ID: 920416400

View in Genome Browser
Species Human (GRCh38)
Location 1:205801541-205801563
Sequence GTTTCTATCTCCAAGGGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 145}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920416392_920416400 22 Left 920416392 1:205801496-205801518 CCACAGGGCTGGGGCCGAGGCTG 0: 1
1: 0
2: 7
3: 75
4: 656
Right 920416400 1:205801541-205801563 GTTTCTATCTCCAAGGGCTTTGG 0: 1
1: 0
2: 1
3: 14
4: 145
920416396_920416400 8 Left 920416396 1:205801510-205801532 CCGAGGCTGGGGAGATTAGAGAG 0: 1
1: 0
2: 0
3: 20
4: 314
Right 920416400 1:205801541-205801563 GTTTCTATCTCCAAGGGCTTTGG 0: 1
1: 0
2: 1
3: 14
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920416400 Original CRISPR GTTTCTATCTCCAAGGGCTT TGG Intronic
901295171 1:8155833-8155855 GCTTCCTTCTCCAAGGGCTGAGG + Intergenic
902058248 1:13620070-13620092 ATTTCTACATCCAAGGGCTCCGG + Intergenic
902154154 1:14470311-14470333 GTTGCTATCCCCAAGTGCTAAGG - Intergenic
902159245 1:14516383-14516405 CTCTCTACATCCAAGGGCTTGGG - Intergenic
902972505 1:20064141-20064163 TTTTCTATTTCCAAAGGCATTGG - Intronic
903451928 1:23459521-23459543 GATTCTCTCTCCAAGGACTTTGG + Intronic
903824600 1:26134287-26134309 GTTTCAATCTCCAAGTATTTGGG - Intergenic
905370641 1:37480988-37481010 GTTTTTACCTCCAAAGGCTGGGG - Intronic
905576397 1:39048208-39048230 GCTTCTACCTCCCGGGGCTTAGG + Intergenic
908220013 1:61996032-61996054 TCTTCTATCTCAAAAGGCTTGGG - Intronic
910616297 1:89202377-89202399 TGTTCCAACTCCAAGGGCTTTGG - Intergenic
911271257 1:95803939-95803961 ATTTCTTTCTCCAAGGGCCTAGG + Intergenic
913687189 1:121243409-121243431 CTCTTCATCTCCAAGGGCTTTGG - Intronic
914039048 1:144031047-144031069 CTCTTCATCTCCAAGGGCTTTGG - Intergenic
914150406 1:145036880-145036902 CTCTTCATCTCCAAGGGCTTTGG + Intronic
918560256 1:185857233-185857255 TTTTCTATCTGAAAGGTCTTTGG + Intronic
918875936 1:190043717-190043739 GTTTCTATCTCCCATAGTTTTGG - Intergenic
920416400 1:205801541-205801563 GTTTCTATCTCCAAGGGCTTTGG + Intronic
920474516 1:206261930-206261952 CTCTTCATCTCCAAGGGCTTTGG - Intronic
921506100 1:215972221-215972243 GTTTCTAGCTCCAAGAGCTGAGG + Intronic
921978712 1:221230833-221230855 GTTTCTATTTCCCAGGGCTGTGG - Intergenic
1063529692 10:6819331-6819353 GTTTCTCCCTCCATGGGATTGGG + Intergenic
1068069544 10:52179622-52179644 ATGTCTATCTCACAGGGCTTGGG + Intronic
1071477978 10:86041343-86041365 ATTACTGCCTCCAAGGGCTTAGG + Intronic
1073897886 10:108184332-108184354 GTTTTTCCCTCCAAGGCCTTGGG - Intergenic
1075065172 10:119284602-119284624 GCTTCTGTGTCCAGGGGCTTTGG + Intronic
1075092186 10:119450078-119450100 GTTTTTAGTGCCAAGGGCTTTGG + Intronic
1075839700 10:125490172-125490194 GTATCTATCTCACAGGGCTATGG + Intergenic
1079134157 11:17766811-17766833 GTTTTTAACTCCAGGAGCTTTGG + Intronic
1079590336 11:22175851-22175873 GTGTCTTTATCAAAGGGCTTGGG - Intergenic
1081570797 11:44289648-44289670 ATTTCTATCTCAAAGGACTAGGG + Intronic
1085243327 11:75076413-75076435 GATAATATCTCAAAGGGCTTGGG - Intergenic
