ID: 920435396

View in Genome Browser
Species Human (GRCh38)
Location 1:205943730-205943752
Sequence CAGGGCCGCCTTGGGGGAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 430
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 385}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920435396_920435415 11 Left 920435396 1:205943730-205943752 CCGGCTCCCCCAAGGCGGCCCTG 0: 1
1: 0
2: 3
3: 41
4: 385
Right 920435415 1:205943764-205943786 CGAGGCAGAGGAGGGGGACAAGG 0: 1
1: 1
2: 5
3: 82
4: 1089
920435396_920435414 5 Left 920435396 1:205943730-205943752 CCGGCTCCCCCAAGGCGGCCCTG 0: 1
1: 0
2: 3
3: 41
4: 385
Right 920435414 1:205943758-205943780 GGGGGACGAGGCAGAGGAGGGGG 0: 1
1: 0
2: 69
3: 1057
4: 6696
920435396_920435413 4 Left 920435396 1:205943730-205943752 CCGGCTCCCCCAAGGCGGCCCTG 0: 1
1: 0
2: 3
3: 41
4: 385
Right 920435413 1:205943757-205943779 AGGGGGACGAGGCAGAGGAGGGG 0: 1
1: 1
2: 21
3: 330
4: 2008
920435396_920435407 -7 Left 920435396 1:205943730-205943752 CCGGCTCCCCCAAGGCGGCCCTG 0: 1
1: 0
2: 3
3: 41
4: 385
Right 920435407 1:205943746-205943768 GGCCCTGGAGGAGGGGGACGAGG 0: 1
1: 0
2: 6
3: 121
4: 1062
920435396_920435411 2 Left 920435396 1:205943730-205943752 CCGGCTCCCCCAAGGCGGCCCTG 0: 1
1: 0
2: 3
3: 41
4: 385
Right 920435411 1:205943755-205943777 GGAGGGGGACGAGGCAGAGGAGG 0: 1
1: 0
2: 51
3: 966
4: 6677
920435396_920435412 3 Left 920435396 1:205943730-205943752 CCGGCTCCCCCAAGGCGGCCCTG 0: 1
1: 0
2: 3
3: 41
4: 385
Right 920435412 1:205943756-205943778 GAGGGGGACGAGGCAGAGGAGGG 0: 1
1: 0
2: 31
3: 432
4: 2482
920435396_920435410 -1 Left 920435396 1:205943730-205943752 CCGGCTCCCCCAAGGCGGCCCTG 0: 1
1: 0
2: 3
3: 41
4: 385
Right 920435410 1:205943752-205943774 GGAGGAGGGGGACGAGGCAGAGG 0: 1
1: 2
2: 70
3: 1024
4: 7036
920435396_920435416 15 Left 920435396 1:205943730-205943752 CCGGCTCCCCCAAGGCGGCCCTG 0: 1
1: 0
2: 3
3: 41
4: 385
Right 920435416 1:205943768-205943790 GCAGAGGAGGGGGACAAGGCAGG 0: 1
1: 1
2: 7
3: 103
4: 885

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920435396 Original CRISPR CAGGGCCGCCTTGGGGGAGC CGG (reversed) Intergenic
900104453 1:976377-976399 CAGCTCAGCCTGGGGGGAGCAGG + Intronic
900196075 1:1376191-1376213 CAGGGGCGCCTGGTGGGAGAGGG + Intergenic
900284322 1:1891744-1891766 CAGGGCCGCCTGGCAGGGGCGGG + Intergenic
900371585 1:2334519-2334541 CGGGGCTCCCTTGGGGGAGCAGG + Intronic
900512722 1:3068170-3068192 CTGGGCCACCTTCGGGGACCCGG - Intergenic
901418910 1:9137091-9137113 CAGGGCCCCCTTGGGGATGCTGG - Intergenic
901471619 1:9460495-9460517 CAGGGCCTCCGTGGGTGAGGGGG - Intergenic
901489378 1:9588956-9588978 CAGGCCGGCCGTGGGGCAGCGGG - Exonic
903179560 1:21598347-21598369 CAGGGCTACCTTGGGGTAGGAGG - Intronic
903261566 1:22134296-22134318 CAGAGCTGCCTTGGGGGATGCGG + Intronic
903346241 1:22685937-22685959 CAGGGCCGCAGTCGGGGAGCAGG - Intergenic
904267337 1:29325474-29325496 CAGGCCCGCCCTCGGGGAGAAGG - Intronic
905071540 1:35230135-35230157 CAGTGCCTCCTTGGGTGAGCTGG - Intergenic
905893271 1:41530164-41530186 CAGGGCAGCCATGGTGGAGAAGG - Intronic
906246938 1:44282923-44282945 CAGGGCCACCTTGGTGCTGCTGG - Intronic
906543288 1:46604339-46604361 CAGGGCCGCCTGAGGGCAGGGGG + Intronic
906835628 1:49080577-49080599 CAGGTCAGCCTTGGGGCAGGTGG + Intronic
907241978 1:53085932-53085954 CAGAGCCGACTTGGGGGCCCAGG + Intergenic
907403352 1:54239135-54239157 CAGTGCCGCCTGGAGGCAGCCGG - Exonic
912672917 1:111648253-111648275 CAGGGTACCCTTTGGGGAGCAGG - Intronic
914431772 1:147625077-147625099 GAGGGCTGCTTTGGGGGAGGGGG + Exonic
915200052 1:154220722-154220744 CAGGGCCGCCGTGAAGGAGGCGG + Intronic
915246398 1:154558766-154558788 CGGGGCCGCCTAGGAGGAGGAGG - Intronic
917537996 1:175888272-175888294 CAGAGCCTCCCTGGGGGAGGAGG - Intergenic
917724298 1:177814282-177814304 CAGGGCTGCCCAGGGGGAGGAGG + Intergenic
917817328 1:178724872-178724894 GAGGGCCGCGTTCCGGGAGCGGG + Intergenic
917966678 1:180183230-180183252 GAGGGCTGCCCCGGGGGAGCTGG - Intronic
917972934 1:180220065-180220087 CAGGGCCGCCATGGAGGTCCAGG + Intergenic
