ID: 920418173

View in Genome Browser
Species Human (GRCh38)
Location 1:205812663-205812685
Sequence TAGTATCCCCAACCCCGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 47}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920418159_920418173 19 Left 920418159 1:205812621-205812643 CCCTATCCCCTCCTCCCAGGCGG 0: 1
1: 0
2: 0
3: 28
4: 295
Right 920418173 1:205812663-205812685 TAGTATCCCCAACCCCGAGGAGG 0: 1
1: 0
2: 0
3: 5
4: 47
920418164_920418173 13 Left 920418164 1:205812627-205812649 CCCCTCCTCCCAGGCGGGGACAA 0: 1
1: 0
2: 2
3: 12
4: 255
Right 920418173 1:205812663-205812685 TAGTATCCCCAACCCCGAGGAGG 0: 1
1: 0
2: 0
3: 5
4: 47
920418167_920418173 8 Left 920418167 1:205812632-205812654 CCTCCCAGGCGGGGACAAAAAAG 0: 1
1: 0
2: 1
3: 13
4: 120
Right 920418173 1:205812663-205812685 TAGTATCCCCAACCCCGAGGAGG 0: 1
1: 0
2: 0
3: 5
4: 47
920418157_920418173 27 Left 920418157 1:205812613-205812635 CCAGGACGCCCTATCCCCTCCTC 0: 1
1: 0
2: 1
3: 21
4: 265
Right 920418173 1:205812663-205812685 TAGTATCCCCAACCCCGAGGAGG 0: 1
1: 0
2: 0
3: 5
4: 47
920418169_920418173 4 Left 920418169 1:205812636-205812658 CCAGGCGGGGACAAAAAAGACCC 0: 1
1: 0
2: 1
3: 4
4: 74
Right 920418173 1:205812663-205812685 TAGTATCCCCAACCCCGAGGAGG 0: 1
1: 0
2: 0
3: 5
4: 47
920418166_920418173 11 Left 920418166 1:205812629-205812651 CCTCCTCCCAGGCGGGGACAAAA 0: 1
1: 0
2: 0
3: 4
4: 123
Right 920418173 1:205812663-205812685 TAGTATCCCCAACCCCGAGGAGG 0: 1
1: 0
2: 0
3: 5
4: 47
920418161_920418173 18 Left 920418161 1:205812622-205812644 CCTATCCCCTCCTCCCAGGCGGG 0: 1
1: 0
2: 2
3: 31
4: 396
Right 920418173 1:205812663-205812685 TAGTATCCCCAACCCCGAGGAGG 0: 1
1: 0
2: 0
3: 5
4: 47
920418168_920418173 5 Left 920418168 1:205812635-205812657 CCCAGGCGGGGACAAAAAAGACC 0: 1
1: 1
2: 1
3: 6
4: 106
Right 920418173 1:205812663-205812685 TAGTATCCCCAACCCCGAGGAGG 0: 1
1: 0
2: 0
3: 5
4: 47
920418165_920418173 12 Left 920418165 1:205812628-205812650 CCCTCCTCCCAGGCGGGGACAAA 0: 1
1: 0
2: 1
3: 8
4: 160
Right 920418173 1:205812663-205812685 TAGTATCCCCAACCCCGAGGAGG 0: 1
1: 0
2: 0
3: 5
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920418173 Original CRISPR TAGTATCCCCAACCCCGAGG AGG Intronic
912264075 1:108137826-108137848 TAGTATTCCCATCCCCAAGATGG + Intronic
917704452 1:177617804-177617826 TAGTATGCCCAAAACTGAGGGGG - Intergenic
919866763 1:201788511-201788533 CAGCATCCCCACCCACGAGGCGG + Exonic
920418173 1:205812663-205812685 TAGTATCCCCAACCCCGAGGAGG + Intronic
922483880 1:225958355-225958377 TTGTATCCCCAGCTCTGAGGTGG - Intergenic
1065858788 10:29852845-29852867 TAGAATCCCCAGCCCCCAAGGGG + Intergenic
1066484748 10:35832519-35832541 TAGAATGCCCAGCCCAGAGGCGG - Intergenic
1071300511 10:84252934-84252956 TAGTGACCCCAACCCAGAAGGGG - Exonic
1074508813 10:114094894-114094916 TACTATCCCCCACCCCGAAGAGG + Intergenic
1076461796 10:130652887-130652909 TACTATGCCTAACCCAGAGGAGG - Intergenic
1087874926 11:103343493-103343515 TAGTCTCCCCACCCCCGATGGGG - Intronic