1088792126 11:113235353-113235375 CTCTCTTTCTCCAAGGGGTTGGG + Intronic
1090244975 11:125209775-125209797 GTTTCTATTTTCAGGGCCTTGGG - Intronic
1094284007 12:28772226-28772248 GTTCCTAACTCAAAGGGCTCTGG + Intergenic
1095126555 12:38485580-38485602 TTTTCTATGTCCAAAGGATTTGG - Intergenic
1098090963 12:66900608-66900630 GTTTCTATCTGCAAGGCCTAAGG + Intergenic
1099675159 12:85751109-85751131 GTTTATTTCTCCCAGGGATTTGG + Intergenic
1103310119 12:119999173-119999195 ATTTCTATCTACAAGAACTTTGG + Intronic
1106355977 13:28983699-28983721 GTTTCTGGTTCCAAGGGCCTGGG - Intronic
1112922791 13:104636263-104636285 ATTCCTATTTCCAAGGGATTAGG + Intergenic
1114968130 14:27990474-27990496 GTATCTATCTACAGGAGCTTAGG + Intergenic
1119196143 14:72718001-72718023 GATCCTACCTCCAAGGGGTTTGG + Intronic
1122057690 14:99115929-99115951 ATATATATGTCCAAGGGCTTTGG + Intergenic
1122821319 14:104346801-104346823 GTTTCTGGCTCCAGCGGCTTCGG - Intergenic
1125179084 15:36861072-36861094 GTAGCTACCTCGAAGGGCTTTGG - Intergenic
1125199353 15:37087234-37087256 GTTTCTATTCCCAGTGGCTTTGG + Intronic
1126251645 15:46574465-46574487 CTTTCTATTTCCAAGGCATTTGG + Intergenic
1126412159 15:48383598-48383620 GTTTCTGTCTCCATGGAATTTGG + Intergenic
1136098774 16:27977999-27978021 GTTACTGTCTCCAGGGGCTCTGG + Intronic
1137591429 16:49696503-49696525 TTTTCTACCTCCAGTGGCTTTGG + Intronic
1137741266 16:50777831-50777853 GTTTCTATTTCCAGGGTCTGAGG - Exonic
1139611167 16:68059959-68059981 GTTTCCATTTCCTGGGGCTTTGG + Intronic
1140514669 16:75533304-75533326 ATTTCTACCTCCAAGGGACTTGG - Intronic
1143925289 17:10364125-10364147 CTTTCCTTCTCCAAGGACTTGGG - Intronic
1144253140 17:13439630-13439652 GTTTCTGTCTGCTAGAGCTTAGG + Intergenic
1150898303 17:69239331-69239353 GTTTCTTTCTCCAACGACCTGGG - Intronic
1158433591 18:57416245-57416267 TTTGCTATCTCCATTGGCTTGGG - Intergenic
1159782173 18:72672965-72672987 CTTTCTCTCTGCAAGTGCTTAGG - Intergenic
1163646252 19:18490854-18490876 GGTTCTATCTCCACTGGCCTGGG + Intronic
1163893090 19:20034003-20034025 GTTTTTCTCTCCAATGCCTTGGG - Intronic
1168322900 19:55521042-55521064 GTTTCTCCCTCAAAGGGCTGTGG - Intergenic
925157749 2:1660461-1660483 GTTTCTCTCTCCTCGGGCTTTGG - Intronic
925894252 2:8459134-8459156 CTTTCTATTTCCAATTGCTTTGG - Intergenic
926561898 2:14426865-14426887 GTTTCTCTCTCCTTGGGCTATGG + Intergenic
928933043 2:36645374-36645396 CTTTCTATATACAGGGGCTTGGG + Intronic
930083692 2:47476584-47476606 ATTTCTATCTTCAAGGGACTAGG - Intronic
930292762 2:49516492-49516514 TGTTCTTTCTCCAAGGGATTGGG + Intergenic
932093189 2:68824852-68824874 GGTTCTATCTTCAAGGGCCTTGG - Intronic
932373653 2:71214803-71214825 TTGTCTAGTTCCAAGGGCTTTGG + Intronic
940471744 2:154110206-154110228 GTTTTTATTTCCAAAGGTTTGGG + Intronic
941897559 2:170644731-170644753 TTGTCTCTCACCAAGGGCTTGGG + Intronic
944052502 2:195486882-195486904 GTTTCAATCTCCAACAACTTAGG - Intergenic
945512119 2:210715375-210715397 GCTTCTTCCTCCAAGGGGTTGGG + Intergenic
948360256 2:237414916-237414938 CTTTCTATTTAAAAGGGCTTAGG - Intergenic