918321953 1:183372989-183373011 GATGGCCTCCCTGGGGGAGCTGG - Intronic
919403259 1:197146471-197146493 CGGAGCCGCCTCGTGGGAGCGGG - Exonic
920135327 1:203764635-203764657 GAAGGTTGCCTTGGGGGAGCAGG + Intergenic
920435396 1:205943730-205943752 CAGGGCCGCCTTGGGGGAGCCGG - Intergenic
921381988 1:214533483-214533505 CAGGGTACCCTTTGGGGAGCAGG + Intronic
922473158 1:225888913-225888935 CAGGGCCGACATGGAGGAGCTGG - Exonic
922481194 1:225940987-225941009 CAGGGCCGACATGGAGAAGCTGG - Exonic
922594479 1:226803316-226803338 CAGGGCAGCCTGGGGGTAGTCGG + Intergenic
922767614 1:228164041-228164063 CCTGGCGGCCTTGGGGGAGATGG - Intergenic
922952936 1:229574336-229574358 CAGTGCAGGCTTGGGGGACCTGG - Intergenic
923119759 1:230978980-230979002 CGGGGCCGCCTTGCCGGTGCCGG + Intronic
923577820 1:235176597-235176619 CAGAGCAGCAGTGGGGGAGCTGG - Intronic
923915090 1:238492659-238492681 CAGGGTACCCTTTGGGGAGCAGG + Intergenic
1062931596 10:1356424-1356446 CAGAACCGCCTGGGGTGAGCTGG + Intronic
1066180485 10:32957582-32957604 CAGGGCCGCCTCCTGGCAGCCGG + Intronic
1067079804 10:43206446-43206468 CAGGGCTGCCTGGGGTGAGAGGG + Intronic
1067790884 10:49286856-49286878 CAGGGCATCCTGTGGGGAGCTGG + Intergenic
1068845161 10:61663230-61663252 CGGGGCCGGCTGGGGGGCGCCGG - Intronic
1069024271 10:63522240-63522262 CAGGGCCGAATTCGGGGATCTGG - Intronic
1070786626 10:79165830-79165852 CAGGCCCGCCTAGGGGGAGCTGG - Intronic
1071789758 10:88941457-88941479 GAGGGAAGCCTTGGGGGAGAGGG + Intronic
1075676672 10:124300604-124300626 CACGGCTGCCTGGGGGGAGGGGG - Intergenic
1076345237 10:129774859-129774881 TGTGGCCGCCTTGGGGGAGGGGG - Intergenic
1076692311 10:132230131-132230153 CGAGGCCGCCTTGGGAGGGCGGG + Intronic
1076888098 10:133271715-133271737 CGGGGCAGCATTGGGGGAGGCGG + Intronic
1077300868 11:1846353-1846375 CAGGGCTGTCTGGGGAGAGCCGG - Intergenic
1078594928 11:12677362-12677384 GAGGGCAGCCTGGGGGGAGTCGG + Intronic
1079879998 11:25915099-25915121 CAGGGCCTACTTGGGGGTGGTGG + Intergenic
1082686198 11:56242083-56242105 CAGGGCCTTATTGGGGGTGCAGG - Intergenic
1082749433 11:57000927-57000949 CAGGGCCGACCTGGAGGAACAGG + Intergenic
1083272285 11:61578587-61578609 CTAGGGAGCCTTGGGGGAGCTGG + Intronic
1083419026 11:62543163-62543185 GAGGACAGCCTTGGGGGTGCAGG - Intronic
1083902542 11:65650580-65650602 CAGGGCGGCCCTGGAGGAGGAGG + Exonic
1084177074 11:67428535-67428557 CACGGCCGCCATGGCGGCGCCGG - Exonic
1084295691 11:68212669-68212691 CAGGGGCGCCGTCGGGGAGGAGG + Intronic
1084474524 11:69381222-69381244 CGGGGCCCCCTGGGAGGAGCAGG + Intergenic
1084600225 11:70141135-70141157 CAGGGCCCTCTTGGGGTAGCAGG + Intronic
1084758940 11:71256186-71256208 CAGGCCTCCCTTGGGGGTGCAGG + Intergenic
1084910124 11:72381564-72381586 CAGGGCAGCCTTGGTGGCCCAGG + Intronic
1087672920 11:101128215-101128237 CAGGGTCGCCCTGGTGGAGCAGG - Exonic
1090076741 11:123584497-123584519 CAGGGCAGCCTTGGGGAGGGAGG + Intronic
1090403393 11:126463123-126463145 CAGGGCTGGGTTGGGGGAGGGGG + Intronic
1091620376 12:2083308-2083330 CAGGGCCTCTTTGGGGGAAAAGG - Intronic
1091993764 12:4977036-4977058 CAGGGCAGCCTGGGAAGAGCCGG - Intergenic
1092253188 12:6912828-6912850 CAGGGCCTCCTGGCGGTAGCTGG - Exonic
1093932033 12:24963722-24963744 CAGGGCGGGATTGGGGGGGCGGG - Intergenic
1094176896 12:27550191-27550213 CAGTGGCCCCATGGGGGAGCTGG + Intronic
1096635053 12:52952854-52952876 CAGGGTACCCTTTGGGGAGCAGG + Exonic
1096781682 12:53995647-53995669 CCAGACCGCGTTGGGGGAGCCGG + Intronic
1097237467 12:57549977-57549999 CGGGGCCGCGATGGAGGAGCGGG - Exonic
1098785258 12:74745303-74745325 CAGGGCCTGCTTGAGGGAGGAGG - Intergenic
1100660986 12:96698665-96698687 CAGGGCCTGCTTGAGGGTGCAGG + Intronic
1101468867 12:104976715-104976737 CAGGGTACCCTTTGGGGAGCAGG - Intergenic
1102253425 12:111403056-111403078 CCAGGCCGTCTTAGGGGAGCAGG - Intergenic
1102677760 12:114669603-114669625 TAGGGGCGCCTTGGGCCAGCCGG + Intergenic
1103527189 12:121576872-121576894 CAGGGCAGCCTTGGGGGAGGAGG + Intronic
1104185285 12:126424812-126424834 CACGGCCACCTGGTGGGAGCTGG + Intergenic
