ID: 920419335

View in Genome Browser
Species Human (GRCh38)
Location 1:205820474-205820496
Sequence TTGACTAAGCAGGGAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920419335_920419341 18 Left 920419335 1:205820474-205820496 CCCTCCTCTCCCTGCTTAGTCAA No data
Right 920419341 1:205820515-205820537 CTCTATAGATTTCCCTATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920419335 Original CRISPR TTGACTAAGCAGGGAGAGGA GGG (reversed) Intergenic
No off target data available for this crispr