ID: 920438796

View in Genome Browser
Species Human (GRCh38)
Location 1:205965001-205965023
Sequence TGGAGAAGAAGCAGCAGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920438793_920438796 -8 Left 920438793 1:205964986-205965008 CCTTCCGGGGGTAACTGGAGAAG No data
Right 920438796 1:205965001-205965023 TGGAGAAGAAGCAGCAGGTGAGG No data
920438787_920438796 15 Left 920438787 1:205964963-205964985 CCTCATCTGAATGTGGATCATCT No data
Right 920438796 1:205965001-205965023 TGGAGAAGAAGCAGCAGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920438796 Original CRISPR TGGAGAAGAAGCAGCAGGTG AGG Intergenic
No off target data available for this crispr