ID: 920436863

View in Genome Browser
Species Human (GRCh38)
Location 1:205952591-205952613
Sequence GGATCAGGAAAGAACCCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920436856_920436863 29 Left 920436856 1:205952539-205952561 CCTCTGTCTCCTGCTTAGAGTGA No data
Right 920436863 1:205952591-205952613 GGATCAGGAAAGAACCCTGTGGG No data
920436857_920436863 20 Left 920436857 1:205952548-205952570 CCTGCTTAGAGTGAGAAGAGAAA No data
Right 920436863 1:205952591-205952613 GGATCAGGAAAGAACCCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920436863 Original CRISPR GGATCAGGAAAGAACCCTGT GGG Intergenic
No off target data available for this crispr