ID: 920422856

View in Genome Browser
Species Human (GRCh38)
Location 1:205847249-205847271
Sequence CACCTCTGACAACTTTGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 2, 1: 0, 2: 1, 3: 10, 4: 106}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920422846_920422856 26 Left 920422846 1:205847200-205847222 CCAGGGTGTTAGAGAGGGGGCTG 0: 2
1: 0
2: 4
3: 25
4: 256
Right 920422856 1:205847249-205847271 CACCTCTGACAACTTTGGAGGGG 0: 2
1: 0
2: 1
3: 10
4: 106
920422848_920422856 -6 Left 920422848 1:205847232-205847254 CCTAGGCCACCTTCTCCCACCTC 0: 2
1: 2
2: 6
3: 68
4: 649
Right 920422856 1:205847249-205847271 CACCTCTGACAACTTTGGAGGGG 0: 2
1: 0
2: 1
3: 10
4: 106
920422845_920422856 27 Left 920422845 1:205847199-205847221 CCCAGGGTGTTAGAGAGGGGGCT 0: 2
1: 0
2: 0
3: 20
4: 143
Right 920422856 1:205847249-205847271 CACCTCTGACAACTTTGGAGGGG 0: 2
1: 0
2: 1
3: 10
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920422856 Original CRISPR CACCTCTGACAACTTTGGAG GGG Intronic
906933612 1:50192658-50192680 CACATCTGACAACGTTGGACAGG - Intronic
907317087 1:53579414-53579436 CACCTCAGACAGCTTTTGAAAGG + Intronic
911013522 1:93307158-93307180 CACCTCTGCCAAATTTAGAGTGG - Intergenic
912668491 1:111604568-111604590 CACCCCTGACAATTTTGGCTTGG + Intronic
915076147 1:153309447-153309469 TTCATCTGACAACTTTGGGGAGG - Intronic
915587922 1:156854359-156854381 CAGCCCTGGCAGCTTTGGAGGGG + Intronic
917630234 1:176884336-176884358 CACCTGTCTCCACTTTGGAGTGG + Exonic
920422856 1:205847249-205847271 CACCTCTGACAACTTTGGAGGGG + Intronic
920423600 1:205854488-205854510 CACCTCTGACAACTTTGGAGGGG - Intergenic
923966017 1:239140147-239140169 CGCCACTGACAACTTTCCAGGGG + Intergenic
1067476602 10:46571495-46571517 CATCTCTGCCAACTTTCCAGTGG + Intergenic
1067618136 10:47770286-47770308 CATCTCTGCCAACTTTCCAGTGG - Intergenic
1068824436 10:61418607-61418629 TACCAGTGACAGCTTTGGAGTGG + Intronic
1071238620 10:83678796-83678818 CACCTGAGAAAACTCTGGAGGGG + Intergenic
1072226944 10:93379251-93379273 AAACTCTGAGAACTTTGCAGTGG - Intronic
1077143538 11:1035170-1035192 CATCTCTGCCAACATGGGAGGGG - Intronic
1078668985 11:13348402-13348424 CGCCTCTGACCACAGTGGAGAGG + Intronic
1078921003 11:15830554-15830576 CAACTCTGAGCACTTGGGAGTGG - Intergenic
1080392499 11:31861264-31861286 CATTTCTGACAAGGTTGGAGTGG - Intronic
1082899886 11:58236296-58236318 TTTCTCTGACAACTTTGGGGAGG - Intergenic
1083303404 11:61750416-61750438 GACCTCTGAAACCTTGGGAGCGG - Intergenic
1084453321 11:69252681-69252703 TTCCTCTGAAGACTTTGGAGAGG - Intergenic
1088649473 11:111944717-111944739 CTGCTCTCACAACTTTAGAGGGG + Intronic
1095226018 12:39677506-39677528 CCCCACTGACAACATTAGAGAGG + Intronic
1098749504 12:74276948-74276970 CTCCTCAGACAAATGTGGAGAGG - Intergenic
1106686009 13:32059869-32059891 CACCTCTGTCAACTCTACAGAGG + Intronic
1107980941 13:45733748-45733770 CACCACTCCCAACTCTGGAGAGG - Intergenic
1114564552 14:23620594-23620616 TACCTCTGGCAACTCTGGTGTGG + Intergenic
1119852867 14:77878553-77878575 CACCTCTCTCAACTGTGGTGGGG + Intronic
1124138052 15:27052274-27052296 CACCTCTGATCACCTTGGGGGGG + Intronic
