ID: 920425233

View in Genome Browser
Species Human (GRCh38)
Location 1:205869699-205869721
Sequence CTTTCTGGAGAGACTCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920425233_920425239 14 Left 920425233 1:205869699-205869721 CCTTCCTGAGTCTCTCCAGAAAG No data
Right 920425239 1:205869736-205869758 TTCCTTTCCCAGTGTTATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920425233 Original CRISPR CTTTCTGGAGAGACTCAGGA AGG (reversed) Intergenic
No off target data available for this crispr