ID: 920446756

View in Genome Browser
Species Human (GRCh38)
Location 1:206023749-206023771
Sequence GCTGCTGGTGCTCCTGGAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 979
Summary {0: 1, 1: 0, 2: 13, 3: 100, 4: 865}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920446756 Original CRISPR GCTGCTGGTGCTCCTGGAGC TGG (reversed) Exonic
900095696 1:939279-939301 GCTGCTGCTGCCGCGGGAGCTGG + Exonic
900196893 1:1381094-1381116 CCTGCAGGTACTCCTGGGGCTGG + Intergenic
900414774 1:2529930-2529952 GCTGAAGCTGCTGCTGGAGCAGG - Exonic
900435640 1:2629379-2629401 GCTGCTGCTGCTGCTGCTGCTGG - Exonic
900458611 1:2789600-2789622 GCTGGTGGTGCTGCGGGAGGAGG - Exonic
900524850 1:3123590-3123612 GCAGCAGGTGCTGCTGGAACTGG + Intronic
901206499 1:7500599-7500621 GCTGCTGCTGCTACAGAAGCGGG - Intronic
901238722 1:7680861-7680883 GCTGCTGCTGCTGCTGCTGCTGG - Intronic
901535282 1:9878759-9878781 GCAGGTGGTGCAGCTGGAGCGGG - Intronic
901717719 1:11170047-11170069 GCGGCTGGTGCTTCTTGAGCTGG + Intronic
902087976 1:13877798-13877820 GCTGCTGGTGCTACTGGTACAGG - Intergenic
902659681 1:17892382-17892404 GTCCCAGGTGCTCCTGGAGCTGG - Intergenic
902681847 1:18049197-18049219 GCTGCTGCTGCTGCTGGTGATGG + Intergenic
903212190 1:21824492-21824514 GCTCTTGGGGCTCCTGGGGCAGG - Exonic
903846222 1:26281096-26281118 GCTGCAGGAGTTCCTGAAGCTGG + Exonic
903917289 1:26773688-26773710 GCTGCTGCTGCTGCTGCTGCGGG - Exonic
903996439 1:27307892-27307914 GCTGCTGCTTCTCCTGCTGCTGG + Exonic
904093426 1:27960327-27960349 GCTGCTGCATCTCCTGCAGCTGG + Exonic
904797540 1:33068530-33068552 GGTGCAGGTCCTCCTGGTGCAGG + Intronic
905169408 1:36100188-36100210 GCTGCTGCTGCTACTGGTGCTGG - Exonic
905637940 1:39567924-39567946 GATGCTGGTGCTCCTGGTCTGGG - Intronic
905954280 1:41979069-41979091 GCTGCTGATGTTGCTGGTGCAGG - Intronic
906345214 1:45010577-45010599 GCTGCTGCTGCCGCTGGAGGTGG + Exonic
906671109 1:47655689-47655711 CCTGCTGGAGCTCCTCCAGCTGG + Intergenic
906791240 1:48660277-48660299 GCTGCTGATGCACCTGCTGCTGG - Intronic
907534503 1:55137548-55137570 ACTGCTGCTGCTGCTGGAGCTGG + Exonic
907666780 1:56439855-56439877 ACAGCTGATGCTCCAGGAGCAGG + Intergenic
907824136 1:57999317-57999339 GCTGCTGATGCTGCTGGTCCAGG - Intronic
907872290 1:58454313-58454335 ACTGCAGTTGCTCCTGCAGCTGG - Intronic
907884059 1:58577093-58577115 GCCGCTGCTGCTGCTGGTGCTGG - Exonic
908825964 1:68132898-68132920 GCTGCTGGAGCCCCGGGAGGTGG + Intronic
908850766 1:68373499-68373521 GCTGGCGGCGCTGCTGGAGCAGG - Intergenic
909433578 1:75616158-75616180 GCTGCTCCTGCTGCTGGAGGGGG + Intergenic
909548020 1:76868589-76868611 GCTGCTGCTGCTGCTGCTGCGGG - Exonic
909622502 1:77683511-77683533 GCTGCTGTTGCTGCTGCTGCAGG + Intergenic
910192221 1:84605918-84605940 GCTGATGGTGCAGCTGGAGGGGG - Intergenic
911052368 1:93681692-93681714 GCCGCGGCTGCTCCCGGAGCTGG + Intronic
911216409 1:95200238-95200260 GCAGCTGTGGATCCTGGAGCAGG + Intronic
912366571 1:109138570-109138592 GCTGCTGCTGCTGCTGCTGCTGG - Intronic
912378386 1:109231633-109231655 GGTCCTGGTGTTCCTGGAACAGG + Exonic
912758247 1:112342712-112342734 GCTGCTGGTGCTCCAGCTGTCGG + Intergenic
913198715 1:116478561-116478583 GCTGACGGTGTTTCTGGAGCTGG + Intergenic
913250709 1:116910230-116910252 GCTGCTGGCGCTCCTGTCGTTGG + Exonic
913269107 1:117075551-117075573 GCCGCTGGTCCTCCAGGAGCAGG - Exonic
914779366 1:150770967-150770989 CCTGCTGGTGCTGCTGCTGCTGG - Intergenic
915241234 1:154523492-154523514 GGTGCTGATGCTCCTGGCCCTGG + Intronic
915264654 1:154708110-154708132 GCTGCTGCTGCTGCTGGCGCAGG + Exonic
915445491 1:155972272-155972294 GCTGCTGGCCCACCTAGAGCAGG - Intronic
916482327 1:165225763-165225785 GCTGCTGCTGCTGCTGGTCCAGG + Intronic
917345213 1:174022270-174022292 GCTGAGGCTGCTCCTGCAGCAGG + Exonic
917469461 1:175314169-175314191 ACTGCCTGTGCTCCTGGAACTGG + Intergenic
918615616 1:186540839-186540861 GCTGAGTGTGCTCCTGGGGCTGG + Intergenic
919085964 1:192920187-192920209 GCTGCTGGTGCTGCTAGTCCGGG + Intergenic
920071739 1:203307225-203307247 GCAGCTGGTGCAGCTGGGGCTGG - Exonic
920094219 1:203475537-203475559 GCTGCTGCCGCTTCTGGAGAGGG - Intergenic
920196059 1:204228143-204228165 GCTTCTCCTGCTCCTGCAGCTGG + Exonic
920446756 1:206023749-206023771 GCTGCTGGTGCTCCTGGAGCTGG - Exonic
920707821 1:208267465-208267487 GCTGCTGCTGCTGCTGCTGCTGG - Intergenic
921217548 1:212950653-212950675 GCTGCTGCTGGGCCTGGGGCTGG - Exonic
921217551 1:212950659-212950681 GCTGCTGCTGCTGCTGGGCCTGG - Exonic
922709383 1:227815770-227815792 TCTGCTGCTGCTCCTGGTGGTGG + Exonic
922810850 1:228414760-228414782 GCTCGTGGTGCTCCTGGCACAGG + Exonic
922866988 1:228868736-228868758 GCTGCTGCTGCTGCTGCTGCTGG + Intergenic
922866990 1:228868742-228868764 GCTGCTGCTGCTGCTGGTGGTGG + Intergenic
922879673 1:228971147-228971169 GCTGCTGCTGCTGCTGGTGGAGG + Intergenic
923120472 1:230985553-230985575 GCTGCTGTGTCTCCTGGTGCTGG + Intronic
923969001 1:239178225-239178247 GCTGCTGCTGCTGCTGCAGCTGG - Intergenic
924052517 1:240092718-240092740 GCTGCTGCTGCTGCTGCAGGCGG - Exonic
924052518 1:240092721-240092743 GCTGCTGCTGCTGCTGCTGCAGG - Exonic
924052520 1:240092754-240092776 GCTGCTGCTGTTGCTGGAGCTGG - Exonic
924052521 1:240092760-240092782 GCTGCTGCTGCTGCTGTTGCTGG - Exonic