1125144281 15:36448469-36448491 CACCAATGACAATTTGGGAGGGG + Intergenic
1125744961 15:41991785-41991807 CTCCCCGGACACCTTTGGAGTGG + Intronic
1129552356 15:76466751-76466773 GGCCTCTGAAAACTTTGGGGGGG + Intronic
1135254700 16:20931884-20931906 AACCTCTGTCAACCTTTGAGAGG + Intergenic
1137315787 16:47320868-47320890 TTCCACTGACAACTTTGCAGTGG - Intronic
1137434725 16:48445997-48446019 ACCACCTGACAACTTTGGAGAGG - Intronic
1143050452 17:4121225-4121247 CACCTCAGACAGTTTTGGGGAGG - Intronic
1144802632 17:17941157-17941179 CTTCTCTGAGAACTTTGGGGAGG + Intronic
1148575949 17:48711363-48711385 CAGCTCTGAGAAATTTGGATGGG - Intergenic
1152431077 17:80248564-80248586 CCCCTCTGACACCTGTGGGGAGG - Exonic
1157979907 18:52367713-52367735 TACCTCTAACAACTTTGATGGGG + Intronic
1157993603 18:52527848-52527870 AGCCTCTGACAACTCTGGGGAGG + Intronic
1163591622 19:18197131-18197153 CACAACTGACAACTGTGGATGGG + Exonic
1167488276 19:49776133-49776155 CACCTCAGAAAACTCTGGAGAGG + Intronic
927511114 2:23644327-23644349 CAACTCTGACAACTGGGCAGCGG + Intronic
928340014 2:30434919-30434941 CCCATCTGACGACTTTGGAGTGG - Intergenic
931735383 2:65189081-65189103 CACCTCTGGCCACTTTGGCCTGG - Intergenic
931774676 2:65530384-65530406 CACCTGTGCCAACAGTGGAGAGG + Intergenic
932225524 2:70036995-70037017 CACCTTTGACAGGCTTGGAGGGG - Intergenic
935183466 2:100710673-100710695 CACCTGAGAAAATTTTGGAGAGG + Intergenic
935277098 2:101484366-101484388 CACATCTGACAATTGTGGAGAGG - Intergenic
935542340 2:104363212-104363234 GACATCTGCCAACTTTGCAGAGG + Intergenic
936957749 2:118040444-118040466 CATCTCTGAGACCTATGGAGGGG - Intergenic
937943220 2:127306273-127306295 CACTTCTGACATTTTGGGAGGGG + Exonic
946012981 2:216581405-216581427 CCACTCTGACACCTTAGGAGGGG - Intergenic
946361155 2:219220068-219220090 AACCTGTGCCAACTGTGGAGTGG - Exonic
948499476 2:238381368-238381390 CCCCACTGACACCCTTGGAGGGG + Intronic
948685996 2:239670092-239670114 CACCTGTGGCAGCTTTGCAGCGG - Intergenic
1168881897 20:1213339-1213361 CACCTCTCAGAGCTGTGGAGAGG + Intergenic
1169066037 20:2694433-2694455 CTCCTCTGACTCCTTTGCAGGGG + Intronic
1173877118 20:46380348-46380370 CACCTGTGACTACTATCGAGAGG + Intronic
1176317144 21:5257068-5257090 CCTCTCTGACAGCTTTGAAGAGG - Intergenic
950012756 3:9734655-9734677 CACCTCTGGCAGCTTGGGAGTGG - Exonic
952673260 3:35996309-35996331 CATCTCTGATATCTTTGCAGTGG + Intergenic
961494384 3:127280604-127280626 CACCTCTGCCCACTTTGGAGGGG + Intergenic
964392119 3:156208546-156208568 CATCTCTGACAACTTGGAGGGGG + Intronic
965798557 3:172467427-172467449 CACCTCTGGCCAGTATGGAGAGG + Intergenic
966962535 3:184954374-184954396 CAGCCCTGACACCTCTGGAGAGG - Intronic
968793383 4:2685125-2685147 CTCCACTGAGAACTTTGCAGTGG + Intronic
972723591 4:41725747-41725769 CTCCTCTTACAACTTTTGAGTGG - Intergenic
978833656 4:113119988-113120010 CACCACTGGCAACTTGGTAGAGG - Intronic
979545003 4:121930409-121930431 CACCTCTGATAACCTTTCAGGGG - Intronic
982480508 4:155903563-155903585 AACCTCTGTAAACTTTAGAGTGG - Intronic
986145204 5:5071461-5071483 CACCTCAGAAAATTCTGGAGAGG - Intergenic
986659237 5:10044251-10044273 CACCTCTGACAGCTTCTCAGGGG - Intergenic