1104766043 12:131330985-131331007 CAGGGCCGACCTGGAGGAACAGG + Intergenic
1104899269 12:132179602-132179624 CAGGGCCCCCAGGGAGGAGCTGG + Intergenic
1104935359 12:132361412-132361434 CAGGGCCGCCTTGGGGAGCACGG - Intergenic
1104970719 12:132529471-132529493 AAGGGCAGCCTCAGGGGAGCTGG - Intronic
1105719856 13:23102379-23102401 CAGGGAGGCCTTGGGAAAGCTGG - Intergenic
1108187314 13:47901184-47901206 CAGGGCCTGTTTGGGGGTGCGGG + Intergenic
1111581786 13:90231694-90231716 CAGGGTACCCTTTGGGGAGCAGG + Intergenic
1112261190 13:97879873-97879895 CAGGGCTGCCTCGAGAGAGCAGG - Intergenic
1113463999 13:110501475-110501497 CAGGGCGGGGTTGGGGGGGCAGG - Intronic
1113579940 13:111421503-111421525 CAGGGCTGCCTGGCAGGAGCAGG + Intergenic
1113601475 13:111572269-111572291 CTGGGCTGCTTTGGAGGAGCAGG - Intergenic
1113804336 13:113104557-113104579 CAGGGAGGCTTTGGGGGTGCTGG + Intergenic
1113901508 13:113800739-113800761 CAGGGCTGCCTCATGGGAGCTGG - Intronic
1117900087 14:60523405-60523427 CAGGGCCTACTTGGGGGTGTGGG - Intergenic
1118478537 14:66141407-66141429 CAGGGCAGCCTTGGGTGCCCTGG + Intergenic
1119325743 14:73758944-73758966 TATGGCCGGCTTGGTGGAGCTGG - Intronic
1119388801 14:74276276-74276298 TAGGCCTGCCTTGGGGGAGCCGG + Intergenic
1121798022 14:96751870-96751892 CAGGGCCTACTTGGGGGTGGAGG + Intergenic
1122535794 14:102461650-102461672 CAGGGCCAGCTTCGTGGAGCGGG - Intronic
1122924642 14:104894033-104894055 AAGGGCCGCCCTGGAGGCGCTGG - Intronic
1122946544 14:105013306-105013328 CAGTGCCGCCTGCGGGGAGCTGG + Intronic
1125921443 15:43527996-43528018 GAGGGCAGCTGTGGGGGAGCTGG - Exonic
1127376855 15:58392935-58392957 CAGGGCTGCCTTTGGGGAAAGGG + Intronic
1127883247 15:63176401-63176423 CAGGGATGCCTTCGGGAAGCTGG - Intergenic
1128304424 15:66588700-66588722 CAGGGTCCGCTTGGGGGCGCAGG + Intronic
1128371478 15:67042792-67042814 CAGGGACCCCTTGAGGGAGCTGG + Intergenic
1128724086 15:69975090-69975112 CAGAGCCGCCTGGTTGGAGCTGG - Intergenic
1129108260 15:73323273-73323295 CTGGGCAGCCTGCGGGGAGCGGG + Exonic
1129198022 15:73982596-73982618 CAGAGACCCCTTGGGGGAGAGGG + Exonic
1129392327 15:75226579-75226601 CTGGGCAGCCTTGGGGGACTAGG + Intergenic
1129832414 15:78679453-78679475 CAGGGCAGGCCTGGGGGACCGGG + Intronic
1129882815 15:79018285-79018307 CAGAACCACCTTGGGGTAGCAGG - Intronic
1130412012 15:83654953-83654975 CGCGGGCGCCTTGGCGGAGCTGG - Intronic
1131259903 15:90882855-90882877 CAGGGCAGCCAGGGAGGAGCAGG - Exonic
1131484620 15:92809451-92809473 AAGGGCCGCGTTCGAGGAGCCGG + Intronic
1132552451 16:559186-559208 CAGGGGTGCCTTGGGGAAGAAGG - Intergenic
1132581915 16:688693-688715 CAGGGCAGCCATCGGGGAGCTGG + Intronic
1132694934 16:1197844-1197866 AAAGGACGTCTTGGGGGAGCAGG + Intronic
1132896636 16:2232410-2232432 CAGGGCCCTCCTGGGGGAACAGG - Intronic
1136060329 16:27721906-27721928 CAGGCCACCCTTGGGGGAACTGG + Intronic
1136110844 16:28063021-28063043 CCGCGCCGCCCCGGGGGAGCCGG + Intronic
1137463315 16:48685759-48685781 CAGGGCCTGCTTGGGGGTGGAGG + Intergenic
1138341124 16:56289704-56289726 CAGGGAGGCCTTTGGGCAGCTGG + Intronic
1139384081 16:66552922-66552944 CATGGCCTCCTTGGGGAAGAAGG + Intronic
1139475078 16:67199065-67199087 CGGGGCCGCCTCGGCGGGGCGGG + Intergenic
1139476087 16:67203253-67203275 CAGGGCGGTCTGGGGAGAGCAGG - Intronic
1140182081 16:72729917-72729939 CAGGGTACCCTTTGGGGAGCAGG + Intergenic
1141382220 16:83586661-83586683 AAGGGCTGCCTCGTGGGAGCAGG + Intronic
1141608688 16:85169566-85169588 CATGGCAGCCGTGGGCGAGCGGG + Intergenic
1141668708 16:85480294-85480316 CAGGGCCCCATTGGGTGAGGCGG + Intergenic
1141945333 16:87305499-87305521 CAGGGCAGCCTGGGGGCGGCGGG - Intronic
1142284053 16:89164488-89164510 CTGGGCCGTCCTGGGGGATCAGG - Intergenic
1142287814 16:89178562-89178584 CAGGGCTGCCTCGGTGGGGCTGG - Intronic
1142374111 16:89697954-89697976 CAGGGGAGCCTCGGGGGGGCAGG + Exonic
1144711017 17:17401492-17401514 CAGGGCATCCGTGGGGGAGGCGG + Intergenic
1144797864 17:17904733-17904755 CAGGGTGACATTGGGGGAGCGGG - Intronic
1145062968 17:19743933-19743955 CAGGGCCTCCTGTGGGGAGCAGG + Intronic