924432740 1:244010376-244010398 ACTTCTGGTGCACCTGCAGCAGG - Intergenic
924526902 1:244860909-244860931 GCTGCTGTTGATCCTGCACCAGG + Intronic
924624500 1:245687836-245687858 GCTGCTGGTGCCGCTGCCGCTGG - Exonic
1063003489 10:1946395-1946417 GGAGCTGGCGCTCTTGGAGCAGG + Intergenic
1063429623 10:5977414-5977436 GCTGCTGCTGCTCCGGCCGCCGG - Exonic
1063770920 10:9198798-9198820 GCTGCTGATGCAGCTGGAGGAGG - Intergenic
1065818753 10:29506519-29506541 ACTGCTGGTGCTGCTGGAGCAGG + Intronic
1065917319 10:30364738-30364760 GGGGCTGGGGCCCCTGGAGCAGG + Intronic
1065917336 10:30364835-30364857 ACTGCTGGAGCTGCAGGAGCTGG - Intronic
1065954167 10:30677877-30677899 ACTGCTGGTGCTGCTGGAGCAGG - Intergenic
1066256472 10:33684296-33684318 GCTACTGCTGCTTATGGAGCAGG + Intergenic
1067732189 10:48820419-48820441 CCTGGAGGTGCTCCTGGAGGTGG + Exonic
1068053532 10:51982794-51982816 GCTGCTGCTGCTGCTGCTGCTGG - Intronic
1069779451 10:70945648-70945670 GCTGCTGGAACTCATGGTGCAGG - Intergenic
1069911680 10:71763563-71763585 CCTGGTGGGGCTTCTGGAGCTGG + Intronic
1069919432 10:71807559-71807581 TCTGCTGGTGCTGCGGGACCTGG + Exonic
1070315105 10:75302829-75302851 GCTGCTGGTTGTCATGGTGCTGG + Intergenic
1070825135 10:79386398-79386420 GCTGCGGGTGCTCCTTGCTCTGG + Exonic
1071358021 10:84817949-84817971 GCTGCTGCTGCTGCTGCTGCTGG - Intergenic
1072102317 10:92240287-92240309 GCCGCTGCTGCTGCTGGGGCTGG + Exonic
1073081283 10:100862588-100862610 GCTGCTGGTGTTCCAGCAGGTGG - Intergenic
1073349952 10:102812677-102812699 GCAGCTGCTGCTGCTGTAGCTGG - Exonic
1074190540 10:111131473-111131495 CCTGCTGGGGCTCCTGAAGATGG - Intergenic
1074767010 10:116706944-116706966 GTGGCTAGTGCTTCTGGAGCAGG - Intronic
1075441291 10:122481184-122481206 ACTGCTGGTTCCCCTGGTGCAGG - Intronic
1076272119 10:129162917-129162939 GCTGCTGCGGGTCCTGCAGCAGG + Intergenic
1076384450 10:130046366-130046388 GCAACTGGCGCTTCTGGAGCAGG - Intergenic
1076427156 10:130375387-130375409 GATGCTGGTGCTACTGGTACAGG - Intergenic
1076718883 10:132384018-132384040 GCTGCTGGAGGCCCTGGGGCAGG - Intergenic
1076722115 10:132397250-132397272 GCTGCCGGTGCGGGTGGAGCAGG + Exonic
1076823835 10:132957421-132957443 GCTGTTAGTGCTCCAGGTGCGGG - Intergenic
1076875060 10:133211708-133211730 CCTGCTGGGCCTCCTGGAGGTGG + Exonic
1076882720 10:133247465-133247487 GAGGCAGGTGCTGCTGGAGCAGG + Intergenic
1076996184 11:298590-298612 GCCACTGCTGCTCCTGGGGCTGG - Exonic
1077111597 11:864451-864473 GCTGCTGGTGTTCCTGCTGGAGG + Exonic
1077112946 11:869932-869954 CCTGCAGGTGCGGCTGGAGCTGG - Exonic
1077426623 11:2482805-2482827 GCTGCAGGTGCACCAGGGGCAGG - Intronic
1077532682 11:3104570-3104592 GCTGCGGGTGCTCCAGGGGTGGG - Intronic
1077633428 11:3826126-3826148 GCTGGTGCTGTTTCTGGAGCAGG - Exonic
1077920977 11:6641514-6641536 GCTGCTGCTGCTGCTGCTGCTGG - Exonic
1078442631 11:11379832-11379854 GCTGCCTGTGGTCCTGGACCTGG + Intronic
1078724830 11:13920708-13920730 GCTCCTGGACCTGCTGGAGCTGG + Intergenic
1079486051 11:20936933-20936955 GCTTCTGTTCCTCCTAGAGCTGG + Intronic
1080052461 11:27871138-27871160 GAGGCTGGTGCAGCTGGAGCCGG + Intergenic
1080088108 11:28310895-28310917 GCTGCTGCTGCTGCTGCTGCTGG + Intronic
1080088110 11:28310901-28310923 GCTGCTGCTGCTGCTGGTGGTGG + Intronic
1082076765 11:47980987-47981009 GCTGCTGCTGCGCCTGGGCCAGG + Exonic
1082106720 11:48229007-48229029 GCTGCTGGTGCTGCAGGCCCAGG + Intergenic
1082996944 11:59262397-59262419 GGTGCAGCTGCTGCTGGAGCTGG + Intergenic
1083728852 11:64642662-64642684 GCTGCTGTTGCTGCTGGGGGCGG - Intronic
1083741447 11:64713633-64713655 GTTGCTGCTGCTGCTGGCGCTGG - Exonic
1083741448 11:64713639-64713661 GCTGCTGTTGCTGCTGCTGCTGG - Exonic
1083883035 11:65557848-65557870 GCTGCTGCTGCTGCTGGGCCTGG - Exonic
1083883037 11:65557854-65557876 GCTGCTGCTGCTGCTGCTGCTGG - Exonic
1083920108 11:65777954-65777976 GCTGCTGCTGCGGCTGGAGGCGG - Exonic
1083955166 11:65978840-65978862 CCTTCTGCTTCTCCTGGAGCAGG - Exonic
1083993730 11:66261897-66261919 GCTGCTTCTCCTCCTCGAGCTGG - Exonic
1084147445 11:67272619-67272641 GCTCCTACTGCTCCCGGAGCAGG - Intronic
1084151661 11:67290362-67290384 GCAGCTGGTGCTCCAGTATCGGG + Exonic
1084178700 11:67436215-67436237 GCTGCTGCTGCTCCTACTGCTGG - Exonic
1084310293 11:68312753-68312775 GCTGCTGCTGCTGCTGCTGCTGG + Exonic
1084424787 11:69078727-69078749 GTTGCAGGTGTTCCTGGTGCTGG + Exonic
1084697040 11:70761919-70761941 GCTGCTGCTGCTGCTGCTGCTGG + Intronic
1084730811 11:71072264-71072286 GCTGCTGGTCCTGTAGGAGCGGG - Intronic
1084860585 11:72015387-72015409 CCTGGAGCTGCTCCTGGAGCTGG + Exonic
1086250088 11:84802365-84802387 GCTGCTGCTGCTGCTGCTGCTGG - Intronic
1086455329 11:86954986-86955008 GTTGCTGCTGCTCCTGGGGCCGG - Exonic
1086866395 11:91985077-91985099 GCTGCTAGTCACCCTGGAGCAGG + Intergenic
1086955598 11:92931855-92931877 GCTGCTGGTGATCCTACAGCTGG + Intergenic
1087269058 11:96092668-96092690 GCTGCTGGTGCTGCTGCATCCGG + Exonic
1088976606 11:114821846-114821868 GCTGCTGCTGCTGCTGCTGCTGG - Intergenic
1089022223 11:115228133-115228155 GCTCCTGGGACTCCTAGAGCTGG + Intronic
1089249004 11:117144293-117144315 GCTGCTGCTGGTGCTGGGGCCGG + Exonic
1089299339 11:117489221-117489243 GCAGCAGGTACTCCTGGGGCAGG + Intronic
