ID: 920437076

View in Genome Browser
Species Human (GRCh38)
Location 1:205953959-205953981
Sequence CTCAGAACAGTGAAGTGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920437070_920437076 1 Left 920437070 1:205953935-205953957 CCTGGGAAGCAGGACCCTTTGGC No data
Right 920437076 1:205953959-205953981 CTCAGAACAGTGAAGTGGTGGGG No data
920437065_920437076 20 Left 920437065 1:205953916-205953938 CCTGCTGGGCAAGTGGTTACCTG No data
Right 920437076 1:205953959-205953981 CTCAGAACAGTGAAGTGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920437076 Original CRISPR CTCAGAACAGTGAAGTGGTG GGG Intergenic
No off target data available for this crispr