ID: 920444115

View in Genome Browser
Species Human (GRCh38)
Location 1:206002740-206002762
Sequence TGGCATTGCAGCACTGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 260}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920444105_920444115 10 Left 920444105 1:206002707-206002729 CCAGATCCGTCCGACTCTATTCA 0: 1
1: 0
2: 0
3: 0
4: 23
Right 920444115 1:206002740-206002762 TGGCATTGCAGCACTGGGCAAGG 0: 1
1: 0
2: 0
3: 19
4: 260
920444104_920444115 11 Left 920444104 1:206002706-206002728 CCCAGATCCGTCCGACTCTATTC 0: 1
1: 0
2: 0
3: 1
4: 29
Right 920444115 1:206002740-206002762 TGGCATTGCAGCACTGGGCAAGG 0: 1
1: 0
2: 0
3: 19
4: 260
920444107_920444115 4 Left 920444107 1:206002713-206002735 CCGTCCGACTCTATTCATTGGCT 0: 1
1: 0
2: 0
3: 6
4: 108
Right 920444115 1:206002740-206002762 TGGCATTGCAGCACTGGGCAAGG 0: 1
1: 0
2: 0
3: 19
4: 260
920444108_920444115 0 Left 920444108 1:206002717-206002739 CCGACTCTATTCATTGGCTCCCC No data
Right 920444115 1:206002740-206002762 TGGCATTGCAGCACTGGGCAAGG 0: 1
1: 0
2: 0
3: 19
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920444115 Original CRISPR TGGCATTGCAGCACTGGGCA AGG Intronic
903109954 1:21123802-21123824 TGGAATTACAGCACTGGATAAGG - Intronic
903124556 1:21238741-21238763 TGGCATTGGAGCCCTGGCCCTGG - Intronic
903178000 1:21591859-21591881 TGGGAATTCAGCCCTGGGCAAGG - Intergenic
904319558 1:29688039-29688061 AGGCAGGGCAGCCCTGGGCATGG + Intergenic
904902787 1:33870517-33870539 TGGAAATGCAGCACTGGGTAGGG - Intronic
905361873 1:37426361-37426383 TGTCATGGCAGTACTGTGCATGG + Intergenic
912335846 1:108861955-108861977 TGGCATTGCAGCATTGGATCAGG - Intronic
912455080 1:109791810-109791832 TGGCCTTGCAGCAGTGAGCAGGG - Intergenic
912895380 1:113581663-113581685 TAGCATGGTAGCAATGGGCAGGG - Intronic
913197674 1:116471564-116471586 TGGCATTGAAGCACAGGGAGGGG - Intergenic
915543406 1:156582643-156582665 TGGGAAGGCAGCAGTGGGCAGGG + Intronic
916479629 1:165203130-165203152 TGGGGTTGAATCACTGGGCAGGG - Exonic
917214342 1:172662650-172662672 GGGCATTTCAGCGCTGGGAACGG + Intronic
919146755 1:193645131-193645153 TGGCTTTGCAGCACTGTGGTGGG + Intergenic
919757372 1:201074434-201074456 TGGCCTTCCAGCTCTGGACAGGG - Intronic
920444115 1:206002740-206002762 TGGCATTGCAGCACTGGGCAAGG + Intronic
920693933 1:208167448-208167470 ACGCATCCCAGCACTGGGCAGGG - Intronic
922903231 1:229154614-229154636 GGGCGCTCCAGCACTGGGCATGG - Intergenic
923434695 1:233956896-233956918 TGGCATTCCACCACTAGGCGGGG - Intronic
1065279198 10:24117304-24117326 TGGGATTACAGCACTGTGCTGGG + Intronic
1065903146 10:30226022-30226044 TGTAATTGCAGCACTTTGCAAGG - Intergenic