1090235020 11:125140588-125140610 GCTGCTGCTGCTGCTGCTGCTGG + Intergenic
1090619288 11:128547408-128547430 CCTGCTGTTTCTCATGGAGCAGG - Intronic
1090832337 11:130428217-130428239 GCTGCTGCTGCTGCTGCCGCTGG - Exonic
1091545883 12:1501029-1501051 GCTGGAGGTGGTCTTGGAGCAGG - Intergenic
1091606157 12:1953165-1953187 GCTGCTGCTGCTGCTGCTGCTGG + Exonic
1091626591 12:2125555-2125577 GATGCTGATGCACCTGAAGCAGG + Intronic
1092035380 12:5329977-5329999 GATGCTGGTGCTGCTGGTTCAGG + Intergenic
1092191858 12:6526964-6526986 GCAGCTGGTCCACTTGGAGCAGG + Exonic
1092282567 12:7108926-7108948 GCTGCTGCTGCTGCTGCTGCTGG + Intronic
1093170855 12:15858840-15858862 GCTGGTGGTGGTCCTGAGGCTGG - Intronic
1093583201 12:20807421-20807443 GGACCAGGTGCTCCTGGAGCAGG + Intergenic
1093827073 12:23705934-23705956 GCTGCAGGAGCTCCTAGAGAGGG + Intronic
1095293165 12:40499415-40499437 GCTACAGGGACTCCTGGAGCAGG + Intronic
1096043813 12:48544352-48544374 GCTGCTGCTGCTGCTGCAGACGG - Intergenic
1096103146 12:48981334-48981356 GGAGCTGCTGCGCCTGGAGCCGG + Exonic
1096112433 12:49037515-49037537 GCTGCTGTTGCTGCTGCTGCTGG + Exonic
1096549386 12:52362324-52362346 CCTCCTGGTACTCCTTGAGCAGG + Exonic
1097266582 12:57749169-57749191 GCTGCTGCTGGTACTGGAGATGG - Exonic
1098345872 12:69502859-69502881 GCTGCTGCTGCTGCTAGAGTAGG - Intronic
1099072353 12:78061064-78061086 GCTGCTGCTGCTGCTGGTCCAGG - Intronic
1099072354 12:78061070-78061092 GCTGCTGCTGCTGCTGCTGCTGG - Intronic
1100089627 12:90954362-90954384 GCTGCTGCTCCTGCTGGAGCGGG - Exonic
1100182033 12:92096112-92096134 GCTACATGTGCTCCTGGAGCCGG + Intronic
1100665710 12:96750283-96750305 GCTGCTGCTGCTGCTGCTGCAGG - Intronic
1101337805 12:103811632-103811654 CCTGCAGGGGATCCTGGAGCAGG + Intronic
1101761793 12:107664747-107664769 GCTGCTGCTGCTGCTGGTCCAGG + Intergenic
1101958265 12:109229346-109229368 GCTGCTTGTGCACGTGGAGTGGG + Intronic
1102278229 12:111598998-111599020 GCTGCTGCTGCTGCTGCTGCTGG + Exonic
1102483626 12:113241348-113241370 GCTGCTGCTGCTGCTGCAGGTGG - Intronic
1103407701 12:120687347-120687369 GCTGCTGCTGCTGCTGCCGCCGG + Exonic
1103459308 12:121090999-121091021 GCTGCTGGTGTCCCTGGTCCAGG + Intergenic
1103618495 12:122170977-122170999 GCTGCTGCTGCTGCTGGGCCAGG + Intronic
1103637819 12:122322653-122322675 GAGGATGGTGCTCCTGGAGCAGG - Intronic
1103729919 12:123020601-123020623 TCTCCTGCTGCTCCCGGAGCTGG - Intronic
1103934160 12:124466461-124466483 GCTGCAGCTGGCCCTGGAGCTGG - Intronic
1104641767 12:130471717-130471739 GCTCCTGCTGCTCCTGCTGCAGG + Intronic
1104642006 12:130473409-130473431 GCTGCTGCTGCTCCTGCCGCAGG - Intronic
1104841622 12:131828566-131828588 GCTGCTGCTGCTGCTGGCGCTGG + Exonic
1104987701 12:132606197-132606219 GCTGCTGCTGCTGCTGCTGCTGG - Exonic
1104993800 12:132641888-132641910 GGGGCTGGTGGTGCTGGAGCTGG - Intronic
1105014042 12:132775176-132775198 GCTGCTGGTTCTGCTGGAGCAGG + Exonic
1105287655 13:19019083-19019105 GCAGCTGCTGCTCATGGAACAGG - Intergenic
1105388766 13:19957802-19957824 GCTGCGGGCTCCCCTGGAGCTGG - Intergenic
1105420911 13:20251579-20251601 GCTGCTGCTGCTGCTGCTGCTGG + Intergenic
1106108183 13:26752868-26752890 GATGCTGGTGCTGCTGGTGAGGG + Intergenic
1106219871 13:27736801-27736823 GCTGCTGGTGTTCTGGGAACTGG - Intergenic
1106451796 13:29888935-29888957 GCTGCTGGTGACCCTGGCCCTGG + Intergenic
1106720157 13:32428019-32428041 GCTGCTGCTGCTGCTGGGGCTGG + Exonic
1106776729 13:33016497-33016519 GCTGCTGGTGCTGCTGGGCCTGG + Exonic
1106953772 13:34913166-34913188 GCTGCTGCTGCTACTGAAGCCGG + Intergenic
1107400056 13:40060812-40060834 GCTGCTGATCTTCCTGGAGCTGG + Intergenic
1108478374 13:50843214-50843236 GCTGCTGGGGCCCCTCCAGCAGG - Exonic
1108727626 13:53200349-53200371 CCTGCTGGTGCACGTGGAGGTGG + Intergenic
1110119717 13:71866341-71866363 GCTGCTGCTGCTGCCGGTGCTGG + Exonic
1110648455 13:77916833-77916855 GCTGCTGCTGCTGCTGCTGCTGG + Intronic
1111397086 13:87677758-87677780 GCTGCTGCTGCTGCTGCAGGTGG - Exonic
1111446701 13:88355572-88355594 ACAGCTGGTGCCCCTGGAGGGGG + Intergenic
1112353474 13:98655525-98655547 GCTGCTGATGCTGCTGGTCCAGG + Intergenic
1113200789 13:107866374-107866396 GCTGCTGGTGCTCCTTGTCCCGG + Exonic
1113774395 13:112934560-112934582 GCTGCTGCTGCTGCTGCTGCTGG + Intronic
1113842851 13:113370134-113370156 GCTGCAGGCTCTCCTGGAGTGGG + Intergenic
1114454417 14:22845928-22845950 GCTGCTGCTGCTCCTGGTGCTGG + Exonic
1114670469 14:24408231-24408253 GCTGCTGCTGAGCCTGGTGCGGG + Exonic
1114748804 14:25180978-25181000 GCTGGGGGTGCACCTGCAGCAGG + Intergenic
1115179382 14:30604584-30604606 GCTGCTGCTGCTGCTGCTGCTGG + Intronic
1115491194 14:33959983-33960005 GCTGCTGATGCTGCTGGAGCTGG - Intronic
1115519756 14:34221533-34221555 GCTGTTGGTGGTGCTGGAGATGG + Intronic
1115772316 14:36677252-36677274 GCTGCTCGGGCTCCTGGACCTGG + Exonic
1117313461 14:54551178-54551200 GGTGCTGCTGGGCCTGGAGCTGG - Intergenic
1117366951 14:55038541-55038563 GCTGCTGGAGTTCTGGGAGCTGG + Intronic
1117369380 14:55062837-55062859 GGTGCTGGGGGTCCTGGAGGTGG - Exonic
1117869365 14:60183799-60183821 GTTACTAGTGCTCGTGGAGCTGG - Intergenic
1118366795 14:65102870-65102892 GGAGCTGGAACTCCTGGAGCCGG + Intergenic
1119278227 14:73380113-73380135 GATGCGGTTTCTCCTGGAGCTGG - Intronic
