ID: 920423600

View in Genome Browser
Species Human (GRCh38)
Location 1:205854488-205854510
Sequence CACCTCTGACAACTTTGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920423600_920423611 27 Left 920423600 1:205854488-205854510 CCCCTCCAAAGTTGTCAGAGGTG No data
Right 920423611 1:205854538-205854560 AGCCCCCTCTCTAACACCCTGGG No data
920423600_920423610 26 Left 920423600 1:205854488-205854510 CCCCTCCAAAGTTGTCAGAGGTG No data
Right 920423610 1:205854537-205854559 CAGCCCCCTCTCTAACACCCTGG No data
920423600_920423608 -6 Left 920423600 1:205854488-205854510 CCCCTCCAAAGTTGTCAGAGGTG No data
Right 920423608 1:205854505-205854527 GAGGTGGGAGAAGGTGGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920423600 Original CRISPR CACCTCTGACAACTTTGGAG GGG (reversed) Intergenic
No off target data available for this crispr