1067276407 10:44838802-44838824 TGGGATTACAGCACTGTGCCCGG + Intergenic
1067995914 10:51273087-51273109 TGCCTCTGCATCACTGGGCATGG + Intronic
1068875079 10:61987073-61987095 TGGCCTGGCAGCTCTGGCCAAGG - Intronic
1069416652 10:68206546-68206568 TGGACTTGCAGCAGTGGGGAGGG + Intronic
1069627321 10:69876358-69876380 TGGCCTTGCAGCTCTGAGGAGGG + Intronic
1072044910 10:91644567-91644589 TGGCTTTGCAGCACTGTGGTGGG - Intergenic
1073365836 10:102940326-102940348 TGGCACTGTAGCAGTGGGAATGG - Intronic
1074762314 10:116676254-116676276 GGGCCCTGCAGGACTGGGCAGGG - Intronic
1074803878 10:117028548-117028570 GGGCAGTGGAGCACTGGGCCTGG - Intronic
1075519808 10:123136646-123136668 TGGAATTGGAGCCCCGGGCACGG + Intronic
1075648654 10:124113071-124113093 TGGCAGTGCAGCCCCGGGCGGGG + Intergenic
1076092695 10:127702014-127702036 TAGCAGTGCAGAAGTGGGCAGGG - Intergenic
1076383196 10:130038911-130038933 GGGGAGTGCTGCACTGGGCAGGG + Intergenic
1079247163 11:18761096-18761118 TTGCAGTGCAGGACTGAGCAGGG + Intronic
1079817168 11:25076299-25076321 TGTAATTGCAGCACTTTGCAAGG - Intronic
1079860776 11:25668772-25668794 TGGGATTACAGCACTGTGCCTGG - Intergenic
1080115958 11:28621825-28621847 CTGCATTGCACCACTGGCCAGGG + Intergenic
1083441954 11:62682674-62682696 TGTAATTCCAGCACTGGGCATGG - Intergenic
1083718878 11:64594162-64594184 AGGCATGGCAGCACTGAGCTAGG + Intronic
1087083766 11:94196775-94196797 AGGCAGTACAGCACAGGGCAGGG - Intergenic
1089150356 11:116359092-116359114 TGGTATTCCAGCACTTGGGATGG - Intergenic
1092465104 12:8724606-8724628 TGGGTCTGCAGCACTGGGCCTGG + Intronic
1092952983 12:13525363-13525385 GGGGAATGCAGCACTGGGAAAGG + Intergenic
1096085571 12:48863095-48863117 AAGCACTGCAGCACTGGGGAAGG + Intronic
1098953489 12:76665520-76665542 TCGCATTTCAGCACAGGGCATGG - Intergenic
1099633952 12:85188648-85188670 TGGCATTGCTGTAGTGGGAAGGG - Intronic
1100014308 12:89990324-89990346 TGTGAATGCAGTACTGGGCATGG + Intergenic
1102849138 12:116222472-116222494 TGGCATTACAGCATAGGTCATGG - Intronic
1102857209 12:116304728-116304750 AGGCCTTGCAGGCCTGGGCAAGG - Intergenic
1104572641 12:129938511-129938533 TGGCTTTGCAGCTGTGGCCAGGG + Intergenic
1104794775 12:131509791-131509813 TGGCATTGGAGTAGAGGGCACGG + Intergenic
1111431615 13:88153198-88153220 TGGCAGGGCAGCAGTTGGCAAGG - Intergenic
1112492166 13:99876974-99876996 GGGCAGGGCAGCACTGAGCAGGG - Intronic
1113364318 13:109661952-109661974 TGGCACAGCATTACTGGGCAGGG + Intergenic
1113786161 13:113003198-113003220 TGGCTGTGGAGCACTGGGGAAGG + Intronic
1114730984 14:24992334-24992356 TGCCTTTGCAGCATTGGTCATGG - Intronic
