ID: 920441985

View in Genome Browser
Species Human (GRCh38)
Location 1:205986845-205986867
Sequence CCTCGGCCTGCACTGTGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 125}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920441985_920441989 14 Left 920441985 1:205986845-205986867 CCAGAACACAGTGCAGGCCGAGG 0: 1
1: 0
2: 1
3: 6
4: 125
Right 920441989 1:205986882-205986904 CCCCTGTTTAATTGTCTCTGTGG 0: 1
1: 0
2: 0
3: 15
4: 170
920441985_920441993 30 Left 920441985 1:205986845-205986867 CCAGAACACAGTGCAGGCCGAGG 0: 1
1: 0
2: 1
3: 6
4: 125
Right 920441993 1:205986898-205986920 TCTGTGGCTCCTGCAGGTCCTGG 0: 1
1: 0
2: 9
3: 54
4: 477
920441985_920441992 24 Left 920441985 1:205986845-205986867 CCAGAACACAGTGCAGGCCGAGG 0: 1
1: 0
2: 1
3: 6
4: 125
Right 920441992 1:205986892-205986914 ATTGTCTCTGTGGCTCCTGCAGG 0: 1
1: 0
2: 5
3: 16
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920441985 Original CRISPR CCTCGGCCTGCACTGTGTTC TGG (reversed) Intronic
900156398 1:1204987-1205009 CCTGGGGCTGCACCCTGTTCTGG - Intronic
900955815 1:5885670-5885692 CCTCGGCCTGGATTCTGCTCTGG - Intronic
903298147 1:22359004-22359026 CCTCTATCTGGACTGTGTTCTGG - Intergenic
903421325 1:23219512-23219534 CCTCGGCCTCCACTCTACTCAGG + Intergenic
905576383 1:39048077-39048099 CCTGGGCCTGCACTTTGATTTGG - Intergenic
906264225 1:44416735-44416757 CCTTGACCTTCACTGTGGTCGGG + Intronic
906636076 1:47411604-47411626 TCTCTGCCTTCACTGTGCTCAGG - Intergenic
907304260 1:53505066-53505088 GCTCTGCCTGCTCTGTGTCCAGG - Intergenic
909971092 1:81990782-81990804 CCTCGGACTTCACTTTCTTCTGG - Exonic
910243092 1:85109578-85109600 CCTGGGCCTGCACTGCATCCTGG - Intronic
914899286 1:151703351-151703373 CCTGGGCCTTGACTGGGTTCTGG - Exonic
915554627 1:156654575-156654597 ACTCTGCCTGCGCTGGGTTCAGG + Intronic
918209461 1:182338177-182338199 CCTCGGCCTGGACTGTGACATGG + Intergenic
919280109 1:195479495-195479517 CCTTGACCTGGACTGTCTTCTGG - Intergenic
920441985 1:205986845-205986867 CCTCGGCCTGCACTGTGTTCTGG - Intronic
922784137 1:228274786-228274808 CCTCAGCCTCCACGGTGATCTGG - Exonic
923085821 1:230703108-230703130 CCTTGCCAGGCACTGTGTTCTGG + Exonic
923537509 1:234864361-234864383 GCCCAGCCTGCACTGTTTTCTGG - Intergenic
924739952 1:246789181-246789203 CCTCGGGCTGCACGTTCTTCCGG + Intergenic
1062845498 10:700653-700675 CCTGTGCCTGCACTGTGTGTGGG + Intergenic
1062912018 10:1217411-1217433 CCACGGCCTGGACCGTGCTCAGG + Intronic
1065001761 10:21343626-21343648 CCTCAGTGTGCCCTGTGTTCTGG - Intergenic
1067308516 10:45090686-45090708 CATCTTTCTGCACTGTGTTCGGG + Intergenic
