ID: 920426343

View in Genome Browser
Species Human (GRCh38)
Location 1:205879617-205879639
Sequence GCATTAGTGTTAGTGGGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920426340_920426343 -5 Left 920426340 1:205879599-205879621 CCAAGGCAGCTTATGCTAGCATT No data
Right 920426343 1:205879617-205879639 GCATTAGTGTTAGTGGGTCCAGG No data
920426339_920426343 -4 Left 920426339 1:205879598-205879620 CCCAAGGCAGCTTATGCTAGCAT No data
Right 920426343 1:205879617-205879639 GCATTAGTGTTAGTGGGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920426343 Original CRISPR GCATTAGTGTTAGTGGGTCC AGG Intergenic
No off target data available for this crispr