1118887143 14:69877085-69877107 TGTCAGTGCTGCACAGGGCACGG + Intronic
1119147793 14:72332544-72332566 TGGGTTTCCAGCACTGGTCATGG - Intronic
1119212868 14:72845907-72845929 TGTCAGTGCAGCACCCGGCAGGG + Intronic
1121624452 14:95374154-95374176 TGGAAGAGCAGCACAGGGCAAGG + Intergenic
1121848026 14:97191405-97191427 TGGCATGGCTGCAGTGAGCAGGG - Intergenic
1121850866 14:97219965-97219987 TGGAATTCCAGAACTGTGCAGGG + Intergenic
1122135443 14:99630190-99630212 TGGGATCTCAGCATTGGGCAGGG + Intergenic
1122857060 14:104565061-104565083 AGGCATTGCTGCCCTGTGCAGGG - Intronic
1124177363 15:27438936-27438958 TGAAATTCCAGCACTGGGCTGGG - Intronic
1124841396 15:33245171-33245193 TGGGAATGAAGCACTGGGCATGG - Intergenic
1129878667 15:78993430-78993452 TGGCAGAGCTGCCCTGGGCAGGG + Intronic
1130965920 15:88697560-88697582 TGGCTTTGCAGCTTTGGGCTTGG - Intergenic
1131741831 15:95401149-95401171 TGGCATTTCAGCACTGGATGGGG - Intergenic
1132209356 15:100008551-100008573 TGGCAGTCCAGCGCTGGCCAAGG - Intronic
1132669197 16:1095757-1095779 TGGGATTGTAGCACAGGGCAAGG + Exonic
1132998628 16:2837874-2837896 TGGCACAGCAGCCCTGGTCAAGG + Intronic
1133003665 16:2865203-2865225 TGGTAGTACAGCCCTGGGCAGGG - Intergenic
1133025502 16:2987439-2987461 TGGCAGGGAGGCACTGGGCATGG - Intergenic
1133103826 16:3494493-3494515 TGTCAAGGCAGGACTGGGCACGG - Intronic
1133734092 16:8600831-8600853 TGTCATTGCAGGCCTGGGCTGGG - Intergenic
1135503895 16:23019953-23019975 GGGCAGTCCAGCCCTGGGCAGGG + Intergenic
1136165738 16:28451765-28451787 TGGCATCGCAGGGCTGGCCATGG - Intergenic
1136197234 16:28663244-28663266 TGGCATCGCAGGGCTGGCCATGG + Intergenic
1136213573 16:28777391-28777413 TGGCATCGCAGGGCTGGCCATGG + Intergenic
1136258306 16:29057315-29057337 TGGCATCGCAGGGCTGGCCATGG + Intergenic
1136271579 16:29151955-29151977 TGCCAGGGCCGCACTGGGCAGGG + Intergenic
1136320189 16:29479001-29479023 TGGCATCGCAGGGCTGGCCATGG - Intergenic
1136417642 16:30113430-30113452 TGGCATAGCTGCCCAGGGCAGGG + Exonic
1136434760 16:30218342-30218364 TGGCATCGCAGGGCTGGCCATGG - Intergenic
1137497447 16:48981671-48981693 TTTCCTTGCACCACTGGGCAGGG + Intergenic
1137538909 16:49348751-49348773 TGGCTATGCACCTCTGGGCATGG + Intergenic
1137995676 16:53208560-53208582 CAGCACTGCAGCACTGGGAAAGG - Intronic
1138043975 16:53702441-53702463 AGGCATTGCAGCATTGTGCAGGG - Intronic
1138245060 16:55461202-55461224 TGCCATGTCTGCACTGGGCAAGG - Intronic
1138711004 16:58970270-58970292 TGGCCTGGCAGCACTTGGGAGGG + Intergenic
1140428761 16:74883805-74883827 TGGCATTCCAGCTGTGGGAATGG - Intronic
1140922481 16:79551915-79551937 TGGCATTAGAGGACTGGGCCTGG + Intergenic
