ID: 920446480

View in Genome Browser
Species Human (GRCh38)
Location 1:206022318-206022340
Sequence AGGGTGCTCACCAGGAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 361}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920446480 Original CRISPR AGGGTGCTCACCAGGAAGCC AGG Intronic
900188133 1:1342449-1342471 AGGGTGCTCACTCGGATGCGGGG - Exonic
900405007 1:2489081-2489103 GGGGTCTTCACCAGGAACCCAGG - Intronic
900439470 1:2646212-2646234 AGGGTGCTCACCTGGGAGCTGGG - Intronic
900661374 1:3786010-3786032 AAGGTGCTCACCACCACGCCTGG + Intronic
900805125 1:4762631-4762653 AGGATGAGCACCAGGAAGACAGG - Intronic
900923989 1:5691722-5691744 AGGGTGCTTAGCAGGATCCCTGG + Intergenic
901040207 1:6358949-6358971 GGGGTGCTCCCCACCAAGCCCGG - Intronic
901132748 1:6972535-6972557 AGGGTGCTGACCAGGCAACACGG + Intronic
901226565 1:7616539-7616561 AGAGTGCTGAAAAGGAAGCCGGG + Intronic
901229596 1:7634384-7634406 AGGGTGCTGAGCAGGAGGTCGGG + Intronic
901791030 1:11653870-11653892 AGGGAGCTCAGGAGGAAGGCAGG + Intronic
902191305 1:14765156-14765178 AGGGTGCTCAACAGCATCCCTGG + Intronic
902270316 1:15299646-15299668 AGGGTCCCCACCAGAAAGGCAGG + Intronic
902685388 1:18073392-18073414 GGGGTCTTCACCAGGAAGGCTGG - Intergenic
902719304 1:18293418-18293440 AGTGTGCTCCCCAGGCGGCCCGG + Intronic
903378314 1:22880132-22880154 GGGGTGCCCAGGAGGAAGCCAGG + Intronic
904205707 1:28853881-28853903 ACGGTGCTCACCATCACGCCTGG + Intronic
906203221 1:43972974-43972996 AGGGTGCTCAGCAGCATCCCTGG + Exonic
908552816 1:65226618-65226640 AGGGCACACACCAGAAAGCCTGG - Exonic
911271286 1:95804359-95804381 AGGGTGGTCACCAGGGATCGGGG - Intergenic
913214362 1:116608126-116608148 AATTTGCTCACCGGGAAGCCAGG - Exonic
913333416 1:117686001-117686023 TGTGTGCCCACCAGGAAACCAGG + Intergenic
914784384 1:150815403-150815425 AGGGTGCTCGCCACCACGCCTGG - Intronic
914952837 1:152132263-152132285 AGGCTGGTCCCCAGGAACCCAGG + Intergenic
915291002 1:154883358-154883380 AGGTTGATCACAAGGTAGCCAGG + Intergenic
915303244 1:154963249-154963271 AGGGTGCTCAGCAAGAACACAGG + Exonic
916678683 1:167085413-167085435 ATGCTGGTCACCAGGAAGCCTGG - Intronic
917450040 1:175140418-175140440 AGGTTCCTGACCAGGAGGCCAGG - Intronic
918068093 1:181115191-181115213 AGGGTGTTCACCAGGAAGTCTGG - Intergenic
918078105 1:181185661-181185683 AGGGTGCCCACCAGAGAACCTGG - Intergenic
918214184 1:182378922-182378944 CAGGTGCTCACCACCAAGCCCGG + Intergenic
918480723 1:184974266-184974288 AGGGTGCTCCCCAGGCCCCCGGG + Intronic
920446480 1:206022318-206022340 AGGGTGCTCACCAGGAAGCCAGG + Intronic
922290883 1:224208094-224208116 ACGGTTCCCACCACGAAGCCTGG + Intergenic
922864536 1:228848350-228848372 GGGGTACTCAGCAGGCAGCCTGG - Intergenic
923619753 1:235568967-235568989 CAGGTGCTCACCACCAAGCCCGG + Intronic
923847521 1:237752293-237752315 CAGGTGCACACCACGAAGCCTGG + Intronic
1063151394 10:3339810-3339832 GATGTGCTCACCAGGAAGCGAGG + Intergenic
1064272549 10:13878608-13878630 CAGGTGCTCACCAGCATGCCTGG - Intronic
1064731398 10:18334634-18334656 AGGATGCTGAGCAGGAACCCTGG + Intronic
1065532032 10:26680679-26680701 CAGGTGCTCACCAGCATGCCCGG + Intergenic
1067384647 10:45807542-45807564 CAGGTGCCCACCACGAAGCCCGG + Intergenic
1067684879 10:48460071-48460093 AGGATGCACACCAGGAGGCTGGG + Intronic
1067878214 10:50022628-50022650 CAGGTGCCCACCAAGAAGCCCGG - Intergenic
1067893501 10:50155276-50155298 CAGGTGCCCACCAAGAAGCCCGG + Intergenic
1069852352 10:71417750-71417772 CAGGTGCTCACCATGATGCCTGG + Intronic
1070458560 10:76642320-76642342 AGGCTGCTCAAGGGGAAGCCAGG + Intergenic