1145260259 17:21350561-21350583 CAGGGCAGCCATCGGGGAGGTGG - Intergenic
1145828165 17:27893065-27893087 CCGGGCGGCCTCGGAGGAGCAGG - Intronic
1145871311 17:28276010-28276032 CAGGGGACCCTTTGGGGAGCAGG - Intergenic
1146296973 17:31657954-31657976 CAGGGCAGGCCAGGGGGAGCCGG + Intergenic
1147871595 17:43591501-43591523 GAAGGCCACCTTGGGAGAGCTGG + Intergenic
1147894140 17:43739489-43739511 CAGGGCTGACTTCAGGGAGCGGG + Intergenic
1148126781 17:45241448-45241470 GAGGGCCGCGTCGGGGCAGCGGG - Exonic
1148235171 17:45963955-45963977 CATGGGCGTATTGGGGGAGCAGG + Intronic
1149614799 17:57988415-57988437 CAGGGCCCCCGCGGGGGGGCTGG + Intergenic
1150220765 17:63494566-63494588 CAGGGCAGACCCGGGGGAGCCGG + Intronic
1150472199 17:65446764-65446786 GAGGGCTGCTATGGGGGAGCAGG + Intergenic
1151642380 17:75405546-75405568 CAGAGCAGCCTTGGGGTCGCCGG - Intronic
1151700954 17:75742379-75742401 CAGGGCCGGCTTGGCCGAGCGGG - Exonic
1151826666 17:76527699-76527721 CAGGGCAGCCCCGGGGGATCCGG - Exonic
1152396289 17:80035709-80035731 CAGCGCCCCCTCGGCGGAGCTGG - Intronic
1153414532 18:4832114-4832136 TAGGGCTGCCTGGTGGGAGCTGG - Intergenic
1153907753 18:9678209-9678231 CAGGGTACCCTTTGGGGAGCAGG - Intergenic
1154196543 18:12271437-12271459 CAGGGCCGCCGTGGGGGCTGCGG - Intronic
1156481707 18:37440439-37440461 CAGGGCTGCCCTGGGACAGCGGG - Intronic
1157168857 18:45383879-45383901 CAGGGGCTTCTTGGGGGTGCAGG - Intronic
1160215372 18:76924442-76924464 CAGGGCGGCGTTGGGATAGCAGG + Intronic
1160235125 18:77079343-77079365 CACGGCCACTGTGGGGGAGCAGG + Intronic
1160717863 19:584547-584569 CAGCGCCGCCTGGTGGCAGCCGG - Intergenic
1160718733 19:588553-588575 CGGGGCCGGCGTGGGGGCGCAGG + Intergenic
1161462950 19:4409697-4409719 CTGTGCTGCTTTGGGGGAGCAGG - Exonic
1161512579 19:4679719-4679741 CAGGGGCTCCCTGGGGGATCTGG - Intronic
1161659380 19:5536661-5536683 CATGGCAGCCTGGCGGGAGCCGG - Intergenic
1161660687 19:5544145-5544167 CCGGGCCTCCCTGGGGGAGAGGG - Intergenic
1161737712 19:6001844-6001866 CCGGGCGGCCTTGGGGAAGCTGG + Exonic
1161849336 19:6730708-6730730 CAGGGCCGCTCTGGGGGCGGGGG - Intronic
1162034916 19:7933561-7933583 CAGGGCCTCCCTGGGGAAGAGGG + Exonic
1162351686 19:10154249-10154271 CTGGGCCACCTTAGGGGAGCGGG + Intronic
1162932414 19:13963567-13963589 CTTGGCGGCCTTGGGGAAGCCGG + Exonic
1163168207 19:15511955-15511977 CAGGCCCGCCTTGGTAGAGGTGG - Intronic
1163386143 19:17001703-17001725 CAGGGCACCCTTGTGGGAGCAGG + Intronic
1163404403 19:17113324-17113346 CAGGGCCGGGTTGGGGAAGCAGG + Intronic
1163747609 19:19057547-19057569 CAAGGCCGCCCTGCGGGACCTGG + Exonic
1163987086 19:20963382-20963404 CAGGGTACCCTTTGGGGAGCAGG + Intergenic
1166214660 19:41327484-41327506 CAGGCCCGTCTTGGGGGCGGGGG + Intronic
1166943474 19:46383257-46383279 CAGGGCAGGCCTGGGGGAGCGGG - Intronic
1167294885 19:48644323-48644345 GAGAGCAGCCTTGGGGGAGGAGG - Intronic
1167383201 19:49150164-49150186 CTGGGCGACCTTGGGGGTGCGGG + Intronic
925194904 2:1914945-1914967 CACGGCGGCCTTGGGGGCCCTGG + Intronic
926006075 2:9374382-9374404 CAGGGCCTTCCTGGGGGAGGAGG + Intronic
926228859 2:10987690-10987712 CAGGGCTGCCTGGGGTGAGCAGG - Intergenic
927156466 2:20224234-20224256 CAGGGCTGCGTGGGGGGCGCGGG - Intronic
927512088 2:23650143-23650165 CAAGTCTGCCCTGGGGGAGCTGG + Intronic
927866054 2:26588353-26588375 CAGGGCAGCCTGGGAGGGGCTGG + Intronic
929197948 2:39205839-39205861 CAGGACTGCCCTGGGCGAGCTGG + Intronic
929438910 2:41950002-41950024 CAGGGCCGTGGTGGGGGAGGGGG + Intronic
932442590 2:71747206-71747228 CAGGGCGGGGCTGGGGGAGCCGG - Intergenic
932743041 2:74306691-74306713 CAGGGTACCCTTTGGGGAGCAGG - Intronic
933302037 2:80552056-80552078 AACGGCCGTCTTGGTGGAGCAGG + Intronic
934664967 2:96163661-96163683 CCAGGCCTCCCTGGGGGAGCCGG + Intergenic
934697122 2:96407867-96407889 CCGGGCCCCTCTGGGGGAGCTGG - Intergenic
935000610 2:99011034-99011056 CACGGCCACCTTGGGGGATGGGG - Intronic
935430922 2:102974698-102974720 CAGGTCTGCCTAGGGGCAGCAGG + Intergenic
942971266 2:181961170-181961192 CAGGGTACCCTTTGGGGAGCAGG - Intronic