1119712103 14:76829779-76829801 GCTCCTGGTGCTCCTGCTGTGGG + Intronic
1119888211 14:78162247-78162269 GCAGATGGTGATCCTGGAGAAGG + Intergenic
1119951661 14:78751781-78751803 GCTACTGCTGCTCCTCCAGCAGG - Intronic
1121104761 14:91272956-91272978 GGTGCTGGTGCTGCTGCTGCTGG - Exonic
1121109718 14:91303816-91303838 GGTGCTCGTGGTCCTGCAGCAGG + Exonic
1121299861 14:92861747-92861769 GCTGGTGGTGCTCGTGGGGGTGG - Intergenic
1121437204 14:93927708-93927730 GGGGCTGGTGCTCCTCGTGCTGG + Intronic
1121502132 14:94446404-94446426 GCTGCTGGTCCTCCCTGACCCGG - Exonic
1121772153 14:96555857-96555879 GCTGCTGTTACAGCTGGAGCAGG - Exonic
1121906701 14:97752692-97752714 GCTGCTGGTCCTGCTGGCTCTGG - Intronic
1122130915 14:99604237-99604259 GCGGCGGGGGCTCCGGGAGCTGG - Intergenic
1122517017 14:102316025-102316047 AAAGCTGGTGCTCCTGGAGTGGG + Intergenic
1122517644 14:102319885-102319907 GCTGCGGCAGGTCCTGGAGCAGG + Exonic
1122535904 14:102462655-102462677 GCTGGTGGTGCTGCTGGAGAGGG - Intronic
1122647737 14:103206380-103206402 GCTCCTGGGGGTCCTGGTGCCGG - Intergenic
1122703441 14:103605581-103605603 GCTGCTGGTGCTCCTCAATCTGG - Intronic
1122738700 14:103858489-103858511 GCTGCTGATGCTGCTGGTCCAGG + Intergenic
1122762665 14:104041135-104041157 GCTGCCGATGCTCCGGGGGCAGG + Intronic
1122771876 14:104101243-104101265 GCTGCTGGGGCCCCTGGGGAGGG + Intronic
1122773387 14:104106873-104106895 GCTGCAGGCGCTTGTGGAGCTGG + Exonic
1122975264 14:105168354-105168376 GCTGCTGGCGCTCTGGGTGCAGG - Exonic
1123117673 14:105901991-105902013 GCTGCTGGTGGTACTGGAAGAGG + Intergenic
1123406294 15:20021057-20021079 GGTGCTGGTGCTGCTGGGTCAGG + Intergenic
1123473713 15:20572324-20572346 GCTGCTGGAGCTGCAGGAGATGG + Intergenic
1123515624 15:21027705-21027727 GGTGCTGGTGCTGCTGGGTCAGG + Intergenic
1123644296 15:22428029-22428051 GCTGCTGGAGCTGCAGGAGATGG - Intergenic
1123665592 15:22607832-22607854 GGGGCTGGGGCTCCTGGACCGGG + Intergenic
1123734013 15:23167335-23167357 GCTGCTGGAGCTGCAGGAGATGG + Intergenic
1123752164 15:23364820-23364842 GGGGCTGGGGCTCCTGGACCGGG - Exonic
1124284516 15:28388646-28388668 GCTGCTGGAGCTGCAGGAGATGG + Exonic
1124298181 15:28522968-28522990 GCTGCTGGAGCTGCAGGAGATGG - Exonic
1124319419 15:28702246-28702268 GGAGCTGGGGCTCCTGGACCGGG + Exonic
1124483097 15:30093185-30093207 GGGGCTGGGGCTCCTGGACCGGG - Exonic
1124489547 15:30145253-30145275 GGAGCTGGGGCTCCTGGACCGGG - Exonic
1124520486 15:30404033-30404055 GGGGCTGGGGCTCCTGGACCGGG + Exonic
1124538171 15:30562186-30562208 GGGGCTGGGGCTCCTGGACCGGG - Exonic
1124544637 15:30614247-30614269 GGGGCTGGGGCTCCTGGACCGGG - Exonic
1124564594 15:30801676-30801698 GGGGCTGGGGCTCCTGGACCGGG - Intergenic
1124753980 15:32393074-32393096 GGAGCTGGGGCTCCTGGACCGGG + Exonic
1124760482 15:32445399-32445421 GGGGCTGGGGCTCCTGGACCGGG + Exonic
1124778154 15:32603663-32603685 GGGGCTGGGGCTCCTGGACCGGG - Exonic
1124817988 15:33015929-33015951 GATGCTGATGCTCCTGGTCCAGG - Intronic
1124959073 15:34381829-34381851 GCTGCTGGAGCTGCAGGAGATGG - Exonic
1124975699 15:34528050-34528072 GCTGCTGGAGCTGCAGGAGATGG - Exonic
1125506323 15:40269806-40269828 GCTGCTGCTGCTGCAGGTGCTGG - Intronic
1126178620 15:45763154-45763176 GCTGCTAGTGATCCTGCAGAAGG + Intergenic
1126580669 15:50239837-50239859 GCTGCTGATGCTGCTGGCTCAGG - Intergenic
1126953829 15:53911755-53911777 GGTGCAGGTGCTCCGGGAGACGG + Intergenic
1127290847 15:57569681-57569703 GCTGCCAGTGCTCTTGGAGCTGG - Intergenic
1127426691 15:58865179-58865201 GATGCTGGAGCTGCTGGTGCTGG + Intronic
1127648045 15:60976845-60976867 GCTGCTGTTGCTGCTGCAGGTGG - Intronic
1128113876 15:65093541-65093563 GCTGTTTGTGCTCCAGGTGCAGG - Intronic
1128322066 15:66701291-66701313 GCCGCTCCTGCCCCTGGAGCCGG - Intergenic
1128322639 15:66703747-66703769 GCGGCTGCTGCTGCTGGAGCAGG + Exonic
1128338530 15:66803670-66803692 GCTGCTGATGCTGCTGGTTCAGG - Intergenic
1128792752 15:70445100-70445122 GATGCTGGCCATCCTGGAGCTGG - Intergenic
1128944276 15:71810783-71810805 GCTGCAGCTGCGCCTGCAGCTGG + Exonic
1129333537 15:74839650-74839672 ACTGCAGCGGCTCCTGGAGCGGG - Exonic
1129457163 15:75682185-75682207 GCTGCCAGTGATGCTGGAGCTGG + Intronic
1129476319 15:75786534-75786556 GCTGCTGGAGCTGCAGGAGCTGG + Intergenic
1129476340 15:75786628-75786650 GGGGCTGGGGCCCCTGGAGCGGG - Intergenic
1129726620 15:77904755-77904777 GCTGCCAGTGATGCTGGAGCTGG - Intergenic
1129785096 15:78304589-78304611 GCGGGGGGTGCTCCTGGAGAAGG - Intergenic
1130093418 15:80839492-80839514 GCTGCTGCTGCTGCGGGTGCTGG - Intronic
1130247175 15:82262613-82262635 GCTGGTGGGGCTGCTGCAGCCGG - Exonic
1130259576 15:82344755-82344777 GGTGGAGGAGCTCCTGGAGCAGG - Exonic
1130269106 15:82434431-82434453 GGTGGAGGAGCTCCTGGAGCAGG + Exonic
1130274654 15:82470094-82470116 GCTGCCGGTGATGCTGGAGCTGG - Intergenic
1130281690 15:82524431-82524453 GGTGGAGGAGCTCCTGGAGCAGG + Intergenic
1130453459 15:84080305-84080327 GCTGGTGGGGCTGCTGCAGCCGG + Intergenic
1130467000 15:84197468-84197490 GCTGCCGGTGATGCTGGAGCTGG - Intergenic
1130468400 15:84204209-84204231 GCTACTGGGGCTCCTAGAGTGGG + Intergenic
1130473059 15:84240593-84240615 GGTGGAGGAGCTCCTGGAGCAGG + Exonic
1130480473 15:84354658-84354680 GGTGGAGGAGCTCCTGGAGCAGG + Intergenic