1070790236 10:79184803-79184825 AGTGTGCTCTGCATGAAGCCTGG + Intronic
1071462966 10:85915998-85916020 AGGGTGCTCACCTGGCAGGTGGG - Intronic
1071516444 10:86300846-86300868 AGGGTGCAGTCCGGGAAGCCTGG + Intronic
1072791343 10:98320538-98320560 AGGGTTATCACTAGGAACCCAGG + Intergenic
1073107266 10:101039301-101039323 AGGGTGTTCAGGAGGAGGCCTGG + Intronic
1073718747 10:106140522-106140544 AGGGTGGTTGCCAGGAATCCAGG - Intergenic
1075930264 10:126289295-126289317 ATGGTCCTCAGCAGGCAGCCAGG - Intronic
1076301340 10:129429488-129429510 AGGGTTCTCCCCAGGAATACGGG + Intergenic
1076713793 10:132353206-132353228 AGGCAGCTCACAAAGAAGCCGGG - Intronic
1076770238 10:132658956-132658978 TGGGTGCTCAACAGGCTGCCTGG + Intronic
1076893430 10:133296368-133296390 CGGGTACTCAGCAGGCAGCCGGG - Intronic
1077012915 11:387004-387026 AGTGTCCTCCCCAGCAAGCCTGG - Intergenic
1077076557 11:705015-705037 AGGCTGTAAACCAGGAAGCCAGG + Intronic
1077212994 11:1382160-1382182 ATGGAGGTGACCAGGAAGCCTGG - Intergenic
1077322694 11:1949393-1949415 AGTGTGGTCATCAGGAGGCCTGG + Intronic
1077339090 11:2018089-2018111 AGGGTCCTCACCAGGGTGTCTGG + Intergenic
1077342134 11:2030889-2030911 AGGGGGCTCCCCAGGTGGCCAGG + Intergenic
1077624679 11:3759984-3760006 CAGGTGCTCACCATGATGCCTGG + Intronic
1077922260 11:6650414-6650436 AGGGGGGTCAGCAGGAAGCTGGG + Intronic
1080179806 11:29412062-29412084 AGGATGCACACCAGGGAGACAGG + Intergenic
1083010434 11:59392182-59392204 AGGTAGATCACCAGGAAGACTGG + Intergenic
1083793340 11:65000024-65000046 GGGGAGCCCACCAGGAACCCAGG - Intergenic
1084410518 11:69003793-69003815 AGGTTGCACACCAGGAACCCAGG + Intergenic
1084654848 11:70509169-70509191 AGGGTGGTAACCAAGAAGGCCGG - Intronic
1084677197 11:70642414-70642436 AGGGGCCTCAGCAGGAAGTCTGG + Intronic
1084766033 11:71309118-71309140 AGGCTGCTCGTCAGGAGGCCTGG + Intergenic
1084939902 11:72606968-72606990 TGGGTGCTGATGAGGAAGCCAGG + Intronic
1085023293 11:73222240-73222262 TGGGCACTCACCAGGAAGCCAGG - Intronic
1086346364 11:85901428-85901450 CGGGTGCTCACCACCATGCCTGG - Intronic
1086868380 11:92007484-92007506 AGGGCACACACCAGAAAGCCTGG - Intergenic
1088914459 11:114216979-114217001 AGGGTGCTCAGCAGATACCCAGG + Intronic
1089338688 11:117743280-117743302 AGGGTGCCCTGCAGGAAACCAGG + Intronic
1090252943 11:125263933-125263955 AGGGTGCGGAGAAGGAAGCCAGG - Intronic
1091075614 11:132613154-132613176 AGGAGGCTCTCCAGGAGGCCTGG - Intronic
1202805711 11_KI270721v1_random:4706-4728 AGTGTGGTCATCAGGAGGCCTGG + Intergenic
1202822074 11_KI270721v1_random:73271-73293 AGGGTCCTCACCAGGGTGTCTGG + Intergenic
1202825120 11_KI270721v1_random:86078-86100 AGGGGGCTCCCCAGGTGGCCAGG + Intergenic
1091667892 12:2432361-2432383 CTGGTGCTCACCATGATGCCAGG + Intronic
1092414143 12:8277006-8277028 CGGGTGCACACCATCAAGCCTGG + Intergenic
1094522798 12:31210598-31210620 AGTGTGGTCTCCTGGAAGCCAGG - Intergenic
1094567708 12:31615305-31615327 AGGGCACACACCAGAAAGCCTGG + Intergenic
1096334630 12:50744142-50744164 CGGGTGCTCACCACCAAGTCTGG + Intronic
1096616883 12:52838300-52838322 AGGAAGCTCTGCAGGAAGCCAGG - Intronic
1096696263 12:53350625-53350647 CAGGTGCTCACCACCAAGCCTGG - Intergenic
1097012605 12:55964123-55964145 CAGGTGCTCACCACCAAGCCTGG + Intronic
1097626095 12:62002362-62002384 AGGGTGCTCAGCGGGGAGCCAGG - Intronic
1097782385 12:63723173-63723195 AGGATGGTCACCTGGAAGCGAGG - Intergenic
1098419989 12:70285349-70285371 AAGGTGCCCACCACGACGCCTGG + Intronic
1101772404 12:107763313-107763335 CAGGTGCTCACCAGCATGCCTGG + Intergenic