943548555 2:189311226-189311248 CAGGGTACCCTTTGGGGAGCAGG - Intergenic
946135067 2:217639226-217639248 CAGGGCCTACTTGAGGGTGCAGG + Intronic
946398024 2:219453105-219453127 CTGGGCCCCCTCAGGGGAGCTGG - Intronic
947746182 2:232508456-232508478 CAGGGCCCACCTGGGTGAGCAGG - Intergenic
947911575 2:233804140-233804162 CATGGCCGACATGTGGGAGCTGG + Exonic
947919336 2:233855625-233855647 CTGGGCCACCCTGGGGCAGCAGG - Intergenic
948116082 2:235494857-235494879 CCGGGCCGCCTTGGGGCCTCGGG + Intronic
948189259 2:236045590-236045612 CAGGGCCGCCCTGGGGCTGTGGG + Intronic
948467853 2:238160653-238160675 CAGGGCCTTCTTTTGGGAGCTGG - Intronic
948886708 2:240888424-240888446 CAGGGCCGCCTCGGGCTGGCTGG + Exonic
1169024641 20:2358861-2358883 CAGGGCCTACTTGGGGGTGGAGG - Intergenic
1170460499 20:16573145-16573167 CAGGCTGGCTTTGGGGGAGCTGG + Intronic
1171194704 20:23187782-23187804 CAGGGCAGCCTGGTGGCAGCTGG - Intergenic
1171464726 20:25319524-25319546 CAGGGCAGCCCTGGAGGAGGTGG - Intronic
1174653855 20:52153118-52153140 CAGGGCGGCCTTGCTGGAGCAGG + Exonic
1175224956 20:57439394-57439416 CAGGGCCGAGCTGGGGGTGCAGG - Intergenic
1175402859 20:58710538-58710560 CTTGGCCGCCCTGGGGGACCAGG + Intronic
1175467228 20:59197595-59197617 CAGAGCAGGCTTGGGGGAGTGGG + Intronic
1175581244 20:60101696-60101718 CAGGGCCTGCTTGTAGGAGCCGG - Intergenic
1175698814 20:61122892-61122914 GAGGGCCACCTTGGTGGATCTGG + Intergenic
1175766748 20:61597661-61597683 CAGGGCCTCCTTGGGTGGGTGGG + Intronic
1175777771 20:61663848-61663870 CAGGGCGGCCTCGAGGGAGCTGG - Intronic
1176000513 20:62829452-62829474 CAGGGCCTCCCTGGACGAGCGGG + Exonic
1176106784 20:63393318-63393340 CAGGGCCGGTGTGGGGGCGCAGG + Intergenic
1176106807 20:63393383-63393405 CAGGGCCGGTGTGGGGGCGCAGG + Intergenic
1176106832 20:63393448-63393470 CAGGGCCGGTGTGGGGGCGCAGG + Intergenic
1176158880 20:63638475-63638497 CAGGGCTGCCCTGGGAGAGGAGG + Intergenic
1176345866 21:5746165-5746187 CAGGGCCGAATTGGGGTCGCAGG + Intergenic
1176352680 21:5866749-5866771 CAGGGCCGAATTGGGGTCGCAGG + Intergenic
1176498961 21:7578290-7578312 CAGGGCCGAATTGGGGTCGCAGG - Intergenic
1176540187 21:8144235-8144257 CAGGGCCGAATTGGGGTCGCAGG + Intergenic
1176559138 21:8327280-8327302 CAGGGCCGAATTGGGGTCGCAGG + Intergenic
1177223626 21:18224898-18224920 CAGGGCGGCCTTAGGGAGGCTGG + Intronic
1179770941 21:43616307-43616329 CATGGCAGCCTTAGGGTAGCTGG - Intronic
1180037388 21:45256796-45256818 CAGGGCCTCCCTGGAGGGGCAGG - Intergenic
1180144565 21:45912157-45912179 ATGGGCAGCCTTGGGGCAGCGGG - Intronic
1180887687 22:19258818-19258840 CAGGGTACCCTTTGGGGAGCAGG + Intronic
1180961509 22:19764422-19764444 CAGAGCCGCCTGGGGACAGCCGG - Intronic
1181068773 22:20319955-20319977 CGCGGCCGCCTTGGAGGAGGTGG - Exonic
1181092371 22:20482781-20482803 CAGGGTATCCTTTGGGGAGCAGG - Intronic
1181500694 22:23314079-23314101 CTGGGCTGCCATGGGAGAGCTGG - Intronic
1181531615 22:23520660-23520682 CAGGGCCGCAGTGGGGGCCCAGG + Intergenic
1181601303 22:23953382-23953404 TAGTGCCTCCTTGGTGGAGCTGG + Intergenic
1181607207 22:23987955-23987977 TAGTGCCTCCTTGGTGGAGCTGG - Intergenic
1182278710 22:29206080-29206102 CAGCGCCGCCTCCCGGGAGCAGG - Exonic
1182468601 22:30533129-30533151 CAGGGCAGCCATGCGGGAGGGGG - Intronic
1182522775 22:30893569-30893591 CAGGGGCGCCCTTGGGGAGGGGG + Intronic
1182574795 22:31265978-31266000 CAGGGGCTCCTTTGGGGAGCTGG - Exonic
1183290980 22:37001989-37002011 CAGGGCCACCTCGGGAGAGGGGG - Exonic
1183339334 22:37270878-37270900 CAGGGTCCCCCTGGGAGAGCCGG - Intergenic
1183427348 22:37746770-37746792 CCTGGCCGCCTTGGGGAATCGGG - Intronic
1183469027 22:37996111-37996133 CAGGGACACCCTGGGGGACCAGG + Intronic
1183473016 22:38019519-38019541 CAGGGCGTGCTTGGGGGATCAGG - Intronic
1184161043 22:42697549-42697571 CCGGGCCCACTTGGAGGAGCAGG + Intronic
1184332232 22:43834269-43834291 CAGGGCCGCGGTGTGGGTGCGGG - Intronic
1184332239 22:43834297-43834319 CAGGGACGCGGTGGGGGCGCGGG - Intronic
1184332249 22:43834325-43834347 CAGGGCCGCGGTGGGGGCGCGGG - Intronic