1130486607 15:84401710-84401732 GCTGCCAGTGATGCTGGAGCTGG + Intergenic
1130491238 15:84433101-84433123 GGTGGAGGAGCTCCTGGAGCAGG - Intergenic
1130495866 15:84469333-84469355 GCTACTGGGGCTCCTAGAGTGGG - Intergenic
1130497264 15:84476068-84476090 GCTGCCGGTGATGCTGGAGCTGG + Intergenic
1130502821 15:84511901-84511923 GGTGGAGGAGCTCCTGGAGCAGG - Intergenic
1130589298 15:85202061-85202083 GCTGCCGGTGATGCTGGAGCTGG - Intergenic
1130590693 15:85208807-85208829 GCTACTGGGGCTCCTAGAGTGGG + Intergenic
1130595348 15:85245201-85245223 GGTGGAGGAGCTCCTGGAGCAGG + Intergenic
1130771804 15:86931595-86931617 GCTGCTGCTGCTGCTGCTGCTGG + Intronic
1131507381 15:93030257-93030279 GCTGGTCCTGCTCCAGGAGCTGG + Intergenic
1132131486 15:99284644-99284666 GCTGCTGCTGCTACTGGAACTGG + Intronic
1132175735 15:99712504-99712526 GCTGCTGCTGCTGCTGCTGCTGG - Exonic
1132184670 15:99792670-99792692 GGGGCTGGGGCTCCTGGACCAGG - Intergenic
1132432313 15:101771984-101772006 GGGGCTGGGGCTCCTGGACCAGG + Intergenic
1132496210 16:264661-264683 GCCGCGCGTGCTGCTGGAGCTGG + Exonic
1132808615 16:1787248-1787270 GGTTCTGGTGCCTCTGGAGCAGG + Intronic
1132892367 16:2210578-2210600 GCTGCTGCTGCTGCTGGTGCTGG - Exonic
1132897094 16:2234223-2234245 CCTCCTGGTGCTTCTTGAGCAGG - Exonic
1133118011 16:3589279-3589301 GCTGCTGGTGCTCAGGGGGCCGG + Exonic
1133152822 16:3849760-3849782 GCTGCTGCTGCTGCTGGTCCAGG + Intronic
1133203445 16:4218633-4218655 GCTGCTGGTGATGGAGGAGCAGG - Intronic
1133216200 16:4293966-4293988 GCTGCTGCTGCTGCTGAAGCCGG - Intergenic
1133336568 16:5010520-5010542 ACTGCCAGTGCTCGTGGAGCTGG - Intronic
1133733586 16:8596742-8596764 GCAGATGGAGCTGCTGGAGCTGG - Intergenic
1134059595 16:11191172-11191194 CCTGCTGTGGCACCTGGAGCTGG - Intergenic
1134434199 16:14240389-14240411 ACAGCTGCTGCTGCTGGAGCAGG - Exonic
1134856143 16:17521076-17521098 GCTGCTGGTGTTCATGGTGGAGG + Intergenic
1135517548 16:23148685-23148707 GCAGCTGGCGCACCTGGTGCGGG - Exonic
1135570337 16:23544542-23544564 GCGGCTGGAGCTCCTGAAGAAGG - Exonic
1136186392 16:28591152-28591174 GGAGCTGGTTCTCCTGGGGCTGG - Intronic
1136235445 16:28910965-28910987 GATGCAGGTGCTCCTGGCCCAGG - Exonic
1136398278 16:30004754-30004776 GCCGCTGGGGCTCCTGGCTCAGG + Intronic
1136507203 16:30712294-30712316 TGTGCTGGTACTCCCGGAGCTGG - Exonic
1136512787 16:30749090-30749112 GCTGCTGCTGCTGCTGCTGCTGG + Intronic
1136512789 16:30749099-30749121 GCTGCTGCTGCTGGTGGTGCTGG + Intronic
1136512790 16:30749105-30749127 GCTGCTGGTGGTGCTGGTGCTGG + Intronic
1136512818 16:30749239-30749261 GGTGCTGGTGCTGGTGGTGCTGG + Intronic
1136671719 16:31864593-31864615 GCTGCTGCTGCTGCAGGAGGAGG - Intergenic
1136672490 16:31871271-31871293 GCTGCTGCTGCTGCTGTTGCTGG - Intergenic
1136776863 16:32876601-32876623 GCTGCTGCTGCTGCTGGTGAAGG - Intergenic
1136776864 16:32876607-32876629 GCTGCTGCTGCTGCTGCTGCTGG - Intergenic
1136893753 16:33984906-33984928 GCTGCTGCTGCTGCTGCTGCTGG + Intergenic
1136893754 16:33984912-33984934 GCTGCTGCTGCTGCTGGTGAAGG + Intergenic
1136911236 16:34146237-34146259 GCTGCTGTTGCTGCTGCTGCTGG + Intergenic
1136996793 16:35196092-35196114 GCTGCTGGTGCCGCTCGGGCAGG - Intergenic
1137592746 16:49703751-49703773 GCTGCTAAGGCTTCTGGAGCTGG + Intronic
1137668623 16:50266503-50266525 GCTGCTGCCGCTGCCGGAGCAGG + Exonic
1138174093 16:54880479-54880501 GCTGCTGGTGTTCTGGAAGCAGG - Intergenic
1138213747 16:55184881-55184903 CCTGCTGGAGCACCTGGGGCTGG - Intergenic
1138408193 16:56815877-56815899 GCTGCTGCTGCTGCTGCTGCTGG + Intronic
1138782655 16:59807923-59807945 GCTACTGGGGCTCCAGGATCTGG - Intergenic
1139573665 16:67828317-67828339 GCTGCCGGTACTCCAGGGGCAGG + Exonic
1139593801 16:67947077-67947099 GCTGCTGGTGCTGCTGAAGCTGG - Exonic
1140187609 16:72788666-72788688 GCTGCTGCTGCTGCTGCTGCTGG + Exonic
1141128310 16:81416949-81416971 GCTGCTGCTGCTGCTGCCGCCGG - Intergenic
1141222886 16:82088198-82088220 GCTGCTGGAGATTCTGAAGCAGG + Intronic
1141463146 16:84190146-84190168 GCTGCTGCTGCTGCTGAAGCTGG - Intergenic
1141608444 16:85168784-85168806 GCTGCGGGCGCCCCTGGAGGCGG - Intergenic
1141672042 16:85497228-85497250 GCTGCTGGGTCTCCTGAAGGCGG + Intergenic
1141703853 16:85654282-85654304 TCCACTGCTGCTCCTGGAGCCGG - Exonic
1141967532 16:87456398-87456420 GCTGCTGGGGCTACAGGTGCCGG - Intronic
1142242059 16:88952045-88952067 GCTCCTGGGGCTGCTGGGGCCGG - Intronic
1142257606 16:89022305-89022327 GCAGCTGGGGCTCCCGCAGCCGG - Intergenic
1142280007 16:89143019-89143041 GGGGCTGGTGCTGCTGGAGATGG + Intronic
1203079279 16_KI270728v1_random:1138710-1138732 GCTGCTGCTGCTGCTGGTGAAGG - Intergenic
1203079280 16_KI270728v1_random:1138716-1138738 GCTGCTGCTGCTGCTGCTGCTGG - Intergenic
1142699120 17:1649026-1649048 GCTGCAGCTGCTCCTGCAACTGG + Exonic
1142903247 17:3026400-3026422 GCTGCTGACGCTGCTGGTGCTGG - Exonic
1143014215 17:3883104-3883126 GCAGCTGCTGCCCCTGGAGCGGG - Exonic
1143164383 17:4890603-4890625 GCTGCTGTTGCTGCTGCTGCAGG - Exonic
1143449042 17:7024700-7024722 GCTGCTGCTGCTGCTGCTGCTGG - Exonic
1143473415 17:7190329-7190351 GCAGCGGGTGCTCCTCGAGGGGG + Exonic
1143994586 17:10995754-10995776 GCTGCTGCTGCTGCTGCTGCTGG + Intergenic
1144021136 17:11240981-11241003 GCGACTGGCGCTCCGGGAGCAGG - Intergenic