991566062 5:68005941-68005963 CCCCTCAGTCAGCTTTGGAGAGG - Intergenic
993150847 5:84160687-84160709 CACCTCTCAGGACTGTGGAGAGG - Intronic
993644051 5:90441091-90441113 CAGCACTGACAGCATTGGAGTGG - Intergenic
998807894 5:145936729-145936751 CCGCGCTGACATCTTTGGAGAGG + Intronic
1000829268 5:166083258-166083280 AACCTCTGAGAACTTTGGGTGGG + Intergenic
1002103150 5:176867274-176867296 ACCCTCTGACAACTCAGGAGCGG - Intronic
1004076656 6:12350101-12350123 CCCCTCTTACAACATTGGGGAGG + Intergenic
1004318774 6:14615774-14615796 CTCTTCTGAGAACTTTGGCGGGG - Intergenic
1005349387 6:24919174-24919196 CATCCCTGGCAGCTTTGGAGAGG + Intronic
1005890606 6:30134892-30134914 CACCTCTGACCTCTGGGGAGGGG - Intergenic
1005899611 6:30206166-30206188 CACCTCTAACAAACCTGGAGAGG + Intronic
1006338617 6:33433631-33433653 CAGCTCTGGCAACATGGGAGGGG - Intronic
1007393353 6:41563057-41563079 CTCCTCTCAGAACTTAGGAGTGG + Intronic
1009728370 6:67563674-67563696 CTCTTCTGAGAACTTTTGAGTGG - Intergenic
1010518149 6:76800391-76800413 CTCCACTGACAACACTGGAGAGG - Intergenic
1017427649 6:154339519-154339541 CACCACTCACCACTTTGGACGGG - Intronic
1018557542 6:165064519-165064541 CACCTATGACGACTTGGGAAAGG - Intergenic
1024648550 7:51387461-51387483 GACCTCTGTCAGCTTGGGAGGGG + Intergenic
1028549366 7:92041102-92041124 CACCTATCTCAACCTTGGAGTGG + Intronic
1029453957 7:100657902-100657924 CAGCTCTGACAACTTGGGGTAGG + Intergenic
1030145265 7:106346766-106346788 CACGTCACACAACTTTGAAGAGG + Intergenic
1030267530 7:107635571-107635593 CAGCTCAGACAACTTTGGGTGGG + Intergenic
1031313395 7:120228056-120228078 GATCTCTGACAATTTTGTAGTGG + Intergenic
1033291298 7:140085337-140085359 CAAATCTGTGAACTTTGGAGAGG - Exonic
1037536701 8:19831285-19831307 CATATGTGACAATTTTGGAGGGG + Intronic
1038492500 8:27981020-27981042 CACCTCTGCAAGCTTTGCAGGGG + Intronic
1040822144 8:51573401-51573423 CTCCTCTGACACCTTTCCAGTGG - Intronic
1041806423 8:61854521-61854543 CACCACTGACATCATGGGAGAGG - Intergenic
1045475895 8:102551981-102552003 CATCTCTCAGAAGTTTGGAGAGG + Exonic
1045773109 8:105768606-105768628 CATAACTGAGAACTTTGGAGTGG + Intronic
1047596085 8:126379195-126379217 CACCTCCTACAACTTCAGAGAGG + Intergenic
1049498631 8:142948922-142948944 CACCTCTCACCACTTTGCACTGG + Intergenic
1050127171 9:2368786-2368808 CACCTCTTCCAATTTTGCAGAGG - Intergenic
1059125121 9:111677078-111677100 CACCTCTGAGGTCTTTTGAGGGG - Intergenic
1203415408 Un_KI270582v1:2116-2138 CCTCTCTGACAGCTTTGAAGAGG - Intergenic
1186447817 X:9646819-9646841 CTCCTCTGACATCACTGGAGGGG - Intronic
1190812714 X:53900319-53900341 CACCTCTATGAAATTTGGAGGGG + Intergenic
1191675212 X:63785593-63785615 CACCTCTGGTAACTTTGGAAAGG - Intergenic
1193403418 X:81072827-81072849 CACATCTGTCAACTTTTGACAGG + Intergenic
1193576528 X:83204944-83204966 CACCTTTCACATATTTGGAGAGG - Intergenic
1195281056 X:103332870-103332892 CACATCTGACTCCTATGGAGAGG - Intergenic
1200778136 Y:7188486-7188508 CACCTCTGGCAATTTTCCAGAGG - Intergenic
1201770075 Y:17610736-17610758 CACCTCTGACAAAATTGGTGAGG - Intergenic
1201831479 Y:18295251-18295273 CACCTCTGACAAAATTGGTGAGG + Intergenic