1184332259 22:43834353-43834375 CAGGGCCGCGGTGGGGGCGCGGG - Intronic
1184332268 22:43834381-43834403 CAGGGCAGCGGTGGGGGCGCGGG - Intronic
1184332284 22:43834437-43834459 CAGGGACGCGGTGGGGGCGCGGG - Intronic
1184332294 22:43834465-43834487 CAGGGCCGCGGTGGGGGCGCGGG - Intronic
1184332304 22:43834493-43834515 CAGGGCCGCGGTGGGGGCGTGGG - Intronic
1184332313 22:43834521-43834543 CAGGGCAGCGGTGGGGGCGCGGG - Intronic
1184332329 22:43834577-43834599 CAGGGACGCGGTGGGGGCGCGGG - Intronic
1184332338 22:43834605-43834627 CAGGGACGCGGTGGGGGCGCGGG - Intronic
1184332348 22:43834633-43834655 CAGGGCCGCGGTGGGGGCGCGGG - Intronic
1184332358 22:43834661-43834683 CAGGGCCGCGGTGGGGGCGCGGG - Intronic
1184332367 22:43834689-43834711 CAGGGCAGCGGTGGGGGCGCGGG - Intronic
1184332383 22:43834745-43834767 CAGGGACGCGGTGGGGGCGCGGG - Intronic
1184332393 22:43834773-43834795 CAGGGCCGCGGTGGGGGCGCGGG - Intronic
1184332402 22:43834801-43834823 CAGGGCAGCGGTGGGGGCGCGGG - Intronic
1184332418 22:43834857-43834879 CAGGGACGCGGTGGGGGCGCGGG - Intronic
1184332427 22:43834885-43834907 CAGGGACGCGGTGGGGGCGCGGG - Intronic
1184332437 22:43834913-43834935 CAGGGCCGCGGTGGGGGCGCGGG - Intronic
1184332447 22:43834941-43834963 CAGGGCCGCGGTGGGGGCGCGGG - Intronic
1184332456 22:43834969-43834991 CAGGGCAGCGGTGGGGGCGCGGG - Intronic
1184332466 22:43834997-43835019 CAGGGCCGCGGTGTGGGTGCGGG - Intronic
1184332473 22:43835025-43835047 CAGGGACGCGGTGGGGGCGCGGG - Intronic
1184332483 22:43835053-43835075 CAGGGCCGCGGTGGGGGCGCGGG - Intronic
1184332492 22:43835081-43835103 CAGGGCAGCGGTGGGGGCGCGGG - Intronic
1184332507 22:43835137-43835159 CAGGGCTGCGGTGGGGGCGCGGG - Intronic
1184474750 22:44714419-44714441 CAGGGCCGGGCTGGGGGTGCAGG + Intronic
1184571797 22:45329658-45329680 CAGGGCCGCCTGAGGGGAGCGGG + Intronic
1184764274 22:46563590-46563612 CAGGGTCTCCCTGGGGCAGCAGG + Intergenic
1184787620 22:46679361-46679383 GAGGGCCACATTCGGGGAGCGGG + Exonic
1184796852 22:46737939-46737961 CGGGGGCGGCTTGGGGGACCCGG - Intronic
1184833090 22:47002940-47002962 CAGGGCCGCCTAGGGGATGTAGG + Intronic
1185050336 22:48551019-48551041 CAGAGCAGCCCTGGGGGAGAGGG - Intronic
1185106019 22:48870359-48870381 CAAGGCTGCCTGGGGGAAGCAGG - Intergenic
1185153212 22:49178340-49178362 CAGAACCGACATGGGGGAGCTGG + Intergenic
1185181581 22:49366482-49366504 CAGGGTTTGCTTGGGGGAGCAGG + Intergenic
1185272372 22:49935300-49935322 CAGAGCGGGCTTGGGGGACCCGG + Intergenic
1185413355 22:50697343-50697365 CAGGGCAGCCTAGTGGGAGCGGG - Intergenic
1203245132 22_KI270733v1_random:60602-60624 CAGGGCCGAATTGGGGTCGCAGG + Intergenic
950403223 3:12787356-12787378 CAGGGTACCCTTTGGGGAGCAGG - Intergenic
950455785 3:13091960-13091982 CAGGGCAGTCATGGGGGAGGTGG + Intergenic
950687169 3:14626916-14626938 CAGGGCTGCCTTAGGGGGGTGGG + Intergenic
951188201 3:19739177-19739199 CATGGAGGCCTTGGGGTAGCTGG - Intergenic
951362640 3:21742669-21742691 CAGGGCCTCCTGGCAGGAGCAGG - Intronic
952966562 3:38624579-38624601 CATGGCCACCTTGGGGGTGGTGG - Intronic
953356538 3:42260884-42260906 CAGGCCCTCCTGGGGGGAGCAGG + Intronic
954613621 3:51958756-51958778 CTGGGCGGCAGTGGGGGAGCAGG - Intronic
956051924 3:65257298-65257320 CAGGGCCTCCTAGGAGGAGGTGG + Intergenic
961312913 3:126015247-126015269 CAGGGCTGCCTGTGAGGAGCCGG + Intronic
961337087 3:126187017-126187039 CAGGGCTGCTCAGGGGGAGCGGG + Intronic
961558173 3:127710863-127710885 CTGCTCCACCTTGGGGGAGCTGG + Intronic
962335637 3:134527748-134527770 CAGGGCAGCCTTGGGTGGCCTGG - Intronic
964483258 3:157162629-157162651 CAGGGTACCCTTTGGGGAGCAGG - Intergenic
964746959 3:160021343-160021365 CAGGGCAGTGTTGGGGGACCAGG + Intronic
965599593 3:170441982-170442004 TAGGGCCACCTAGGGGGAGCTGG + Intronic
965736896 3:171830112-171830134 CAGGGCCACCTGGAGGCAGCTGG + Intergenic
967990403 3:195126107-195126129 CAGACCCGCCTTGGGCAAGCTGG + Intronic
968506873 4:974772-974794 GAGGGCTGCCTGGGGGCAGCAGG + Intronic
968591223 4:1460506-1460528 CAAGGCCGACTTGGGGCAGCTGG + Intergenic
968629915 4:1645031-1645053 CAGGGCCGCCTTGGCTGTGAGGG - Intronic