1169867018 20:10212890-10212912 GTATCCATTTCCAAGGCCTTGGG - Intergenic
1171264791 20:23762530-23762552 TTTGCTATTTCCAAGTGCTTAGG - Intergenic
1172339372 20:34144056-34144078 TTCTCTGTCTCCCAGGGCTTGGG + Intergenic
1179535832 21:42051252-42051274 GTTTCTTTTCCCAAGTGCTTTGG + Intergenic
1180677885 22:17600599-17600621 GTTTCTATCACCAAAGGTTTGGG - Intronic
1181325636 22:22043641-22043663 CTCTCTGTATCCAAGGGCTTGGG + Intergenic
1182029855 22:27149912-27149934 GATTCTACATCCAAGGGCTCTGG + Intergenic
1184248579 22:43247956-43247978 GGTTGCATCTCGAAGGGCTTTGG + Intronic
1184306744 22:43608202-43608224 GTTTCTATTTCCAAGGACCTGGG - Intronic
1184558240 22:45245443-45245465 ATTTTTATCTCCAAATGCTTGGG + Intergenic
950015752 3:9753776-9753798 GTTTCTATCTAGAAGGGCTTTGG + Intronic
952862651 3:37827006-37827028 CTTTCTATATCCATGTGCTTTGG + Intergenic
954317542 3:49809397-49809419 GTGTCAAACTCCAAGGGCTGGGG + Exonic
960113083 3:113864566-113864588 GTATCCATGTCCTAGGGCTTTGG - Intronic
961107808 3:124257066-124257088 GTTTCTCTCTCCATGGCCTCAGG - Intronic
962750678 3:138432933-138432955 GATCCTGTCTCCAAGGGGTTTGG + Intergenic
966923094 3:184627267-184627289 GGCTCTACCTCCAGGGGCTTAGG - Intronic
968395229 4:230114-230136 GTTTCTTTTTACAATGGCTTTGG + Intergenic
968521008 4:1034691-1034713 CTGTCCACCTCCAAGGGCTTGGG + Intergenic
970128646 4:12842421-12842443 GTTTCTACCTTCATGAGCTTAGG - Intergenic
970561247 4:17284153-17284175 GTTTCTTTGTCCAAGACCTTGGG + Intergenic
974688138 4:65258590-65258612 GTTTATATCTTCAAGGACTGAGG + Intergenic
975234882 4:71982041-71982063 GTTAATAGCTCCAAGGGATTTGG - Intergenic
976440297 4:85065469-85065491 GTTTCTATGTCCAAAAGTTTTGG - Intergenic
977989852 4:103428027-103428049 GTTTATAAATTCAAGGGCTTAGG + Intergenic
978931025 4:114312239-114312261 ATTTCTATCTCCAACGGATGAGG - Intergenic
980523771 4:133962650-133962672 GTTTCTAGCTTGAAGGGATTGGG + Intergenic
980572916 4:134646070-134646092 GTTTCTCTCTCCAATAGATTAGG + Intergenic
981449771 4:144883197-144883219 GATTTTATCTTAAAGGGCTTGGG + Intergenic
982734480 4:158991274-158991296 GATTCTGTCTCCAAGGTCTTTGG - Intronic
983344973 4:166516868-166516890 ATTTCTAACTTTAAGGGCTTTGG - Intergenic
983381907 4:167006252-167006274 TTTTGTAATTCCAAGGGCTTGGG - Intronic
985289340 4:188371753-188371775 GTTTCTGGCTCAAAGAGCTTTGG - Intergenic
987010542 5:13758779-13758801 GCTTCTCTCTCCAAGAGTTTGGG - Intronic
987632208 5:20488799-20488821 TTTTCTATCTCTAAGGTCTTAGG - Intronic
989738679 5:44741222-44741244 GTTTCTATCAACAAGGGTTAGGG + Intergenic
990516424 5:56534930-56534952 GTTTCTATTGCCAGGGGCTGGGG - Intronic
991379241 5:66002328-66002350 GTTGCTATTTGCAATGGCTTGGG - Intronic
993392694 5:87340434-87340456 GTTACTATATCCAAGGGAGTAGG - Intronic
994449536 5:99924547-99924569 GTATCGATCTCCAAGGGGCTAGG - Intergenic
997884776 5:137620382-137620404 GTTTCTAACTGCAGGGGCTGGGG + Exonic
998297994 5:140989990-140990012 TTGTCTATCTCCAAGGGCGTGGG + Intronic
998810745 5:145963695-145963717 GTCTCTGTCTCCAAGGGACTTGG - Intronic