1144327461 17:14195809-14195831 GCTGCTGATGCCCCTGGTCCAGG + Intronic
1144671659 17:17136247-17136269 GCTGCTGCTGCTGCTGCTGCTGG - Exonic
1144777862 17:17793779-17793801 GCTGCTGCTGCTGCTGCTGCTGG - Exonic
1145063199 17:19745003-19745025 CCTGCTCCTGCTCCTGGATCAGG + Exonic
1145244671 17:21260701-21260723 TTTGCTGGCTCTCCTGGAGCAGG + Intergenic
1146957106 17:36942304-36942326 GCTGGTGGACCGCCTGGAGCCGG + Exonic
1147315297 17:39617542-39617564 GAAGCTGGGGCTCCTGAAGCTGG - Intergenic
1147416142 17:40291606-40291628 CTTTCTGGTGCTCCTGGAACTGG + Exonic
1147514769 17:41105486-41105508 GCAGCAGGTGGTCCTGCAGCAGG - Exonic
1147516646 17:41124015-41124037 GCAGCAGGTGGTCCTGCAGCAGG + Exonic
1147517984 17:41140248-41140270 GCAGCAGGTGGTCCTGCAGCAGG + Exonic
1147518007 17:41140380-41140402 GCAGCAGGTGGTCCTGCAGCAGG + Exonic
1147518903 17:41149480-41149502 GCAGCAGGTGGTCCTGCAGCAGG + Exonic
1147518906 17:41149495-41149517 GCAGCAGGTGGTCCTGCAGCAGG + Exonic
1147518937 17:41149660-41149682 GCAGCAGGTGGTCCTGCAGCAGG + Exonic
1147519805 17:41160149-41160171 GCAGCAGGTGGTCCTGTAGCAGG + Exonic
1147519871 17:41160509-41160531 GCAGCAGGTGGTCCTGCAGCAGG + Exonic
1147519885 17:41160584-41160606 GCAGCAGGTGGTCCTGCAGCAGG + Exonic
1147520534 17:41168053-41168075 GCAGCAGGTGGTCCTGCAGCAGG + Exonic
1147521547 17:41178057-41178079 GCAGCAGGTGGTCCTGCAGCAGG + Exonic
1147522738 17:41190065-41190087 GCAGCAGGTGGTCCTGCAGCAGG - Exonic
1147526250 17:41226689-41226711 GCAGCAGGTGGTCCTGCAGCAGG - Exonic
1147528957 17:41255549-41255571 GCAGCAGGTGGTCCTGCAGCAGG - Exonic
1147529864 17:41265556-41265578 GCAGCAGGTGGTCCTGCAGCAGG - Exonic
1147530446 17:41271489-41271511 GCAGCAGGTGGTCCTGCAGCAGG - Intergenic
1147530859 17:41275861-41275883 GCAGCAGGTGGTCCTGCAGCAGG - Exonic
1147554369 17:41467071-41467093 GCTGCCGGGGCCCATGGAGCCGG + Exonic
1147721401 17:42541825-42541847 GCTGCTGCTGCTGCTGCTGCTGG - Intronic
1148225222 17:45894571-45894593 GCTGCTGTTGGTGCCGGAGCTGG - Exonic
1148774467 17:50087889-50087911 GCTGGTGGAGGTCCCGGAGCAGG - Intronic
1148839311 17:50484501-50484523 GGTGCAGGAGCTGCTGGAGCGGG + Exonic
1148847728 17:50538995-50539017 GCTGCTGCTGCTGCTGGTGGAGG + Intronic
1149293469 17:55239059-55239081 GCTGCTGCTGCTGCTGCTGCTGG + Intergenic
1149539058 17:57454942-57454964 CCTGCTGCTGCTCCTGTCGCAGG + Intronic
1149598579 17:57878561-57878583 TGTGCTGGGGCTGCTGGAGCTGG - Intronic
1150069740 17:62140456-62140478 GCTGGAGGTGCTCCAGGCGCGGG - Intergenic
1150148170 17:62788425-62788447 GCTGCTGCTGCTGCTGGTGGTGG - Intronic
1150302187 17:64055861-64055883 GCTGCTGCTGCTGCTGCTGCAGG + Exonic
1150302188 17:64055867-64055889 GCTGCTGCTGCTGCAGGAGCTGG + Exonic
1150602869 17:66665591-66665613 GCTGCTGGTCTACCTGGAGTGGG + Intronic
1151250261 17:72828761-72828783 GGTCCAGGTGCTGCTGGAGCAGG + Intronic
1151411572 17:73933762-73933784 GATGTTAGTCCTCCTGGAGCTGG + Intergenic
1151555474 17:74844374-74844396 GCTGCTGGTGGCCATGGGGCTGG - Exonic
1151561622 17:74872912-74872934 GCTGCTGGCGCTGGTGGGGCTGG - Exonic
1151723712 17:75872990-75873012 GCTGCTGAGGCTGCTGGGGCTGG + Intergenic
1151727258 17:75892290-75892312 GATCCGGGAGCTCCTGGAGCAGG - Exonic
1151885993 17:76923688-76923710 ACGGCTTGTGCTCCTGGGGCTGG + Intronic
1152256339 17:79242189-79242211 GCTGCTGCTGCTGGTGGAGGGGG + Intronic
1152353380 17:79795376-79795398 GCGGCAGGTGCTGCTGGTGCTGG + Exonic
1152465538 17:80464235-80464257 GCAGCTGGGGGACCTGGAGCCGG + Intergenic
1152502452 17:80721429-80721451 GCTTCTGCTGCTCCTGCACCAGG - Intronic
1152537525 17:80959392-80959414 GCAGCAGGTGCTCCCAGAGCCGG + Intronic
1152587092 17:81193972-81193994 GCTGCGGGAGCAGCTGGAGCGGG - Exonic
1152663207 17:81552473-81552495 GCTGCAGGGACTCCGGGAGCTGG + Intronic
1152698806 17:81809048-81809070 GCTGCTGTTGCTGCTGCTGCTGG + Exonic
1152769385 17:82157924-82157946 GCTGCGGGAACCCCTGGAGCCGG - Exonic
1152799081 17:82322769-82322791 CCTGCTGGGGCTCCAGGAGAGGG - Intronic
1152832206 17:82504327-82504349 CCTTCAGGAGCTCCTGGAGCTGG - Intergenic
1152992361 18:375066-375088 GCAGCTGCTGCTCCTGCTGCTGG - Intronic
1153568588 18:6445610-6445632 GCTGGTTGTGCTGCTGGGGCAGG + Intergenic
1153815135 18:8784687-8784709 GCTGCAGGCCTTCCTGGAGCAGG + Exonic
1154040964 18:10855487-10855509 GCACCTGGTGGTCCTGGTGCCGG - Exonic
1154206013 18:12337643-12337665 GCTGCTGCTGCTGCTGCTGCTGG - Intronic
1154359822 18:13650260-13650282 GCTGCTGCTGCTTCTCGAACTGG + Exonic
1156294027 18:35773877-35773899 GCTGCTGGGGCCCCTGAGGCTGG - Intergenic
1156492282 18:37503273-37503295 GCTGCAAGTGCTCCTGGAACAGG - Intronic
1157479035 18:48040978-48041000 GCTCCTGGTGGTGCAGGAGCAGG - Exonic
1157566420 18:48681698-48681720 GCAACTGGTGCTGCTGGATCAGG - Intronic
1157742407 18:50105269-50105291 GCTGATGCTGGTACTGGAGCTGG + Intronic
1157764376 18:50285916-50285938 GCTGCTGGTGATGCTGCAGGAGG + Exonic
1158480998 18:57821752-57821774 ACTGCTGCTGCTCCTGGTCCAGG - Intergenic
1158490160 18:57902765-57902787 GCTCCTGCTTCTCCTGGAGCTGG - Intergenic
1158695163 18:59697255-59697277 GCTGCTGCTGCTCCTGGCGTTGG - Exonic
1160057680 18:75499988-75500010 GCTGCTGCTGCTGCTGCTGCTGG - Intergenic
1160419102 18:78732007-78732029 GCTGCTGTGGCAGCTGGAGCAGG - Intergenic
1160584293 18:79904065-79904087 GCTGCAGGTGCTGGTGGACCTGG - Exonic