969447993 4:7256263-7256285 CAGGGCCGCCACGAGGGACCAGG + Intronic
970365479 4:15354036-15354058 CACAGCAGCCTTGGGGGAGAAGG - Intronic
972400139 4:38693982-38694004 CAGGCATGCCATGGGGGAGCCGG + Intronic
972532804 4:39976776-39976798 CAGGGCCGGGTTGGCGGGGCCGG - Intronic
972538833 4:40021535-40021557 CAGGGTACCCTTTGGGGAGCAGG + Intergenic
973733321 4:53844873-53844895 CAGGGCTGCCATCGGGGAGGTGG - Intronic
974683175 4:65191345-65191367 CAGGGCCTACTTGAGGGTGCAGG - Intergenic
975767813 4:77687457-77687479 CAGGGTCTCTTTGGGGGAGATGG + Intergenic
980625554 4:135371143-135371165 CAGGGTACCCTTTGGGGAGCAGG - Intergenic
981422952 4:144572195-144572217 CAGGGTACCCTTTGGGGAGCAGG - Intergenic
982147675 4:152414961-152414983 CAGGCCTACCTTGGGGGAGGGGG + Intronic
985716646 5:1466822-1466844 CAGGGCCGTCTTGAGGATGCAGG + Exonic
985887366 5:2689918-2689940 CAGGGACGGCTGGGGGCAGCAGG + Intergenic
986273005 5:6250343-6250365 CAGTGCAGGCTTGGTGGAGCTGG + Intergenic
986317768 5:6601946-6601968 GTGGGGGGCCTTGGGGGAGCAGG - Intronic
986326835 5:6682143-6682165 CAGGGCAGCCTCAGAGGAGCAGG + Intergenic
987039333 5:14046951-14046973 CAGGGACGTCTTGGGGGAGGAGG + Intergenic
989012316 5:36886509-36886531 CAGGGTACCCTTTGGGGAGCAGG + Intronic
990336222 5:54775133-54775155 CAGGGCGGACTTGGAGGAGATGG + Intergenic
991054372 5:62306074-62306096 CGGGGCCGCCTGGAGGCAGCGGG + Intergenic
994699927 5:103120695-103120717 AAGGGAAGCCATGGGGGAGCAGG - Intronic
995215458 5:109589608-109589630 CAGGGTACCCTTTGGGGAGCAGG + Intergenic
996452172 5:123637420-123637442 CAGGGTACCCTTTGGGGAGCAGG + Intergenic
998419253 5:141968982-141969004 CAGCGCCGCCTTGGGCCTGCGGG + Intronic
998477284 5:142432555-142432577 AAGGGGCGCCTGGGGAGAGCAGG - Intergenic
1001554451 5:172626415-172626437 GAGGGCCTCAGTGGGGGAGCAGG - Intergenic
1001646026 5:173283119-173283141 CAGGGCTGCCTTGAGGAACCAGG - Intergenic
1002606954 5:180389300-180389322 CAGGGCAGCAGTGGGGGAGAGGG - Intergenic
1002895823 6:1379545-1379567 CTGGGCCGCCCTGTGGGAGGCGG - Intergenic
1002922792 6:1585104-1585126 CAGGGGCCCCTGGGGGAAGCCGG - Intergenic
1006298421 6:33180313-33180335 CAGGGCCCCCCTGGCCGAGCAGG - Exonic
1007072838 6:39049183-39049205 CAGGGCGGCCGCGGGGCAGCGGG - Intronic
1012440704 6:99259818-99259840 CAGGGCCTACTTGGGGGTGGAGG + Intergenic
1012506348 6:99951053-99951075 CTGGGCTGCCTGGTGGGAGCTGG - Intronic
1012583176 6:100892878-100892900 CAGGGCCGCCTTGGGGGCTTGGG + Intergenic
1013303977 6:108831289-108831311 CAGGGCAGCTTTGGGCAAGCAGG + Intergenic
1016577799 6:145589842-145589864 CAGGGTACCCTTTGGGGAGCAGG + Intronic
1017174884 6:151493870-151493892 CAGGGCGACCTGGGGGGAGTCGG - Intergenic
1017873214 6:158503280-158503302 CAGGGCATCTTTGGGAGAGCAGG - Exonic
1019306875 7:339818-339840 GAGGGCCGCCTCTGGGGAGGAGG - Intergenic
1019321814 7:419447-419469 CAGGGGTGACTGGGGGGAGCTGG - Intergenic
1019321851 7:419581-419603 CAGGGGTGACTGGGGGGAGCTGG - Intergenic
1019321889 7:419715-419737 CAGGGGTGACTGGGGGGAGCTGG - Intergenic
1019321927 7:419849-419871 CAGGGGTGACTGGGGGGAGCTGG - Intergenic
1019322026 7:420184-420206 CAGGGGTGACTGGGGGGAGCTGG - Intergenic
1019336236 7:484388-484410 CAGTGTCGGCTTGGGGGAACGGG - Intergenic
1019422422 7:957257-957279 CAGGGAGGCCTCAGGGGAGCCGG + Intronic
1019474072 7:1235739-1235761 CAGGCCCCTCTGGGGGGAGCGGG + Intronic
1019509084 7:1408175-1408197 CAGGCCGGGCCTGGGGGAGCTGG + Intergenic
1023678090 7:42651778-42651800 CAGAGCAGGCTTGTGGGAGCTGG - Intergenic
1023865539 7:44236506-44236528 CAGGGCTGCCTTGGGACATCAGG - Intronic
1023866648 7:44241615-44241637 CAGGGGGGCCTTGGGGGGTCTGG - Intronic
1025615792 7:63114777-63114799 CATGGCCGCCGTGGCCGAGCGGG - Intergenic
1027051560 7:75024565-75024587 CAGGGCCGGGGTGGGGAAGCAGG + Intronic
1028922220 7:96321639-96321661 CAGGGCCGACGAGGAGGAGCGGG - Intronic
1029747407 7:102523995-102524017 CAGGGACCCCTTGTGGGAGGTGG + Intergenic
1029765360 7:102623085-102623107 CAGGGACCCCTTGTGGGAGGTGG + Intronic
1030760495 7:113344227-113344249 GAGGGCCACCTTGGTGGAGTTGG + Intergenic