1102458139 12:113083792-113083814 AGGGTGGACAGAAGGAAGCCAGG - Intronic
1102698204 12:114816453-114816475 CAGGTGCTCACCACCAAGCCCGG + Intergenic
1104513596 12:129403786-129403808 AGGGTGCTTACTAGGAAGGTAGG + Intronic
1104757388 12:131277661-131277683 AGAGTTCTCACCCTGAAGCCTGG - Intergenic
1104775658 12:131388813-131388835 AGAGTTCTCACCCTGAAGCCTGG + Intergenic
1105218094 13:18301636-18301658 AATTTGCTCACCGGGAAGCCAGG - Intergenic
1106099135 13:26679338-26679360 AGGGTGCCCATCAGGAGGACGGG - Intronic
1107033122 13:35873526-35873548 AGGGTGCCCACCACCATGCCTGG + Intronic
1107833853 13:44398087-44398109 ATGGTTCTCACCAAGAGGCCTGG - Intergenic
1108880177 13:55103921-55103943 TGGGTGCCCACCACAAAGCCCGG - Intergenic
1109107677 13:58276070-58276092 AGGGTGTCCACAAGGAAGACTGG - Intergenic
1112046172 13:95600422-95600444 CGAGTGCTCACCAGGAGGCTGGG + Intronic
1112606742 13:100913736-100913758 AGGGTGGTCACCTGCAAGCGAGG + Intergenic
1113108939 13:106801419-106801441 CGGGTGCTCGCCATGACGCCTGG - Intergenic
1113619216 13:111701576-111701598 AAGTAGCTCACCAGGAAGCCTGG - Intergenic
1113624745 13:111786837-111786859 AAGTAGCTCACCAGGAAGCCTGG - Intergenic
1113702457 13:112397397-112397419 AAGGTGCTCAGCACGGAGCCTGG - Intronic
1113893517 13:113748938-113748960 AGGGACCTCACGAGGAGGCCTGG + Intergenic
1114556607 14:23565874-23565896 ATGGTGCCCAGCAGGATGCCTGG + Exonic
1118593164 14:67416441-67416463 AGGGTGCTCTCCTGGCTGCCCGG - Intergenic
1119124923 14:72116819-72116841 CAGGTGCCCACCATGAAGCCTGG - Intronic
1119264062 14:73253879-73253901 AGGGGGCTTCCCAGGCAGCCCGG - Exonic
1119485029 14:74981459-74981481 AGGCTGCTCAGCATGAACCCAGG - Intergenic
1120087791 14:80294589-80294611 AGTGTGCTCACTAAGCAGCCAGG + Intronic
1121664245 14:95659876-95659898 AGCCTGCCCACCAGGCAGCCTGG - Intergenic
1121780975 14:96622278-96622300 AGGGTGCTCCCTGGGAAGGCTGG + Intergenic
1121978614 14:98431508-98431530 AGGTTCATCTCCAGGAAGCCTGG - Intergenic
1122505790 14:102230939-102230961 AGGCTGCTCTCCAGAAAGCCAGG - Intronic
1122997179 14:105271573-105271595 AGGGTGTGGACCAGGAAGCGGGG + Intronic
1123069980 14:105637895-105637917 AGGGTGCGCTCCAGGGGGCCTGG - Intergenic
1125140735 15:36403529-36403551 TGGGGGCCCACCAGGGAGCCTGG + Intergenic
1125464688 15:39939210-39939232 TGGGTGCTCTCCTGGAAGCTGGG - Intronic
1126428860 15:48559360-48559382 AGAGAGCTCTCCAGGAAGTCTGG + Intronic
1128313811 15:66647623-66647645 AGGGTGCTCGGCTGGGAGCCTGG - Intronic
1128660440 15:69497096-69497118 AGGGTCCTCAGCAGGCATCCTGG + Intergenic
1130581614 15:85142397-85142419 TGTGTGTTCACCAGGAAGCTAGG - Intergenic
1132041990 15:98532960-98532982 CAGGTGCTCACCATGAATCCTGG + Intergenic
1132561886 16:598982-599004 ACGTTGCTGACCAGGAAGTCAGG - Intronic
1132578169 16:673413-673435 AGGGTGCCCAGCAGCAAGCTGGG + Intronic
1133326011 16:4942897-4942919 CAGATGCACACCAGGAAGCCTGG + Intronic
1135111738 16:19695669-19695691 AGGGTGCACACCACCATGCCTGG - Intronic
1135692127 16:24547596-24547618 TGGGTGCCCACCACCAAGCCTGG + Intronic
1136066243 16:27760905-27760927 AGGGTGCTCACAAGTCAACCAGG + Intronic
1136483565 16:30557320-30557342 CAGGTGCTCGCCACGAAGCCTGG - Intronic
1137755352 16:50897732-50897754 AGGACTCTGACCAGGAAGCCAGG - Intergenic
1139868302 16:70081878-70081900 CGGGTGCTCACCACCACGCCTGG + Intergenic
1139916742 16:70433001-70433023 AGGAAGCTCACCAGGATTCCGGG + Intronic
1141351291 16:83300119-83300141 AGGGTGAGTACCAGGAAGCTGGG + Intronic
1141495753 16:84408280-84408302 ATGGTGTTGACCTGGAAGCCTGG + Intronic
