ID: 920436857

View in Genome Browser
Species Human (GRCh38)
Location 1:205952548-205952570
Sequence TTTCTCTTCTCACTCTAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920436857_920436859 -9 Left 920436857 1:205952548-205952570 CCTGCTTAGAGTGAGAAGAGAAA No data
Right 920436859 1:205952562-205952584 GAAGAGAAAGCAAGCATTGGAGG No data
920436857_920436863 20 Left 920436857 1:205952548-205952570 CCTGCTTAGAGTGAGAAGAGAAA No data
Right 920436863 1:205952591-205952613 GGATCAGGAAAGAACCCTGTGGG No data
920436857_920436861 5 Left 920436857 1:205952548-205952570 CCTGCTTAGAGTGAGAAGAGAAA No data
Right 920436861 1:205952576-205952598 CATTGGAGGTCTTTTGGATCAGG No data
920436857_920436862 19 Left 920436857 1:205952548-205952570 CCTGCTTAGAGTGAGAAGAGAAA No data
Right 920436862 1:205952590-205952612 TGGATCAGGAAAGAACCCTGTGG No data
920436857_920436860 -1 Left 920436857 1:205952548-205952570 CCTGCTTAGAGTGAGAAGAGAAA No data
Right 920436860 1:205952570-205952592 AGCAAGCATTGGAGGTCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920436857 Original CRISPR TTTCTCTTCTCACTCTAAGC AGG (reversed) Intergenic
No off target data available for this crispr