1141944914 16:87303335-87303357 TGGCTTTGCAGAACTGTGAAGGG + Intronic
1142075194 16:88113939-88113961 TGCCAGGGCCGCACTGGGCAGGG + Intronic
1142970337 17:3607001-3607023 TGTCATTGCAGCCCTGAGGAAGG - Intergenic
1143848440 17:9791131-9791153 TGCCATCTCAGGACTGGGCAAGG - Exonic
1144658188 17:17051480-17051502 AAGCAGTGCAGCTCTGGGCAAGG + Intronic
1145807003 17:27741657-27741679 TGGCAGTGCAGCTCTTTGCATGG - Intergenic
1146258196 17:31403980-31404002 CTGCATCCCAGCACTGGGCAGGG + Intronic
1148109981 17:45138962-45138984 AGGCAATTCAGCTCTGGGCAGGG - Intronic
1148820760 17:50358283-50358305 TGGCCGTGCAGCGCTGGGCCCGG + Exonic
1149878971 17:60268276-60268298 TGGAAATGCAGAGCTGGGCATGG + Intronic
1152075175 17:78154928-78154950 TGTCTGTGCAGCCCTGGGCAGGG + Intronic
1152336889 17:79703761-79703783 TGGCATGGCTGCTGTGGGCATGG - Intergenic
1153348889 18:4057425-4057447 TGGCCTTCCAGCACTTGGGAGGG - Intronic
1153745751 18:8177898-8177920 TGGCCTACCAGCACTGGGGAGGG + Intronic
1153903899 18:9643421-9643443 TGTCATATTAGCACTGGGCAGGG + Intergenic
1154001198 18:10483737-10483759 TGGCATGGGAGCACGGGGCTGGG + Intronic
1154129816 18:11727162-11727184 GGGCCTTGCAGGGCTGGGCAGGG - Intronic
1155718723 18:28982468-28982490 TGGCTGTGCAGAAGTGGGCAAGG + Intergenic
1156095475 18:33526268-33526290 TGGCATTGCAGCAATTTGGATGG - Intergenic
1156212980 18:34967252-34967274 TGGCAGTGATGCACAGGGCAAGG + Intergenic
1159721583 18:71898486-71898508 TGGCATTGCTACGGTGGGCAAGG + Intergenic
1160487923 18:79310265-79310287 GGGGCTTGCAGCACTGGGAAGGG + Intronic
1160850973 19:1192272-1192294 TGTCATCCCAGCACTGTGCAGGG - Intronic
1162482371 19:10935678-10935700 TGGCCCTGCACCACTAGGCAGGG - Intergenic
1164539989 19:29115175-29115197 TTGCCCTGAAGCACTGGGCATGG - Intergenic
1164761544 19:30731961-30731983 TGTCATTTCAGTCCTGGGCAAGG + Intergenic
1165897443 19:39151358-39151380 CGGCCTTGCAGCACGGGGCGTGG - Intronic
925596831 2:5563595-5563617 TGGCAGTGCGGCCCTGGGCTGGG + Intergenic
926159028 2:10475142-10475164 TGTCATTGCAGGACTGGGAGAGG - Intergenic
926799752 2:16649727-16649749 TGGCTATACAGCACAGGGCACGG + Intronic
927281853 2:21315729-21315751 TGACTTTGAAGCACTGGGCCCGG + Intergenic
927728484 2:25447938-25447960 TGACATTCAAGCACAGGGCAGGG + Intronic
927933119 2:27058414-27058436 GGCCATTGCAGCCCTGGACATGG + Exonic
928086060 2:28347109-28347131 TGGAAAAGCAGCACTGGGCCAGG + Intergenic
928162206 2:28938959-28938981 TGGCCTGGCAGCACTGGTGAGGG + Intronic
929011261 2:37447500-37447522 AGGCATTGCAGAGCTGGGAAGGG - Intergenic
931613091 2:64125125-64125147 TGGCATTCCTGGACAGGGCATGG - Intronic