1071366416 10:84904951-84904973 GCTCAGCCCTCACTGTGTTCAGG + Intergenic
1072926707 10:99622065-99622087 CCTCGGCCTTCACAGTGTTGGGG - Intergenic
1076546940 10:131251528-131251550 CCTCAGCTTCTACTGTGTTCCGG + Intronic
1077889936 11:6411539-6411561 CCTGGGCCTGGACTGTGATGGGG - Intronic
1083420207 11:62547994-62548016 CCACGGCCTGTACTCTGTGCCGG - Intronic
1083899629 11:65637280-65637302 CCTGGGCCTGCACTGCCTGCAGG + Exonic
1085085525 11:73664215-73664237 CTAAGGCCTGTACTGTGTTCAGG + Intergenic
1094003135 12:25718088-25718110 ACTGGGCCTGGACTGTTTTCAGG + Intergenic
1095493412 12:42759739-42759761 CCTCCTGCTACACTGTGTTCAGG + Intergenic
1095980482 12:47971043-47971065 CCTCTGCCTGCACTAGGGTCAGG - Intergenic
1097187998 12:57205815-57205837 GCTGGGCCAGCACTGTGCTCAGG - Intronic
1106512607 13:30424200-30424222 CCTCTGCCTTCACTCTGTTAAGG + Intergenic
1106628125 13:31441944-31441966 CCTTGGCAGGCACTGTGTGCAGG + Intergenic
1109247306 13:59971060-59971082 CCTCCGCCTCCACTGCCTTCTGG - Exonic
1113740566 13:112710017-112710039 CCTCTGCCTGCACTCTGCCCTGG + Intronic
1113812042 13:113148920-113148942 CCTCCTCCTGCTCCGTGTTCCGG - Exonic
1114668372 14:24395589-24395611 CTCTGTCCTGCACTGTGTTCAGG + Intergenic
1121124745 14:91398972-91398994 CCTCGGGCAGCCCTGTGTGCTGG + Intronic
1121301880 14:92878277-92878299 CCGAGGCCTGCTCTGTGTCCCGG + Intergenic
1122204857 14:100143283-100143305 CCTCAGCCTCCACTATGTTGGGG + Intronic
1130605126 15:85308613-85308635 CCTCGGCCTCCCCAGAGTTCTGG - Intergenic
1131459138 15:92606267-92606289 CCTCTTCCTGCACTGGTTTCCGG - Intergenic
1132336587 15:101051981-101052003 CTGTGACCTGCACTGTGTTCTGG - Intronic
1132685529 16:1160522-1160544 CCTCGGCGGGCACAGTGCTCTGG - Intronic
1132728403 16:1348727-1348749 CTCTGGCCTGCACTGTGTCCTGG - Exonic
1132744536 16:1431227-1431249 CCTGGGCCTGCCCAGTGGTCTGG - Intergenic
1136227713 16:28870201-28870223 CCTGGCCCTGCTCTGTGTCCCGG + Intronic
1136717224 16:32290302-32290324 CCTCGCACTGCTGTGTGTTCTGG - Intergenic
1136835599 16:33496556-33496578 CCTCGCACTGCTGTGTGTTCTGG - Intergenic
1138984329 16:62308902-62308924 CCTAGGCCTGCACAGGGTTAGGG - Intergenic
1142175959 16:88645520-88645542 CCTCTGCCTGCCCTGGGCTCCGG - Intronic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1203009205 16_KI270728v1_random:227476-227498 CCTCGCACTGCTGTGTGTTCTGG + Intergenic
1203145777 16_KI270728v1_random:1796869-1796891 CCTCGCACTGCTGTGTGTTCTGG - Intergenic
1143584696 17:7845258-7845280 CCTGGGCCTTGACTGTGTGCTGG + Intronic
1151582159 17:74986380-74986402 CCTCGGCCTCCCCAGAGTTCTGG + Intergenic