1000311881 5:160052788-160052810 TTTTCTGTCTCCAAGGCTTTGGG + Intronic
1002715695 5:181225288-181225310 GGTTCTGTCTTCAAGGACTTTGG + Intronic
1002911335 6:1493355-1493377 CTTTCTTACTCCAAGGGCTCAGG - Intergenic
1003009689 6:2414923-2414945 GTTTCTATCCCAAAGGGATCCGG - Intergenic
1006950319 6:37816837-37816859 GTTTCTTTCTCCTGGGGATTGGG + Intergenic
1007369196 6:41415084-41415106 GTTGCTCTCTCTAATGGCTTAGG + Intergenic
1007670621 6:43550190-43550212 GTTTCCATAGCCAAGTGCTTGGG - Intronic
1008233795 6:49018854-49018876 GTTTCTCTATACAAGGGGTTTGG + Intergenic
1008422303 6:51315942-51315964 TTTTTTATGTTCAAGGGCTTGGG - Intergenic
1011370734 6:86634118-86634140 GCTTCTGCCTCCAAAGGCTTGGG + Intergenic
1012769898 6:103419023-103419045 GAATATATCTCCAATGGCTTTGG - Intergenic
1013051118 6:106536181-106536203 TTTCCTATCTACTAGGGCTTAGG + Intronic
1013319187 6:108970364-108970386 CCTTCTTTCTCCTAGGGCTTTGG - Intronic
1015087565 6:129313838-129313860 GTTTCTACCATCAAGGGCTTCGG + Intronic
1017332355 6:153214613-153214635 GTTTGTGTCTCCATGGGATTGGG + Intergenic
1019879357 7:3844746-3844768 ACTTCTGTCTCCAAGGCCTTGGG - Intronic
1028315637 7:89398862-89398884 TTTTATATCTCCAGGTGCTTTGG - Intergenic
1030552706 7:110984031-110984053 GATTCTCTCTCAAAGGGATTTGG + Intronic
1031910237 7:127509057-127509079 GAATCTATCTTCAAGGGCTAAGG + Intergenic
1032768527 7:135023950-135023972 GTTACAATGTCCCAGGGCTTTGG + Intronic
1036984825 8:13517308-13517330 GTTTCTATTTCTATTGGCTTGGG + Intergenic
1037420861 8:18700908-18700930 GTTATAATCTCCAAGGTCTTTGG + Intronic
1039228499 8:35417276-35417298 CTTTCTATCTCCATGAGTTTTGG + Intronic
1040563513 8:48545629-48545651 GTTTGTCCCTCCCAGGGCTTGGG + Intergenic
1040728951 8:50419294-50419316 CTTTCTATCTCCAATGGCAATGG + Intronic
1044751490 8:95420746-95420768 GTTTCTAAATCCAAAGGCTGTGG + Intergenic
1048176300 8:132155526-132155548 GTACCTATCTCCTAGGGCTGTGG - Intronic
1048521770 8:135162312-135162334 TCTTCTATCCCCAAGAGCTTTGG + Intergenic
1048779176 8:137982598-137982620 GCTGCTATCACCAAGGGCCTGGG + Intergenic
1048921482 8:139235212-139235234 TTTGCTATCTCAAAGTGCTTGGG - Intergenic
1049134018 8:140877531-140877553 GTCTCTAACTCCTAGGGTTTGGG + Intronic
1051816576 9:21114399-21114421 GTTTCTAACTCTAAGGCTTTAGG + Intergenic
1056473118 9:86925154-86925176 ATTTCTATATCCAGGAGCTTAGG + Intergenic
1057142657 9:92736998-92737020 TTCTCTATCTCCTAGGGGTTTGG - Intronic
1059341323 9:113599085-113599107 TTTTCTGTCTCCAAAGGCTTTGG + Intergenic
1062614393 9:137389444-137389466 GGTTCTGTCTCCAAGGCCCTCGG - Intronic
1062714778 9:138003388-138003410 GTCTCTATCTCCAAAGTGTTGGG + Intronic
1189099832 X:38177246-38177268 GTTTCTATCTCCATAGCCTCAGG - Intronic
1192005425 X:67206901-67206923 GTTTCTCCCTCCCAGGCCTTGGG - Intergenic
1193847125 X:86486519-86486541 GTTTCAATCTCCAAGGGAGATGG + Intronic
1196304194 X:114082221-114082243 TTTTCTATCTCCAAAAACTTTGG + Intergenic
1196692619 X:118576556-118576578 GTACCTGTCTCCAAGGGCTGTGG + Intronic
1201636358 Y:16127317-16127339 GTTTGTATCTGACAGGGCTTGGG - Intergenic