933187549 2:79295266-79295288 TGGCTTTGCAGAACATGGCAGGG - Intronic
933829700 2:86197010-86197032 GGGCATGACAGCAGTGGGCAGGG - Intergenic
936027835 2:109047000-109047022 TGGCACTGCAGGGCAGGGCAGGG - Intergenic
937216325 2:120315839-120315861 GGGCATTTCAGCACTGTGCCGGG - Intergenic
937295646 2:120808303-120808325 TGGGATTGCAGCACTCGGCGGGG - Intronic
938024766 2:127937703-127937725 TGGGATTACAGCACTGTGCCTGG - Intergenic
938240766 2:129740988-129741010 AGGCATGGCAGAGCTGGGCAGGG + Intergenic
939080548 2:137655651-137655673 TAGCATTGCATACCTGGGCAAGG - Exonic
940274297 2:151922996-151923018 GGGTATTGCACAACTGGGCAGGG - Intronic
940799506 2:158117883-158117905 TGACATCGCAGCACCGTGCATGG - Exonic
941353739 2:164463944-164463966 TGTCAGTGAAGCCCTGGGCAAGG - Intergenic
941891976 2:170592105-170592127 TGGAATCCCAGCACTGGGTATGG - Intronic
942125872 2:172824424-172824446 TAGCATCTCAGCACAGGGCAAGG - Intronic
944389732 2:199205131-199205153 TGGCATTGCAACACTGAATATGG + Intergenic
945620592 2:212131734-212131756 TTGAATTTCATCACTGGGCATGG - Intronic
947838535 2:233192067-233192089 TGCCAGTGCTGCACTGGGAACGG - Intronic
947928558 2:233942685-233942707 TGGCATAGCAGCTTGGGGCATGG + Exonic
948139017 2:235659395-235659417 TGGCTTTGGTGCACTGGGAAGGG + Intronic
948290431 2:236820268-236820290 TGGCAGAGAAGCAGTGGGCATGG + Intergenic
948345877 2:237297716-237297738 TGGCTCTGCAGCACTGGGGGTGG - Intergenic
948508498 2:238447559-238447581 TGGCTGTGCAGCCCTGGGTAAGG - Exonic
1169598240 20:7225994-7226016 TGTCCTTGCACCCCTGGGCAAGG + Intergenic
1170581779 20:17704833-17704855 TGGCAATGCAGAACTGGAGATGG - Intronic
1170864324 20:20139655-20139677 CTGCATTTCAGAACTGGGCAAGG - Intronic
1173847640 20:46198122-46198144 TGGCAGTGTTGCTCTGGGCATGG + Intronic
1175795470 20:61767761-61767783 GGACACTGCAGCCCTGGGCAGGG + Intronic
1175953997 20:62598917-62598939 TGGCGTGGCTGGACTGGGCATGG + Intergenic
1177014020 21:15761638-15761660 TGGCCTGCCAGCACTGGGGAGGG - Intronic
1177595746 21:23240183-23240205 TGGCATCCCAGCACTCTGCAGGG - Intergenic
1179479317 21:41667609-41667631 TTTCATTGCAAGACTGGGCATGG + Intergenic
1179985775 21:44919704-44919726 TGGCATGGCTGCAATGGGGAAGG - Intronic
1180913760 22:19471165-19471187 TGTCATTGCAGATCTGGGCTGGG - Intronic
1182423023 22:30257676-30257698 TCGCCACGCAGCACTGGGCAGGG - Intergenic
1182761192 22:32723640-32723662 TGGAATTTCAGCTCTGGGCTCGG + Intronic
1183058293 22:35320182-35320204 TGGCATGGCAGAACAGGCCAGGG + Intronic
1184168165 22:42742938-42742960 GGGCATTGGAGCACTAGGCTTGG - Intergenic
1185014521 22:48335251-48335273 GGGCACTGCAGCTCAGGGCAGGG - Intergenic