1141544451 16:84755400-84755422 AGGCTGCTCAGCCAGAAGCCGGG - Intronic
1141964722 16:87434101-87434123 AGCGGCCTCACCAGGGAGCCCGG + Intronic
1142493297 17:292619-292641 AGTGTGCTAGCCAGGCAGCCAGG - Intronic
1142764741 17:2058774-2058796 AGGGCGCTCACCTGGCGGCCGGG + Exonic
1143845275 17:9769060-9769082 AGGCTGCCCACCAGGTAGACTGG + Intergenic
1143977009 17:10837480-10837502 AGGGTGCTCAGGAGGACGGCTGG + Intronic
1144053403 17:11517154-11517176 AGGATGCACACCAGGGAGACAGG + Intronic
1144201972 17:12949719-12949741 GGGGTACTCACTTGGAAGCCTGG - Exonic
1145003020 17:19318768-19318790 GGGGTTCTCACGTGGAAGCCTGG + Intronic
1146251318 17:31346631-31346653 AGGGCACACACCAGAAAGCCTGG - Intronic
1146424900 17:32728347-32728369 AGGGTGCACACCACCATGCCTGG + Intronic
1146712525 17:35055058-35055080 CGGGTGCCCACCAGCACGCCTGG + Intronic
1147342598 17:39762742-39762764 CAGGTGCTCACCACCAAGCCCGG - Intergenic
1147574589 17:41591622-41591644 CAGGCGCTCACCATGAAGCCCGG + Intergenic
1147832918 17:43309763-43309785 AGTGTGGTCACTTGGAAGCCTGG + Intergenic
1147904511 17:43814115-43814137 AGGGAGCTCAGCAGGGACCCTGG - Intronic
1148330607 17:46811812-46811834 CAGGTGCGCACCAGGATGCCTGG - Intronic
1148550844 17:48550206-48550228 CCGGTTCTGACCAGGAAGCCTGG + Exonic
1148736935 17:49870174-49870196 TGGGTGCTCACCAGGTAGGTGGG + Intergenic
1148816475 17:50331567-50331589 AGGGTACTCTCCAGGAAGGATGG + Intergenic
1149604312 17:57914067-57914089 ATGGTGCCCACCTGGAAGGCGGG + Intronic
1149649961 17:58270661-58270683 AGGCTTCCCTCCAGGAAGCCAGG + Exonic
1152412254 17:80133290-80133312 AGGCTGCTCTCCAGAAAGTCTGG + Intergenic
1152498877 17:80695000-80695022 AGGGTAGTGAGCAGGAAGCCTGG + Intronic
1152533901 17:80939555-80939577 AGGGTGCTGAGCTGCAAGCCTGG - Intronic
1152541564 17:80979340-80979362 AAGCGGCTCAGCAGGAAGCCGGG + Intergenic
1154008448 18:10555660-10555682 AGGATGCTCCCCAGCCAGCCAGG - Intergenic
1154945161 18:21156054-21156076 CAGGTGCTCACCACGACGCCTGG + Intergenic
1154945807 18:21160323-21160345 CAGGTGCTCACCACGACGCCTGG + Intergenic
1155156692 18:23163524-23163546 AGGGTGCTGTCAGGGAAGCCTGG + Intronic
1157176740 18:45458972-45458994 AAGGTGCTCTCTAGAAAGCCAGG + Intronic
1158122059 18:54059274-54059296 AGAGTGTTGACCAAGAAGCCTGG - Intergenic
1158461251 18:57648127-57648149 CGGGTGCCCACCACCAAGCCCGG + Exonic
1158543828 18:58379169-58379191 AGACTGCTCACCAGGGAGCAGGG + Intronic
1158624764 18:59061551-59061573 AGGGTCAGCACCAGGAAGCCCGG + Intergenic
1158697538 18:59716237-59716259 ATGGAGCTCACCAGGCTGCCTGG - Intergenic
1160018799 18:75164715-75164737 AGAGTGCTCACCAGGATCCTCGG + Intergenic
1160408023 18:78656139-78656161 AAGGGGCTCAGCAGGAAGGCTGG + Intergenic
1160519744 18:79497875-79497897 AGGGTGATCCCTAGGCAGCCTGG + Intronic
1160614773 18:80116776-80116798 CAGGTGCGCACCAGGATGCCTGG + Intronic
1161218676 19:3107748-3107770 GGGGTGCTCAGCAGCAACCCTGG - Intronic
1161627999 19:5338241-5338263 CGTGAGCTCACCAGGCAGCCTGG + Intronic
1161931604 19:7344378-7344400 AGATTGCGCAGCAGGAAGCCTGG - Intergenic
1163273638 19:16268976-16268998 GGGCAGCTCACGAGGAAGCCAGG - Intergenic
1163518922 19:17780589-17780611 AGGGTGCTGAGCAGCAACCCAGG - Intronic
1164454157 19:28393083-28393105 TGGGTGCTCACCACCATGCCTGG - Intergenic
1165090902 19:33387993-33388015 ATGGTGCTCACCGTGGAGCCGGG - Exonic
1166560789 19:43731298-43731320 TGAATGGTCACCAGGAAGCCCGG - Exonic
1167101524 19:47406995-47407017 AGGCTGAGCCCCAGGAAGCCCGG + Intronic
1167647281 19:50712544-50712566 AAGGGGCACAGCAGGAAGCCAGG + Intronic