1160618840 18:80155621-80155643 GATGCTGATGCTGCTGGTGCAGG - Intronic
1160701091 19:507773-507795 GCTGCTGCTGCAGCAGGAGCTGG - Exonic
1160780922 19:877716-877738 GCTGCTGGGGCACGTGGGGCAGG - Intronic
1160780948 19:877790-877812 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160780980 19:877902-877924 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781002 19:877970-877992 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781020 19:878032-878054 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781060 19:878182-878204 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781085 19:878250-878272 GCTGCTGGGGCCCGTGGGGCTGG - Intronic
1160781102 19:878306-878328 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781124 19:878374-878396 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781151 19:878448-878470 GCTGCTGGGGCACGTGGGGCCGG - Intronic
1160781168 19:878504-878526 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781204 19:878628-878650 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781238 19:878740-878762 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781257 19:878796-878818 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781282 19:878864-878886 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781353 19:879074-879096 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781378 19:879142-879164 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781419 19:879318-879340 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781450 19:879430-879452 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781467 19:879486-879508 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781503 19:879622-879644 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781519 19:879678-879700 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781543 19:879766-879788 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781561 19:879822-879844 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781586 19:879910-879932 GCTGCTGGGGCACGTGGGGCCGG - Intronic
1160881837 19:1324523-1324545 GCAGCTGGTGTGGCTGGAGCAGG + Intergenic
1161304033 19:3557205-3557227 GCTGCTGCTGCTGCTGGGCCAGG - Exonic
1161428523 19:4217518-4217540 GCTGCGGGCGGCCCTGGAGCAGG + Exonic
1161483738 19:4523818-4523840 GCTGCTGGAGCTGGTGGTGCAGG - Exonic
1161526943 19:4762015-4762037 GCTCCTGCTGTTCCCGGAGCAGG - Intergenic
1161743288 19:6038797-6038819 GCTGCTGGTGCTCTTGGTTTTGG - Intronic
1162133867 19:8543725-8543747 GCTGGTGGTGCTGGTGGTGCTGG + Intronic
1162133878 19:8543767-8543789 GCTGGTGGTGCTGGTGGTGCTGG + Intronic
1162133903 19:8543857-8543879 GCTGGTGGTGCTGGTGGTGCTGG + Intronic
1162247087 19:9410463-9410485 GCTTCTGGAGCTCCTGGACAAGG - Intergenic
1162412221 19:10513375-10513397 GATGCTGGTGTGCCTGGAGCAGG - Exonic
1162478544 19:10915142-10915164 GCTGGCTGTGCTCCTGGAGGTGG + Intronic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1162818036 19:13207879-13207901 GCTGCTGCTGCTGCTGCTGCGGG + Exonic
1162818437 19:13209387-13209409 GCCGCTGGTTCTCCTCGGGCGGG + Exonic
1162904961 19:13817894-13817916 GCTGCTGGCCCTGCTGGAGGAGG + Exonic
1162937831 19:13990348-13990370 GCTGCTGGACCCCCTGCAGCTGG - Intronic
1163237320 19:16037314-16037336 CCTGCATGTGCTGCTGGAGCTGG + Intergenic
1163313841 19:16529774-16529796 GCTGCTGCTGCTGCTGGGCCAGG + Exonic
1163347091 19:16750079-16750101 GCAGCGGGTGCTCCTGGACCCGG + Exonic
1163364139 19:16866722-16866744 GTTGCTGGTTCTCCTAGGGCAGG - Intronic
1163420382 19:17210753-17210775 GCTGGAGGTGCTGCTGGAGGAGG + Exonic
1164156983 19:22602983-22603005 GCTGCTGGAGTTGCAGGAGCTGG + Intergenic
1164157001 19:22603080-22603102 GGGGCTGGGGCCCCTGGAGCTGG - Intergenic
1164391224 19:27822792-27822814 TTTGCTGGAGATCCTGGAGCCGG + Intergenic
1164869496 19:31631485-31631507 GCTGCTGGTGCCACTGAAGGGGG - Intergenic
1165120346 19:33554963-33554985 TCTGCTGAGGCTCCTGGGGCCGG - Intergenic
1165318790 19:35073792-35073814 CCTGCTGGTTCTCTTGGAGCAGG - Intergenic
1165575972 19:36818285-36818307 GCTGCTGCTGCTGCTGCTGCTGG + Exonic
1165854217 19:38870207-38870229 GGTGCTGGCGCCCCTGAAGCCGG - Exonic
1165953890 19:39489709-39489731 GCTGCTGCTCCTCCTGGGGTAGG - Exonic
1166331171 19:42078873-42078895 GCTCCTGGTGCTCCAGGAGCTGG - Exonic
1166748341 19:45152513-45152535 GCTGCTGCTGCTGCTGCAGCAGG + Exonic
1166853227 19:45770204-45770226 GCTGCTGCTGCTGCTGCTGCTGG - Exonic
1166978850 19:46621137-46621159 GCTGCTGTTTCTCCTGCGGCAGG - Exonic
1167070602 19:47220096-47220118 GCTCCAGGTGCTCCTCCAGCTGG + Intergenic
1167233073 19:48297500-48297522 GCAGGTGGAGCTCCAGGAGCAGG - Exonic
1167251006 19:48398437-48398459 GATGCTGCTGCTGCTGGCGCTGG + Exonic
1167265695 19:48482084-48482106 GCTGCTGCTGCTTCTGGGGGAGG - Intronic
1167288222 19:48610736-48610758 GCTGCTGGCGGTCCAGGAGCAGG + Exonic
1167353009 19:48987328-48987350 TCTGGTGGTGCTCCTGGACGTGG - Exonic
1167424530 19:49423273-49423295 GCTGCTGCTGCTGCTGCTGCTGG - Exonic
1167443684 19:49525055-49525077 GCTGCTGCTGCTGCTGCTGCGGG + Intronic
1167467158 19:49656381-49656403 ACTGATGTTGCTCCTGGAGTCGG + Intronic
1168269435 19:55241572-55241594 GCAGCTGGAGCTCCTGGCCCAGG - Exonic