949173859 3:1034858-1034880 TGGCTTTGCAGCACTGTGCTGGG + Intergenic
950420729 3:12897586-12897608 CAGCATTGCAACACTGAGCAGGG - Exonic
950448042 3:13049319-13049341 TGGCAGGGCAGCCCTGGGCCTGG - Intronic
954655763 3:52193229-52193251 TCGCATCGTAGCTCTGGGCAAGG + Intergenic
954683766 3:52359643-52359665 AGGCACTGGAGCACAGGGCAAGG - Intronic
956141219 3:66148540-66148562 TGGCCTTGACTCACTGGGCATGG + Intronic
956576486 3:70758006-70758028 TGGCATTGGAGCAGTTGGCATGG + Intergenic
956981202 3:74640761-74640783 TGGCTTTGCAGCACTGAACAGGG - Intergenic
957605593 3:82394813-82394835 GGGCAGGGCAGCACAGGGCAGGG - Intergenic
959061365 3:101619366-101619388 TGGCCTTGTAGCACTGAACAGGG + Intergenic
961155239 3:124674274-124674296 TGGCCTTGAACCACTGGGTAGGG + Intronic
961405027 3:126672500-126672522 TGGGATTGCACCACTGGGGCTGG + Intergenic
961943030 3:130656824-130656846 TGGCATGTCAGCACTGCCCATGG + Intronic
962249837 3:133829143-133829165 TGGCATTTGAGCACTGGTCGAGG - Intronic
962404667 3:135090679-135090701 TGGCACTGCAGACATGGGCATGG - Intronic
964685124 3:159386938-159386960 TGGCAGTGCAGCCCTGATCAAGG + Intronic
966420990 3:179733846-179733868 TGGCTTTGCAACTTTGGGCAAGG - Intronic
966979303 3:185116042-185116064 AGGCATAGCAGCACTGGACTGGG - Intronic
968224412 3:196964643-196964665 TGGCAGTGCTAGACTGGGCACGG - Intronic
969648039 4:8444944-8444966 TGGGGTTGCCACACTGGGCAGGG + Intronic
971587631 4:28424668-28424690 GTGCATTGCAGCACTGTTCATGG + Intergenic
971689295 4:29812144-29812166 TGGCCTCGCAGCACTGAGGAGGG + Intergenic
972324860 4:38005827-38005849 TGGCATGGCAGCAGTGGGACTGG - Intronic
972349789 4:38225975-38225997 TGGCATTCCAAGGCTGGGCATGG - Intergenic
972359390 4:38313608-38313630 TGGCAGTGTGGAACTGGGCAAGG + Intergenic
972939103 4:44175738-44175760 TGTGATTGCAGCTCTGGGCCTGG - Intronic
976541562 4:86283215-86283237 TGGCTTTCCAGAACTGGGCCAGG - Intronic
979417474 4:120461060-120461082 TGGCTTTGCGGCACTGTGCTGGG - Intergenic
981316912 4:143349463-143349485 TGGCAGTGCAGCCCTGGGCTGGG + Intronic
981928761 4:150167945-150167967 TGGCCTTTCAGCACTTGGGAGGG - Intronic
982166065 4:152614569-152614591 TGGCATTCCTGCCCTGGGGAGGG - Intergenic
983178135 4:164615550-164615572 TAGCATTTAAGCACTGGTCATGG + Intergenic
983557114 4:169068609-169068631 TGGCAGTGCTGCTCTGGCCAAGG - Intergenic
984485896 4:180368803-180368825 TGGCATTGCAGAACAAGTCAAGG + Intergenic
985686064 5:1282312-1282334 TGGCTGTGCAGCTCTGGGCTGGG - Intronic
988470000 5:31528864-31528886 TGGCTTCCCAGCCCTGGGCATGG + Intronic
989415847 5:41174568-41174590 TGGCATTGCTTCAGTGTGCAAGG - Intronic
990597290 5:57324307-57324329 AGGCATTTCAGAACTAGGCAAGG + Intergenic