1167976045 19:53226673-53226695 CGGGTGCTCACCAGAACGCCCGG + Intergenic
925108391 2:1312478-1312500 TGGGTGGGCACCAGGCAGCCTGG + Intronic
925177348 2:1794913-1794935 ACGGGGCTCACCAAGCAGCCTGG - Intronic
925346354 2:3174774-3174796 AGGGTGTGCACCAGGAAGTCAGG + Intergenic
925457728 2:4030448-4030470 AGGCTGCTCACCAGGGCTCCCGG - Intergenic
926188422 2:10709334-10709356 AGGGTGTTCAGCAGGATGGCAGG + Intergenic
926302568 2:11614976-11614998 TGGGTCCTCACCAGGAAGGTGGG + Intronic
926749346 2:16186131-16186153 AGGGTGAACATCAGGAAGCATGG + Intergenic
927209403 2:20629562-20629584 CCTGTGCTCACCAGGAAGCCAGG - Intronic
927823104 2:26286643-26286665 CAGGTGCTCACCACCAAGCCCGG + Intronic
928861946 2:35868973-35868995 AGGATGGTTACCAGGAAGGCAGG + Intergenic
929758814 2:44789448-44789470 TGGGTCTTCACCAGGAAGCAAGG + Intergenic
933901868 2:86855925-86855947 TGGGTGCTCAGGAGGAATCCAGG - Intronic
934296214 2:91745028-91745050 AATTTGCTCACCGGGAAGCCAGG + Intergenic
934683969 2:96306803-96306825 ATGGTGCTCACCGAGAGGCCAGG - Intergenic
935233688 2:101120273-101120295 AGGGTGGGCACCGGGAAGGCCGG - Intronic
937198500 2:120181143-120181165 TAGGTGCTCACCAGCATGCCTGG - Intergenic
938097916 2:128475395-128475417 TTGGTGCTCACCAGGATGCTGGG - Intergenic
942593633 2:177571606-177571628 AAGGTACTCACCTGCAAGCCAGG + Intergenic
942922107 2:181387482-181387504 AGGGTGGTCATCAGGAAGTAGGG + Intergenic
943195336 2:184739534-184739556 CAGGTGCTCACCACAAAGCCTGG + Intronic
945943054 2:215968896-215968918 AGGGTGCACACCACCACGCCTGG + Intronic
948032936 2:234834390-234834412 AGAGAGCTCACCAGGAAACCAGG + Intergenic
948562208 2:238861683-238861705 ACGGGATTCACCAGGAAGCCTGG - Intronic
948570050 2:238912350-238912372 CTGTTGCTCACCAGGAAACCAGG - Intergenic
948615977 2:239199224-239199246 TGGGTGCTCACCGAGAGGCCTGG + Intronic
948802105 2:240437584-240437606 AGGGGGCACACCTGGATGCCAGG + Intronic
949054001 2:241914749-241914771 AGGCTGCTCCCCAGGAGGCCCGG - Intergenic
949072204 2:242032374-242032396 TGTGTGTTCACCAGGAGGCCTGG - Intergenic
1170743613 20:19079163-19079185 AGCGTGCTGTCCCGGAAGCCAGG + Intergenic
1171300931 20:24059721-24059743 AGAGTCCACACCAGGGAGCCAGG + Intergenic
1171449093 20:25223836-25223858 AGAAAGCTCACCAGGAACCCAGG - Intronic
1172688978 20:36777734-36777756 AGGACCCTCACCAGGAAACCAGG + Exonic
1173811685 20:45959739-45959761 AGTGTGCTGACCAGGGAGCTAGG + Intronic
1174651885 20:52133661-52133683 AGTGGGCCCATCAGGAAGCCAGG - Intronic
1174935619 20:54865008-54865030 TGGGTGATCTCTAGGAAGCCTGG + Intergenic
1175487692 20:59357063-59357085 AGGGTGTTCACCAGGAGCTCTGG + Intergenic
1175814838 20:61877975-61877997 AGGGTCATCACCAGGAACCACGG + Intronic
1175888602 20:62306102-62306124 AGGTCCCTCACCTGGAAGCCAGG + Intronic
1175900285 20:62357333-62357355 AGGGTGCTGGCCCGGACGCCTGG - Intronic
1175916255 20:62427374-62427396 GGGGTGCTCACCAGGGAGGCTGG - Intronic
1175925398 20:62468853-62468875 AGGGTGCCCACCATCCAGCCGGG - Intronic
1179166514 21:38939353-38939375 AGGGTGAAAACCAGGAAGGCAGG - Intergenic
1179622628 21:42627337-42627359 AGGATGCTGTCCAGGATGCCAGG + Intergenic
1179625386 21:42646271-42646293 TGGGGGCTCCACAGGAAGCCTGG + Intergenic
1179729612 21:43360464-43360486 AAGATGCTCACCGGGTAGCCAGG + Intergenic
1180646205 22:17341150-17341172 AAGGTGCCCACCACCAAGCCCGG + Intergenic
1181150365 22:20878819-20878841 AGGGGGCTCAGCAGGATGTCGGG + Intronic
1182034580 22:27187806-27187828 CAGGTGCTCACCACGATGCCTGG + Intergenic
951171586 3:19548264-19548286 AGTGTGCACACCAGGAAGTAAGG - Intergenic
