325130 6:62339381-62339403 CTCCAGGGTTGGCCTGGAAAAGG + Intergenic
1009328608 6:62385464-62385486 GGCCAATGTTGTCCTGATAAAGG - Intergenic
1010575552 6:77525787-77525809 GTCTAATGGTTGCTTGGGAAAGG - Intergenic
1014922212 6:127226652-127226674 ATTCTATTTTGGCCTGGGAAGGG - Intergenic
1015138326 6:129899955-129899977 GTCCTGTGTAGGCCTTGGAAAGG + Intergenic
1018242922 6:161795738-161795760 GTCCAATGTTGGTCAGGCACAGG + Intronic
1020104039 7:5412929-5412951 GTACACTGGTGGCCTGGGAGAGG + Intronic
1020107337 7:5428185-5428207 CTCCACTGTTTGGCTGGGAAAGG + Intergenic
1020771891 7:12404959-12404981 GTTCAAGGTTGGCCTAGGCATGG + Intergenic
1022333251 7:29399669-29399691 CACCATTGTGGGCCTGGGAAGGG - Intronic
1027190708 7:75994244-75994266 TTCCAATGAGGGCCTTGGAAAGG - Intronic
1027238888 7:76314449-76314471 GTCCTATCTGGGCCTGGGAGTGG - Intergenic
1030239210 7:107302347-107302369 GATCAGTGTTTGCCTGGGAATGG + Intronic
1031989569 7:128188906-128188928 GTCCCATGTCAGCCAGGGAACGG + Intergenic
1032055922 7:128684159-128684181 GTCCAAGGCTGGCTTGGAAAGGG + Exonic
1032253569 7:130278911-130278933 GTCCATTGTAGGCCTGGCCAGGG - Intronic
1034732333 7:153398984-153399006 GTCCCATGGTGGGCTGGGAGAGG + Intergenic
1039449513 8:37660529-37660551 AGGCAATGTTGGCATGGGAAGGG + Intergenic
1039890667 8:41683430-41683452 GTCCCAGGTGGGCCTGGGCACGG - Intronic
1046714222 8:117549568-117549590 GGCCATTGTTGGCCTGACAATGG + Intergenic
1046907704 8:119591842-119591864 GTACAATGTTAGCGTGGGAAGGG + Intronic
1047710351 8:127545434-127545456 GTACAATGTTGGCCTGGATTGGG + Intergenic
1048873228 8:138815882-138815904 GTCCAACATGGGCCTGAGAAGGG - Intronic
1049435612 8:142584859-142584881 GTCCTACATTGGCTTGGGAAAGG + Intergenic
1049935423 9:497306-497328 CTCCAAGGTTGGCGTTGGAAAGG + Intronic
1053362195 9:37496301-37496323 CCCAAATGCTGGCCTGGGAATGG + Intronic
1053504363 9:38628766-38628788 GTGAAATGTTTTCCTGGGAAAGG - Intergenic
1054162253 9:61681913-61681935 CTCCAATGTGGCTCTGGGAATGG + Intergenic
1056836658 9:89961214-89961236 GTCCACTGTTTGCCTAGGGATGG + Intergenic
1058798828 9:108525050-108525072 TTTCACTGTTGGCCTGTGAAAGG + Intergenic
1059035108 9:110746106-110746128 GTCCCATGTTGGCCTGAGCTTGG - Intronic
1059634784 9:116160046-116160068 GTCTGGGGTTGGCCTGGGAACGG + Intronic
1062460415 9:136660443-136660465 GTCTAGTCTTGGCCTGGGGAGGG + Intronic
1186283220 X:8016925-8016947 GTCCAAGGTTGGCCTGGCTGGGG - Intergenic
1192603467 X:72489006-72489028 GTCTGATGTTGGCCTAGGGAAGG - Exonic
1195383143 X:104289873-104289895 GTAAAATGTTGCCCTGAGAAGGG + Intergenic
1195738772 X:108040932-108040954 GTTCCATGTGAGCCTGGGAAAGG + Intergenic
1195738823 X:108041638-108041660 GTTCCATGTGAGCCTGGGAAAGG + Intergenic
1195829601 X:109041427-109041449 GATCAATGTTTGCCTGGGAGTGG - Intergenic
1198784654 X:140273956-140273978 GCAGAATGTTGGACTGGGAAGGG - Intergenic
1201273347 Y:12276940-12276962 ATCCAATGTTTGGCTGGGCATGG - Intergenic