990866544 5:60386599-60386621 AGCCAGTGCAGCATTGGGCAGGG + Intronic
991777461 5:70099109-70099131 AGGCATTGCAGAGCTGGGAAAGG - Intergenic
991856749 5:70974553-70974575 AGGCATTGCAGAGCTGGGAAAGG - Intronic
991976297 5:72186560-72186582 TGGGATGGCAGCACTGCCCATGG + Intronic
993314671 5:86386811-86386833 TGACATTGAAACATTGGGCACGG - Intergenic
995331013 5:110946062-110946084 TGGCCTGGCAGCACTGGGGTGGG - Intergenic
997196585 5:131984472-131984494 TGGAAAGGCAGCACTGGGAAAGG + Intronic
998286363 5:140864905-140864927 TGGCATTGCTGAGCTTGGCAGGG + Intronic
998422867 5:142003586-142003608 TGGGATAGCAGGCCTGGGCATGG - Intronic
998719097 5:144922906-144922928 TGGCAATCCTGCGCTGGGCAGGG + Intergenic
999486126 5:151997989-151998011 TGGCATTGCAGCCCTTTGTATGG + Intergenic
1000201638 5:159016638-159016660 TGGCATTGCAGTCATAGGCATGG - Intronic
1001203168 5:169737760-169737782 TGGCATTCCTGGACCGGGCATGG + Intronic
1001206258 5:169766006-169766028 TATCATTGCAGCATTGGGCTAGG + Intronic
1002000637 5:176194683-176194705 GGGCATGGCACCTCTGGGCAGGG + Intergenic
1002253702 5:177944298-177944320 GGGCATGGCACCTCTGGGCAGGG - Intergenic
1006026377 6:31149710-31149732 TGGCATTACTTGACTGGGCACGG + Intronic
1006451782 6:34109554-34109576 AGGCCTTGGAGGACTGGGCAGGG - Intronic
1006727554 6:36210822-36210844 TGGCATTGGAGCATGGGACAGGG + Intronic
1006983759 6:38164731-38164753 TGGCAATGCAGCCCAAGGCAGGG - Intergenic
1008666003 6:53717106-53717128 TCTCTTTGCAGCACTGGACATGG - Intergenic
1009718247 6:67428185-67428207 TGGCTTTGCAGCACTGGGATGGG + Intergenic
1016363251 6:143290415-143290437 TGGCCTGCCAGCACTTGGCAGGG + Intronic
1016981073 6:149854740-149854762 GTGCCTTGCAGCACTGTGCAGGG - Intronic
1017426935 6:154331792-154331814 TGGCCTTTCAGCACTTGGGAGGG - Intronic
1019453687 7:1113565-1113587 TCGGATGGCAGCGCTGGGCAGGG + Intronic
1019475917 7:1244166-1244188 TGGGATGGCAGCAGTGGGCCCGG - Intergenic
1022262373 7:28718833-28718855 TGGCATTGTAGGGTTGGGCAGGG - Exonic
1022816549 7:33919606-33919628 TGGCATTGCAGGACTGGAGTAGG + Intronic
1024545293 7:50512715-50512737 GGGTCTTGCAGCAATGGGCAGGG - Intronic
1024959333 7:54958189-54958211 GGGGATGGCATCACTGGGCATGG + Intergenic
1025101091 7:56135869-56135891 TGGCTTTACTGCACTGGGTAAGG - Intergenic
1026235077 7:68520346-68520368 TGGCTTTGCAGAAGTGGGAAGGG + Intergenic
1029369968 7:100143350-100143372 TGAAATTCCAGCACTGTGCAAGG + Intergenic
1030403595 7:109083631-109083653 TGGCTTTGCAGCACTGTGGTGGG - Intergenic
1032893338 7:136222885-136222907 TGGCTTTGCAGCACTGAGGTGGG - Intergenic
1033355173 7:140593623-140593645 TTGGATGGCAACACTGGGCAAGG - Intronic