951348661 3:21577950-21577972 CAGGTGCTCACCATCAAGCCTGG + Intronic
952416805 3:33097060-33097082 AGGATGCGAACCAGGAACCCCGG + Exonic
952999912 3:38923134-38923156 AAGGTGGTCTCCTGGAAGCCAGG - Intronic
953496512 3:43392071-43392093 AGGGTCCTCACCAGAGAGGCAGG + Intronic
953658245 3:44871157-44871179 AGGGTGCTCAGGTGGAAGCCTGG - Intronic
954750621 3:52811431-52811453 ATGGGGATGACCAGGAAGCCTGG - Intergenic
954867002 3:53738130-53738152 AAGGTGCCCACCAGCAAGCCAGG - Intronic
956221957 3:66914002-66914024 CAGGTGCCCACCACGAAGCCCGG - Intergenic
957059174 3:75467882-75467904 CGGGTGCACACCATGAAGCCTGG + Intergenic
960829839 3:121834902-121834924 AGGGCGCCTACCAGGAGGCCAGG - Intronic
961085276 3:124061972-124061994 TGGATGCTCACCTGGAAGCAAGG + Intergenic
968730674 4:2267914-2267936 AAGGGGCTCAGGAGGAAGCCTGG - Intergenic
969635852 4:8369252-8369274 TGGGGGCTCACCAGGCAGACAGG - Intronic
969663772 4:8545351-8545373 AGGGGGCGCCCCAGGAAGCGAGG - Intergenic
971353462 4:25873032-25873054 AGTGTGCACACCAGGAAACCAGG - Intronic
972083858 4:35188070-35188092 TAGGTGCACACCAGGAAGACTGG - Intergenic
973320013 4:48800557-48800579 CAGGTGCTCACCACCAAGCCAGG + Intergenic
975197122 4:71538848-71538870 AGAGTGCTCAAAAGCAAGCCAGG + Intronic
976210438 4:82663386-82663408 TGGGTGCTCACAAGGAAGGTTGG + Intronic
976594183 4:86878987-86879009 AGGGTCTTCACCAGTCAGCCTGG - Intronic
976691847 4:87876840-87876862 TAGGTGCTCACCATGATGCCCGG + Intergenic
978265323 4:106816935-106816957 AGCATGTTTACCAGGAAGCCTGG + Intergenic
980445972 4:132907880-132907902 TAGGTGCACACCACGAAGCCTGG - Intergenic
980732124 4:136837070-136837092 AAGGTGCTCATCTGCAAGCCAGG + Intergenic
981681244 4:147401219-147401241 AGGGTGTTCACCTGAAAGGCAGG - Intergenic
983712109 4:170731204-170731226 AGGGAGCTCAGGAGGAAGTCAGG - Intergenic
984400938 4:179262554-179262576 AGGGTGCTGAACAGGAAGAGAGG + Intergenic
984754635 4:183313842-183313864 AGTGTGCTCACCAGGGATCCCGG - Intronic
984974743 4:185220621-185220643 AGGGTGCCCACCACCACGCCTGG + Intronic
985508309 5:297708-297730 TGTGTGTTCACCAGGAGGCCTGG - Intronic
985549199 5:524591-524613 AGGGTGGGCACCAGGGAGCGCGG - Intergenic
985712567 5:1437755-1437777 AGCCAGCTCTCCAGGAAGCCTGG - Intronic
985739732 5:1607962-1607984 TGTGTGTTCACCAGGAGGCCTGG + Intergenic
985805086 5:2037863-2037885 CCGGTGCTCACCACGACGCCTGG + Intergenic
986208873 5:5651605-5651627 AAGGTGCTCACCACCACGCCTGG + Intergenic
986323915 5:6657466-6657488 AGGGTGCTGGGCAGGAAGCGAGG - Intronic
986353180 5:6899357-6899379 AGGAGGCCGACCAGGAAGCCGGG - Intergenic
987967199 5:24892457-24892479 CAGGTGCCCACCAGGAAGCCTGG + Intergenic
988013887 5:25528431-25528453 CAGGTGCTCACCACCAAGCCTGG + Intergenic
988413289 5:30913986-30914008 AGGCTGCTTATCAGAAAGCCTGG - Intergenic
996737367 5:126770371-126770393 TAGGTGCTCACCAGCATGCCCGG + Intergenic
997376435 5:133400899-133400921 TGCGTGCTCAGCAGGAAGACAGG - Exonic
998208340 5:140175357-140175379 AGGGCGCTCCCCAGGGAGCCCGG - Intronic
999150147 5:149421388-149421410 AGGGTCCTGACCAGGCTGCCAGG - Intergenic
1001624226 5:173117235-173117257 CAGGTGCTCACCACCAAGCCTGG - Intronic
1001709670 5:173768119-173768141 AGGGTGCCCTCCAGGAGGTCAGG + Intergenic
1002828217 6:793298-793320 AGAAGGCTCACCAGGAAGCCGGG + Intergenic
1002829295 6:804701-804723 GGGGCGCTCACCATGATGCCAGG + Intergenic
1003574351 6:7278875-7278897 AGGTGGCTGGCCAGGAAGCCTGG + Intronic
1003933203 6:10948353-10948375 AGGGTGGTTACCAGGAATCAAGG - Intronic
1005585317 6:27270982-27271004 CGGGTGCCCACCACTAAGCCCGG - Intergenic