1151719841 17:75848774-75848796 GCTGGGCCTGCACTGTGATGGGG + Intronic
1151982129 17:77519333-77519355 CCTTGGCCTCCACTCTGTGCTGG + Intergenic
1152096167 17:78272933-78272955 CCTCGGCTTCCACTGTCTCCAGG - Intergenic
1152561665 17:81081812-81081834 CCTGGGGCTGCACTGCGGTCAGG - Intronic
1154146987 18:11874762-11874784 TCTCTGCCTGGGCTGTGTTCTGG - Intronic
1160245211 18:77153168-77153190 ACTCAGCCAGCACTGTTTTCTGG - Intergenic
1160297074 18:77648648-77648670 CCTCGGCCTTCACAGAGCTCAGG + Intergenic
1162802393 19:13118562-13118584 CCGCAGCCTGCACTGTGCCCGGG + Intronic
1164434574 19:28218506-28218528 CCTCTGCCTCCACTGTCCTCAGG - Intergenic
1164491732 19:28720901-28720923 ACTCTCCCAGCACTGTGTTCTGG + Intergenic
1165586423 19:36920142-36920164 CCTAGGCCTACACAGTGTCCAGG - Intronic
925020594 2:564767-564789 CGGCGGCCTCCACTGTGTCCGGG - Intergenic
925646740 2:6044207-6044229 CCTCGGGCTGCAGTGTGCTGGGG - Intergenic
926785276 2:16511812-16511834 CCTCGGCCTCTACTGGGTCCTGG - Intergenic
927200672 2:20576229-20576251 CCTCGGCCTCCAAAGTGTTCTGG + Intronic
930883620 2:56299466-56299488 CCTGAGGCTGCACTCTGTTCTGG + Intronic
937275809 2:120683370-120683392 TCTTGGCCTGCCCTGTGTCCCGG + Intergenic
937284111 2:120739167-120739189 CCAGGGGCTGCACTGTGTACAGG - Intronic
938380063 2:130831598-130831620 CCCCTGCCTCCCCTGTGTTCAGG + Intergenic
942784919 2:179689649-179689671 CCTCACCCTGCACTGTGCCCAGG + Intronic
944461590 2:199955629-199955651 CCTCGGCCTGGGCTGCGTGCTGG + Exonic
1169029526 20:2396784-2396806 CCAGGGCCTGCACTGGGTCCTGG + Intronic
1170969958 20:21106303-21106325 CCTCGCCCCGCACTGTGCACGGG + Intergenic
1171988450 20:31677077-31677099 TCTCTGCCTGCTCTGTGCTCTGG - Intronic
1174898957 20:54478237-54478259 CTTTGGTTTGCACTGTGTTCTGG - Intronic
1175749090 20:61482828-61482850 CCTGGTCCTCCACTGTATTCAGG + Intronic
1180119330 21:45736440-45736462 CCTCAGGATGCACTGTGCTCAGG - Intronic
950343800 3:12273210-12273232 CTTTGCCCTGCACTGTGTTAGGG - Intergenic
953518142 3:43617087-43617109 CCTTGGCCTAAACTGAGTTCTGG + Intronic
954689053 3:52386186-52386208 CCTCTGTCTGCACTGAATTCCGG - Exonic
972793325 4:42393459-42393481 CCTCTTCCTGCCCTGTGTTTCGG - Intergenic
976827306 4:89275077-89275099 CTTTGGCAAGCACTGTGTTCTGG + Intronic
982065299 4:151649678-151649700 GCTCGGCCTGCCCTGTGTTCGGG + Exonic
986017091 5:3766941-3766963 ACACGACCTGCTCTGTGTTCTGG + Intergenic
986421276 5:7586446-7586468 CATAGGCCTGCACTGAGATCTGG - Intronic
986971228 5:13339389-13339411 CCTCAGCCTCCAGTGTGTTTGGG + Intergenic
987340340 5:16934441-16934463 CCTCGGGCTACAGTGAGTTCCGG - Intronic