1036397925 8:8384733-8384755 TGGCACTGCTGCACCAGGCAAGG - Intronic
1036489438 8:9211440-9211462 TGGCTGTCCAGCACAGGGCAGGG + Intergenic
1037695952 8:21224093-21224115 CGGCTTCGCAGCTCTGGGCAGGG + Intergenic
1038211595 8:25523446-25523468 TGGCTTTGCAGCACTGGGGTGGG - Intergenic
1040537875 8:48325436-48325458 TGGCAGTGATGCACAGGGCAAGG + Intergenic
1041248995 8:55916740-55916762 TGCCATTGCAGTATTGGGCATGG - Intronic
1042642023 8:70946792-70946814 TAACATTGCAACACTGGGGAGGG + Intergenic
1043003737 8:74792158-74792180 TGGCGATACAGCACTGGGGAAGG + Intronic
1043013557 8:74910267-74910289 TGGCATTTCAGCACAGTTCACGG + Intergenic
1043384268 8:79732461-79732483 GGGCAATGGATCACTGGGCATGG + Intergenic
1047482473 8:125297980-125298002 AGGCATTGCACCACTGTGCCTGG - Intronic
1048331190 8:133471823-133471845 TTGCATTTGGGCACTGGGCATGG + Intronic
1049413599 8:142484799-142484821 TTGCTTTGCAGCCCTGGGCCAGG + Intronic
1049929906 9:446247-446269 TAGCTTTTCTGCACTGGGCAGGG + Intronic
1052629646 9:31020819-31020841 GGGCAATGCACCATTGGGCATGG - Intergenic
1056687039 9:88775413-88775435 TCACACTGCAGAACTGGGCAGGG + Intergenic
1056757352 9:89390195-89390217 TGTCAGAGCAGCACTGGCCAGGG - Intronic
1058704533 9:107627684-107627706 TGGCATTCCAGCATTGTGCCAGG - Intergenic
1059241371 9:112809219-112809241 TGGGATTACAGCACTGTGCCTGG + Intronic
1061500408 9:130998409-130998431 GGCCATTGCTGCACAGGGCAGGG - Intergenic
1061584657 9:131558052-131558074 GGCCCGTGCAGCACTGGGCAGGG + Intergenic
1061956778 9:133967570-133967592 TGTCATTGCAGCAATGTGGATGG + Intronic
1062312823 9:135948533-135948555 TGGCAGGGGAGCACAGGGCAGGG - Intronic
1062454167 9:136627936-136627958 TGGCCTTGCAGCCCTGGGGGTGG - Intergenic
1186946500 X:14574396-14574418 TGGCATTGCAGCACTTACCATGG - Exonic
1189313234 X:40034720-40034742 TGCCATTGCAGCAATGGGCTGGG + Intergenic
1189318859 X:40075129-40075151 TGGCCTGGCAGCACTGAGCATGG - Exonic
1190905743 X:54725808-54725830 TGGAATTGTTGTACTGGGCAAGG + Intergenic
1192007387 X:67231714-67231736 TGGCATTCTACCACTAGGCAAGG + Intergenic
1192261108 X:69506254-69506276 TGGTAGTGCTGCACTGGGCACGG - Intronic
1198929629 X:141839572-141839594 TGGGATTGCAGCTGTGGGCCTGG - Intronic
1202119564 Y:21509294-21509316 TGGCACTGAAGAAGTGGGCAGGG + Intergenic
1202122016 Y:21532834-21532856 TGGCACTGAAGAAGTGGGCAGGG + Intronic
1202156990 Y:21896548-21896570 TGGCACTGAAGAAGTGGGCAGGG - Intronic
1202159436 Y:21920089-21920111 TGGCACTGAAGAAGTGGGCAGGG - Intergenic
1202185884 Y:22185004-22185026 TGGCACTGAAGAAGTGGGCAGGG - Intergenic
1202205476 Y:22401392-22401414 TGGCACTGAAGAAGTGGGCAGGG + Intronic