1006245475 6:32730884-32730906 AGTGTCCTCATCTGGAAGCCTGG + Intergenic
1006418743 6:33920446-33920468 AGTCTGCTCACAATGAAGCCAGG - Intergenic
1007050488 6:38823406-38823428 AGGGTGTCCACCAGGAAGCGAGG - Intronic
1007250101 6:40489624-40489646 TGGGTGCTGACGAGGAGGCCTGG + Intronic
1008088068 6:47264922-47264944 AGTGTAAACACCAGGAAGCCAGG - Intronic
1008762100 6:54863423-54863445 ATGGTGCTCACCAGGAAAAAGGG - Intronic
1008788781 6:55203457-55203479 AAGGTGATCTCCAGGAAGACAGG - Intronic
1009794043 6:68443078-68443100 AGGGTCCTCACCAAGAAGGAGGG - Intergenic
1010409085 6:75540091-75540113 AGGCTGCTTACAAGGAAGCCAGG - Intergenic
1011443353 6:87410840-87410862 ATGGTGTGCCCCAGGAAGCCAGG - Intronic
1011841060 6:91499532-91499554 AGGGTGGCCACCTGCAAGCCAGG - Intergenic
1013109928 6:107056800-107056822 AGGGTGTTCAGCAGCATGCCTGG + Intergenic
1013914652 6:115321050-115321072 ATGGGGCACACCTGGAAGCCTGG - Intergenic
1014552094 6:122800891-122800913 TGGGTGCTCACCACCATGCCTGG + Intronic
1014635947 6:123846733-123846755 AGCGCCCTCATCAGGAAGCCTGG - Intronic
1016033439 6:139361344-139361366 TGGGTGCTAATCAGGAAACCAGG + Intergenic
1017005590 6:150026179-150026201 CGGGTGCCCACCACCAAGCCCGG + Intergenic
1017117038 6:150987450-150987472 AGGGTGCTCAGCACGTAGCCAGG - Intronic
1017646149 6:156541434-156541456 AAGGTGCTGCCCAGGAGGCCTGG + Intergenic
1018058430 6:160071346-160071368 AGGGTGCCCAGCAGGAATCATGG + Intronic
1018383346 6:163280671-163280693 AAGGTGGTCACCTGCAAGCCAGG - Intronic
1018730374 6:166645658-166645680 TGGGGGCACTCCAGGAAGCCTGG + Intronic
1018807663 6:167273731-167273753 AGGTGGCACACCAGGAAGCAGGG + Intronic
1018881138 6:167882368-167882390 AGGGGGATCAAAAGGAAGCCAGG + Intronic
1019193727 6:170268953-170268975 AAAGTGCCCACCAGGAAGCCTGG + Intergenic
1019794984 7:3042939-3042961 AGGGGGCTCAGCAGAAGGCCTGG + Intronic
1020697389 7:11430606-11430628 AGGGTGCCCACCACCATGCCAGG + Intronic
1021150274 7:17142339-17142361 CAGGTGCCCACCATGAAGCCAGG - Intergenic
1021239239 7:18180191-18180213 AGGGTGCTCACAAGAAATGCTGG - Intronic
1022323528 7:29309275-29309297 AGGCTGCTCATCTGGAAGACTGG - Intronic
1022801142 7:33778641-33778663 CAGGTGCACACCAGCAAGCCTGG - Intergenic
1023093450 7:36637567-36637589 AGGGTGTTCAGCAGCAACCCTGG - Intronic
1023227999 7:37992025-37992047 TGGGTGTGCACCATGAAGCCTGG + Intronic
1023747251 7:43332807-43332829 AAGGTGCTCAGCATGATGCCAGG - Intronic
1024059612 7:45687959-45687981 AGGGTGCCCAGGAGGAAGCGTGG + Intronic
1024886279 7:54146399-54146421 AGGGTGCCCACCACCACGCCTGG - Intergenic
1024966349 7:55025402-55025424 AGGCTTCTCACTTGGAAGCCTGG + Intronic
1025140779 7:56461692-56461714 TGGGTGCTCGCCACCAAGCCTGG + Intergenic
1025733471 7:64126779-64126801 CAGGTGCTCACCACTAAGCCCGG - Intronic
1025993947 7:66516450-66516472 TAGGTGCTCACCACCAAGCCTGG - Intergenic
1026649990 7:72208857-72208879 TGGCTGCTCTCCAGGAAGGCTGG + Intronic
1029403942 7:100362074-100362096 AGGGGGGTCAGCAGGAAGCTTGG + Intronic
1029746219 7:102517157-102517179 CGAGTGCACAGCAGGAAGCCCGG + Intronic
1029764157 7:102616136-102616158 CGAGTGCACAGCAGGAAGCCCGG + Intronic
1030051852 7:105545307-105545329 TGGGTGCTCACCACCAAGCCTGG - Intronic
1031194029 7:118589996-118590018 AGGATGATCAACATGAAGCCTGG + Intergenic
1034120581 7:148623422-148623444 AGGCTGCGCACCACCAAGCCTGG - Intergenic
1035281815 7:157783367-157783389 AGGGTCCTCACCACACAGCCTGG + Intronic
1036403024 8:8427186-8427208 TAGGTGCTCACCACCAAGCCTGG - Intergenic
1036663930 8:10726492-10726514 AGGGAGCTCAGAAGGAAGCCCGG + Exonic