1109546752 13:63842464-63842486 TAGGATCCCCATCCCGGAGAGGG + Intergenic
1110443073 13:75547118-75547140 TAGTAATCCCAAGCCCAAGGAGG - Intronic
1113004917 13:105689959-105689981 TACTATCCACAAACCCCAGGGGG + Intergenic
1113561330 13:111283736-111283758 CAGGATCCCCAACCTAGAGGAGG - Intronic
1116145240 14:41058795-41058817 TAGTATACCCAACCCCAGGTAGG - Intergenic
1122348944 14:101076913-101076935 CATTTTCCCCAACCCAGAGGTGG - Intergenic
1131069736 15:89458661-89458683 TGGTATCCCCAACAGCGAGGGGG + Intergenic
1141755117 16:85985892-85985914 TAGTGACACCAACCACGAGGTGG + Intergenic
1146126469 17:30235534-30235556 TTCTATCCCCCTCCCCGAGGCGG + Intronic
1153813454 18:8772196-8772218 CAGTTTCCCCAACCCTCAGGGGG + Intronic
1158222751 18:55167071-55167093 TGGTATCCCCAACCTCTAGCAGG - Intergenic
1163278431 19:16300362-16300384 TAGTATCCCCAATATCGCGGGGG - Intergenic
1164745599 19:30610436-30610458 TAGCCTCCCCCACCCAGAGGGGG - Intronic
1166334103 19:42095252-42095274 TGGTCTCCCCACCCCCCAGGCGG + Intronic
1166868075 19:45853154-45853176 GAGTAGCCCCACCTCCGAGGTGG - Intronic
1167314037 19:48753487-48753509 CAGCATCGCCAACCCCGAGCAGG + Exonic
1168692882 19:58387346-58387368 TAGGATCCCCGGCCCCGCGGCGG - Exonic
938763600 2:134445831-134445853 CAGGATCCTCAACCCCTAGGGGG - Intronic
1170159958 20:13300816-13300838 TCGTCTACCCAACCCCCAGGAGG + Intergenic
1170838296 20:19903587-19903609 TAGCATCCCCATCCCAGTGGTGG - Intronic
1184004465 22:41698178-41698200 AAGTATCCCAAACCCCGAAAGGG - Intergenic
960639063 3:119809944-119809966 TAGTGTCCCCCTCCCCGAGTCGG + Intronic
979086173 4:116411951-116411973 TAGCACCCCCAACCCCCAGCAGG - Intergenic
983768795 4:171521613-171521635 TTGTATCCCCAACAAAGAGGGGG + Intergenic
985752085 5:1686524-1686546 TGGTATCCCCAAGCCACAGGGGG + Intergenic
987591895 5:19940960-19940982 TAGTATCCCCATCCTAAAGGGGG + Intronic
1006136961 6:31901453-31901475 CAGTTTCCCCAACCCTGGGGAGG + Intronic
1010916983 6:81632302-81632324 TAGTATCACCCACCCCAAGGTGG + Intronic
1013269128 6:108529414-108529436 TCTTATCCCCAGCCCCCAGGTGG - Intergenic
1019800230 7:3082965-3082987 TAGCATCTCCTACCACGAGGTGG + Intergenic
1024688210 7:51771204-51771226 TAGTTTCCCCAACCTAGAGAAGG - Intergenic
1037628214 8:20627389-20627411 TGGTATTCCCAGCCCTGAGGAGG - Intergenic
1039515558 8:38129884-38129906 TAGTAGCCCCAAACCTGAGACGG - Intronic
1039824212 8:41159177-41159199 TAGTATTCCCAAACTCGACGGGG + Intergenic
1048409158 8:134153966-134153988 TAGCACCCCCAACCCCCAGCAGG + Intergenic
1052826977 9:33184011-33184033 TAGCACCCCCAACCCCCAGCAGG - Intergenic
1055875486 9:80936950-80936972 TTACATCCCCAACCCTGAGGAGG - Intergenic
1059830855 9:118094249-118094271 TTGAATCCCCAACTCCCAGGAGG - Intergenic
1186588072 X:10897982-10898004 AGGGATCCCCAACCCCCAGGCGG - Intergenic
1194621391 X:96176954-96176976 TAGTATCCCAAGCCCAGAGGTGG + Intergenic
1197814117 X:130478906-130478928 TAGCACCCCCAACCCCCAGCAGG - Intergenic
1201516063 Y:14819599-14819621 TAGTCTCCCCCACCCAGAAGGGG - Intronic