1031258221 7:119483391-119483413 CAGGGCCTACTTGAGGGTGCAGG - Intergenic
1031607896 7:123791737-123791759 GACGGCCTCCTTGGGTGAGCTGG + Intergenic
1032079106 7:128849835-128849857 CAGGGCAGCCTCTGGGGAGATGG - Intronic
1032239428 7:130149511-130149533 CCCGGCCGCCCCGGGGGAGCAGG - Intergenic
1034268122 7:149790958-149790980 CAGGCCAGCCTGGGAGGAGCTGG - Intergenic
1035020113 7:155796048-155796070 CAGGGCATCCCTGGGGCAGCTGG + Intergenic
1035728033 8:1836595-1836617 CAGGTCGGAGTTGGGGGAGCAGG + Intronic
1036604704 8:10294853-10294875 CAGGGCCGGCTTGGGAGGGGTGG + Intronic
1039383342 8:37106809-37106831 CTGGGCAGGGTTGGGGGAGCAGG - Intergenic
1039936566 8:42051577-42051599 CGGGCCCGCCCTGGGGGAGCCGG - Intronic
1040963978 8:53065562-53065584 CAGGGCCGCCGGGGTGGAGCCGG - Intergenic
1045294874 8:100863962-100863984 CAGAGCAGCCTTGGGGGAAATGG - Intergenic
1049101001 8:140578824-140578846 CGGGGCCGCCTTGCAGAAGCCGG + Intronic
1049406461 8:142453762-142453784 CAGAGCCTCCTTGGCAGAGCTGG - Intronic
1049689573 8:143952791-143952813 CGGAGCCGGCTTGGGGGAGGCGG - Intronic
1049709499 8:144057268-144057290 CTGGCCTGCTTTGGGGGAGCTGG - Exonic
1052241926 9:26283376-26283398 CAGGGCCTGTTGGGGGGAGCGGG + Intergenic
1053050498 9:34957871-34957893 AGGGGGCGCCTTGGGGGCGCTGG - Intronic
1053056737 9:34997427-34997449 CTGGGCTGCCTGGGGGGAGTGGG + Exonic
1053123013 9:35560303-35560325 CAGGGCAGCCCAAGGGGAGCGGG + Exonic
1057277557 9:93684071-93684093 CAGCGCTGCCTTGGGCGACCAGG + Intergenic
1057482004 9:95452032-95452054 CAGGGCCGATTTCGGGGGGCGGG - Intronic
1058671849 9:107366782-107366804 CAGTGCCACCCTGGGGGAGTGGG + Intergenic
1060216749 9:121743023-121743045 CAGGGCCTCGTGGAGGGAGCAGG + Intronic
1060664312 9:125423809-125423831 CAGGGCCCTGTTGGGGGAGGTGG + Intergenic
1061237625 9:129351834-129351856 CAGGGCCAGCAAGGGGGAGCCGG - Intergenic
1061248891 9:129415124-129415146 CAGGGCCGCAGTGGGGGCTCAGG - Intergenic
1062040304 9:134401505-134401527 CGGGGCCACCTTGAGGGTGCCGG + Intronic
1062284125 9:135765562-135765584 CAGGGCCGCCCGGGCGGGGCAGG + Intronic
1062390540 9:136331969-136331991 GAGGGCTGGCTTGGGGGAGGAGG + Intronic
1062398176 9:136360939-136360961 CAGTGCCTCCATGGAGGAGCAGG + Intronic
1062429518 9:136520835-136520857 CAGGGCAGCCCTGGGGTCGCAGG - Intronic
1062435984 9:136546734-136546756 CGGGTCCCCCTTGGGGGAGCGGG - Intergenic
1062527023 9:136982052-136982074 CAGGGTGGCGTTGGGGGTGCAGG - Intronic
1062547544 9:137070433-137070455 CGGGGCCGCCATGGCCGAGCGGG - Exonic
1062574695 9:137200690-137200712 CATGGCCGCCCTGGGGCGGCCGG - Exonic
1203759569 EBV:5116-5138 CTCGGTGGCCTTGGGGGAGCTGG + Intergenic
1203461465 Un_GL000220v1:43671-43693 CAGGGCCGAATTGGGGTCGCAGG + Intergenic
1186334509 X:8572287-8572309 CAGGGCCTGCTTGGGGGAGGTGG - Intronic
1188147093 X:26627659-26627681 CAGGGCCTCCCTGAGGGAGGAGG - Intergenic
1189272965 X:39764683-39764705 CTGAGCCGCCCTGGGGGAGGGGG - Intergenic
1190118121 X:47638958-47638980 CAGCGCCCCCCTCGGGGAGCAGG - Exonic
1190335889 X:49261425-49261447 CTGGGCCTCATGGGGGGAGCTGG + Intronic
1192196311 X:69031211-69031233 CAGGGCCTCCTTGGCCCAGCTGG + Intergenic
1193340534 X:80343954-80343976 CAGGGCCTACTTGAGGGAGGAGG - Intronic
1194322107 X:92460964-92460986 CAGGGTACCCTTTGGGGAGCAGG + Intronic
1194346624 X:92773465-92773487 CAGGGCAGCCTTGGGTGCCCAGG + Intergenic
1195705971 X:107738379-107738401 GAGGGCAGGGTTGGGGGAGCAGG - Intronic
1197618004 X:128715802-128715824 CAGGGTATCCTTTGGGGAGCAGG + Intergenic
1197727819 X:129788079-129788101 CAGGGCATCCTTGTGGGATCTGG + Intronic
1198054481 X:132980407-132980429 CAGGGCCTACTTGAGGGAGGAGG + Intergenic
1199685315 X:150260126-150260148 CAGGGCCCCTTTGTGGGGGCTGG - Intergenic
1199984692 X:152941999-152942021 CAGGGCTGCCCAGGGGGAGGGGG + Intronic
1200079709 X:153570164-153570186 CAGGGCCGCCTTCCCGGGGCTGG + Intronic
1200244832 X:154517364-154517386 CAGGGCGCACTTGGGGCAGCCGG - Intergenic
1200630269 Y:5574443-5574465 CAGGGTACCCTTTGGGGAGCAGG + Intronic
1200654961 Y:5890109-5890131 CAGGGCAGCCTTGGGTGCCCAGG + Intergenic