1036769162 8:11566889-11566911 AGTATGCTCACCCGGAACCCTGG - Intergenic
1037671649 8:21020245-21020267 AGGGAGCTAACCAGAAAGCAGGG + Intergenic
1037693552 8:21204501-21204523 AGGAATGTCACCAGGAAGCCAGG + Intergenic
1037848108 8:22302599-22302621 GGGGTGATCACTAGGAAGCCAGG - Intronic
1038417707 8:27409367-27409389 AGGGAGCTCACCAGGAGGAAAGG + Intronic
1038634688 8:29276197-29276219 GTTCTGCTCACCAGGAAGCCAGG + Intergenic
1038885103 8:31654796-31654818 AAGGTGCACACCACCAAGCCTGG - Intronic
1038948726 8:32390458-32390480 AAGGTGCTCACCACCATGCCTGG - Intronic
1040837441 8:51747196-51747218 AGGGTGGGCACCAGGAAGGAAGG - Intronic
1042852026 8:73226096-73226118 AGGGAGGACACCAGGAAGACAGG + Intergenic
1043515362 8:80990406-80990428 AGGGTGCAAACAAGGAAGCATGG - Intronic
1046263845 8:111805785-111805807 AGGTTGCTCACCTGGAAGACAGG + Intergenic
1049325069 8:142017480-142017502 AGGCTGCCCTCCCGGAAGCCAGG + Intergenic
1049397626 8:142408897-142408919 AAGGTGTCCACCAAGAAGCCAGG - Intergenic
1049475144 8:142793841-142793863 AGGGAACTCACCAGGACCCCAGG + Intergenic
1049587131 8:143437371-143437393 AGGGGCCTGACCAGGAGGCCTGG - Intergenic
1052028479 9:23601570-23601592 TGGGTACCCACCAGGTAGCCTGG - Intergenic
1053326275 9:37154622-37154644 AGGGTGCACACCACCATGCCTGG + Intronic
1053616904 9:39776910-39776932 ATATTGCTCAGCAGGAAGCCAGG + Intergenic
1053875086 9:42536248-42536270 ATATTGCTCAGCAGGAAGCCAGG + Intergenic
1054236611 9:62565471-62565493 ATATTGCTCAGCAGGAAGCCAGG - Intergenic
1054267264 9:62930528-62930550 ATATTGCTCAGCAGGAAGCCAGG - Intergenic
1054457735 9:65443796-65443818 GGGGTTCTCACCAGGAAGTATGG + Intergenic
1054550752 9:66599981-66600003 ATATTGCTCAGCAGGAAGCCAGG - Intergenic
1056661505 9:88547113-88547135 ACGGGGCTCACCAGGGAGTCTGG - Intronic
1059384652 9:113954784-113954806 AGGATGCTCATCAGGAAGACTGG + Intronic
1059439804 9:114300676-114300698 AGGGAACTCACCATCAAGCCAGG - Exonic
1059469035 9:114490052-114490074 TGTGTGCTCATCAGGGAGCCAGG + Intronic
1059960539 9:119560190-119560212 TGGTGGCTCAGCAGGAAGCCAGG + Intergenic
1060750074 9:126163103-126163125 TGGGTGCTGAGCACGAAGCCTGG + Intergenic
1061762011 9:132857694-132857716 AGGGTGCCAACCAGGACGCAGGG + Intronic
1061972086 9:134050363-134050385 AGGGTGCTCACCTTGACGACAGG + Exonic
1062081576 9:134626785-134626807 AGGGTGCAGACAAGGAACCCTGG + Intergenic
1062467910 9:136689297-136689319 AGGGTGAACACCAGACAGCCGGG + Intergenic
1062473816 9:136718015-136718037 AGGATGTTTAGCAGGAAGCCTGG + Intronic
1185488749 X:503248-503270 GGGGCGCCCACCACGAAGCCCGG + Intergenic
1185523382 X:758589-758611 AAGGTGCCCACCACCAAGCCCGG + Intergenic
1188440800 X:30214091-30214113 AGGGTCCTCACCATGACACCTGG - Intergenic
1189134509 X:38534456-38534478 AGTGTGCACACCACGGAGCCAGG - Intronic
1189407082 X:40735252-40735274 AGGGTGCTCAGCCGGTAGCCCGG + Exonic
1190799708 X:53776165-53776187 CAGGTGCTCACCACCAAGCCTGG - Intergenic
1191850655 X:65583520-65583542 AAGGTGCTCACCACTATGCCTGG + Intergenic
1192035138 X:67554791-67554813 TGGGTGCTCACCAAAACGCCTGG - Intronic
1193144284 X:78061371-78061393 CAGGTGCTCACCACGATGCCTGG - Intergenic
1193789597 X:85801622-85801644 AGGGTGACCCCTAGGAAGCCAGG - Intergenic
1196683460 X:118491800-118491822 AGGGTGCACACCATCACGCCTGG + Intergenic
1199947218 X:152679482-152679504 AGGGTCCTCACCTTGAAACCTGG - Intergenic
1199962462 X:152788972-152788994 AGGGTCCTCACCTTGAAACCTGG + Intergenic
1200064737 X:153498893-153498915 AGGGGGCTCCCCTGGAAGCATGG - Intronic
1201673712 Y:16555529-16555551 AGGATGCTAAACAGGAAGTCAGG + Intergenic