988666417 5:33333126-33333148 CTTGGGCATTCACTGTGTTCAGG - Intergenic
995538393 5:113160147-113160169 CCTGGGCCTGCTTTGTGATCTGG - Intronic
998447737 5:142211464-142211486 TCTCGGCCTGCGGTGTGTTCTGG + Intergenic
999422864 5:151459843-151459865 CCTCTGCCTGCACTGTCTGCTGG + Intronic
1001475505 5:172047801-172047823 CCTTGGCCTGTACTATGTGCTGG + Intronic
1001560939 5:172668577-172668599 CCACGGGGTGCACTGTGCTCTGG - Intronic
1002352679 5:178594154-178594176 GCTCTACCTGCACTGTGTCCTGG - Intergenic
1005838480 6:29724802-29724824 CCTCGGCCTCCACTTAGGTCAGG + Intronic
1005848471 6:29801036-29801058 CCTCGGCCTCCACTCAGGTCAGG + Intergenic
1007652671 6:43432943-43432965 CCACGGCCTGCTCTATGCTCTGG + Exonic
1011298104 6:85845750-85845772 TATTGGCCTCCACTGTGTTCTGG + Intergenic
1015970859 6:138741526-138741548 CCTTGTTCTCCACTGTGTTCTGG + Intergenic
1017216131 6:151909654-151909676 CCTCAGCCACCACTGGGTTCAGG + Intronic
1018462849 6:164015566-164015588 CCTTGTCTTGCACTGTGTTGGGG + Intergenic
1019440360 7:1042906-1042928 CCACGGCCTGCAGTGTGACCTGG + Intronic
1019594304 7:1851282-1851304 CCTCGGCCGGCACAGGGTTGGGG + Intronic
1019733359 7:2639058-2639080 CCTCGGTCTGCACTGGGGTGTGG + Intronic
1022377131 7:29824622-29824644 TCTCATCCTCCACTGTGTTCTGG - Intronic
1022384781 7:29890758-29890780 CTCAGGCCTGCCCTGTGTTCAGG + Intronic
1023337654 7:39186936-39186958 CTGCCGCCTGCTCTGTGTTCTGG + Intronic
1023913315 7:44570321-44570343 TCTCGGCCTGACCTCTGTTCTGG + Intronic
1024005187 7:45220021-45220043 ACTCTGCCTGCACCGTGGTCAGG + Intergenic
1031969403 7:128053420-128053442 CCTTAGCCTGCCCTGTCTTCAGG + Intronic
1033979591 7:147147587-147147609 CCTCTGCGTGGACTGTGGTCAGG + Intronic
1038583515 8:28770148-28770170 CCTCAGCCGGCACTCGGTTCAGG + Intronic
1039494579 8:37971209-37971231 CCTCTGAATGCACTGAGTTCAGG + Intergenic
1049041912 8:140118889-140118911 CCTGGCCCTGCAGTGTGTCCTGG + Intronic
1052106883 9:24529692-24529714 CCTCAGCCTGCCCAGAGTTCTGG + Intergenic
1053468595 9:38328548-38328570 CCTCGGCCTGCACTGGGTCTAGG + Intergenic
1060246890 9:121954006-121954028 CCTCGGCCAGCTCTGTCATCTGG - Intronic
1061459944 9:130729497-130729519 CATCTCCCTGCACTGTGTTTGGG + Intronic
1062371173 9:136239593-136239615 CCTCGCCCTGCAGTGTGTGCAGG - Intronic
1185761296 X:2691393-2691415 CTTCGGCCTGCTGGGTGTTCTGG + Exonic
1187572423 X:20518646-20518668 CCCCCGGCTGCACTTTGTTCAGG + Intergenic
1188870316 X:35364116-35364138 CCTTGTTCTGCACTGTGATCTGG - Intergenic
1195686437 X:107591013-107591035 CCTGGGCCTGGACTTTTTTCGGG + Intronic
1197551599 X:127899167-127899189 CATAGGCCTGCAATCTGTTCTGG - Intergenic