1168642214 19:58038064-58038086 GATGCTGGAGCTGCTGGTGCTGG + Exonic
1168650633 19:58089985-58090007 GATGCTGGAGCTGCTGGTGCTGG - Exonic
1168687844 19:58359031-58359053 GATGCTGGAGCTCTTGGTGCTGG - Intronic
925191949 2:1892238-1892260 GCTGCTGGTGCTGCTGCTGCTGG + Exonic
925191952 2:1892244-1892266 GGTGCTGCTGCTGCTGGGGCTGG + Exonic
925765169 2:7226414-7226436 GCTGCTATTGCTCCTACAGCAGG + Intergenic
925997927 2:9307052-9307074 GCTGCTGGTGCAGCTGGCCCAGG - Intronic
927185590 2:20479934-20479956 GCTGCTGCTGCTGCTGCTGCTGG + Intergenic
927457036 2:23261782-23261804 GCTGCTGCTGCTGCTGCTGCTGG + Intergenic
927506994 2:23621176-23621198 GCTGCTGCTGCTGCTGCTGCTGG - Intronic
928193197 2:29193282-29193304 GCCGCTACTGCCCCTGGAGCTGG - Exonic
929231443 2:39564721-39564743 GCTGCTGCTGCTGCTGGTGGTGG + Intergenic
929779229 2:44947055-44947077 GGTGCTGGTGCTGCTGGGGATGG - Intergenic
931429216 2:62196092-62196114 GCGGCTGCTGCGCCTGGAACCGG + Exonic
933217105 2:79643392-79643414 GCTGCTGCTGCTGCTGGTTCAGG - Intronic
933776375 2:85773622-85773644 GCTGCTGGGGCTTCTGGATCTGG - Intronic
934098247 2:88627211-88627233 GCTGCTGCTGCTGCTGCTGCTGG - Exonic
934521863 2:95025037-95025059 GCTGGTGGTGGTGCTGGGGCAGG - Intergenic
934754640 2:96816625-96816647 GCTGGCGGTGCGCGTGGAGCCGG + Exonic
935318225 2:101859049-101859071 GCAGCAGCTGCTCCAGGAGCAGG + Exonic
935397053 2:102619902-102619924 GTTGCTGCTGCTCCTGCAGGTGG + Exonic
935623445 2:105148295-105148317 GCTCCTGGTGCTGCTGCTGCTGG - Intergenic
936450184 2:112628037-112628059 CCTGCTGATTCTCCTGGAGATGG - Intergenic
937011141 2:118563762-118563784 GGTGCTGCTGCTGCTGGTGCAGG + Intergenic
937022527 2:118671374-118671396 GCTGCTGTTGCTGCTGCTGCTGG + Intergenic
937244471 2:120483685-120483707 GAAGCTGGTGCTCCAGAAGCTGG + Intergenic
937253720 2:120540487-120540509 CCTGCTGCTTCTGCTGGAGCTGG + Intergenic
937644419 2:124250291-124250313 GCTGCTGGTGCTCCTGGTTGGGG + Intronic
937710887 2:124978719-124978741 TGTGATGGTGCTTCTGGAGCTGG + Intergenic
938131816 2:128722653-128722675 GCTGCAGGTGCTGCTGGTCCTGG + Intergenic
938181703 2:129190369-129190391 GTTGCTGGCGCTCCTGCTGCAGG - Intergenic
938341486 2:130539406-130539428 GCTGCCTGTCCTCCTGGAGCTGG - Exonic
938348344 2:130581303-130581325 GCTGCCTGTCCTCCTGGAGCTGG + Intronic
938698939 2:133859234-133859256 TCTGCTGTTCCTCCTGGGGCAGG + Intergenic
938922728 2:136009771-136009793 GCTGCTGCTGCTGCTGGTCCAGG + Intergenic
939894502 2:147775474-147775496 GATGCTGTTACTCTTGGAGCTGG - Intergenic
940453682 2:153871699-153871721 GCTCCAGCTGCTTCTGGAGCTGG - Intergenic
940561022 2:155297001-155297023 GTTGCTGGTGCTGCTGATGCAGG + Intergenic
940987291 2:160062364-160062386 GCTGCTGCTGCTGCTGCTGCTGG - Exonic
941264138 2:163338499-163338521 GCTGCTGCTGCTGCTGCAGGAGG - Intergenic
941264139 2:163338502-163338524 GCTGCTGCTGCTGCTGCTGCAGG - Intergenic
941819165 2:169827657-169827679 GCTGCAGGCGCTGCTGGAGCGGG + Exonic
942323703 2:174757523-174757545 GCGGAGGGTGCTCCTGGGGCAGG - Intronic
942364365 2:175208007-175208029 GGTGCTGGTGCTGCTGGTCCAGG + Intergenic
942713611 2:178865859-178865881 GCAGCTGGAGCTCCTTGAGGAGG - Exonic
942780594 2:179637293-179637315 GCTGCTGCTGGTCCTAGGGCAGG - Intronic
942791828 2:179769507-179769529 GCTGCTGTTGCTGCTGGGGCTGG + Exonic
943394637 2:187318733-187318755 GATGCTGATGCACCTGGACCAGG - Intergenic
943687570 2:190834907-190834929 TCTGCTGCTCCTCGTGGAGCAGG + Intergenic
943736884 2:191366039-191366061 GCTGCTGCTGCTGCTGGTCCAGG + Intronic
944402915 2:199348880-199348902 GATGCTGGTGAGCCAGGAGCCGG + Exonic
944513152 2:200484241-200484263 GCTGCTTGTGATACTAGAGCTGG - Intergenic
944743659 2:202635310-202635332 GCTGCTGCTGCTGCTTCAGCTGG - Exonic
944772956 2:202932642-202932664 GCTGCTGCTGCTGCTGCAACTGG - Intronic
945871937 2:215236464-215236486 GCTGCTTGGGCTGCTGGGGCAGG + Intergenic
946015822 2:216603150-216603172 GATGCTGGTGGTGCTGGGGCTGG - Intergenic
946291673 2:218750113-218750135 GCTGCTGCAGCTGCTGGGGCTGG - Exonic
946306629 2:218860073-218860095 GCTGCTGCTGCTCCTGTGCCCGG + Exonic
947118685 2:226796681-226796703 GCTGCTGCTGCTGCTGCTGCTGG + Exonic
947156231 2:227164774-227164796 CCTGCTGGTGCTCCTGGCGGCGG + Exonic
947579874 2:231308447-231308469 GCAGAGGGTGCTCCTGGAGGTGG + Intronic
947722585 2:232378820-232378842 GCTGCTGCTGCTGCTGCTGCTGG + Exonic
947748877 2:232522788-232522810 GCTCCTGGGGCTCCTGGGGCAGG - Exonic
947912912 2:233813272-233813294 GCTGCTGCTGCTGCTGCTGCTGG + Intronic
947912913 2:233813278-233813300 GCTGCTGCTGCTGCTGGTGATGG + Intronic
948084773 2:235238291-235238313 GGTGCTGATGCTGCTGGTGCAGG - Intergenic
948119164 2:235516073-235516095 GCTGCTGCTGCTGCTGCTGCTGG + Intronic
948127200 2:235572856-235572878 GCTGCGGGAGCTCCTGGTGTTGG + Intronic
948614006 2:239186727-239186749 TCTTCTGGTGCCCCAGGAGCTGG - Intronic
948617944 2:239213485-239213507 GCTGCTGTTGCTACTGCATCTGG + Intronic
948717547 2:239874989-239875011 GCTGCTGGACCTCGTGGACCTGG + Intergenic
948830328 2:240595460-240595482 TCTGCTGGTGCTCCCAGACCCGG + Intronic
949032401 2:241803236-241803258 GATGGGGGTGCTCCTTGAGCGGG + Intronic
1168855873 20:1008449-1008471 TCTTCTGGTGCTACTGGGGCTGG - Intergenic
1168958886 20:1854763-1854785 GCTGCTGCTGCTGCTGGTCCTGG - Intergenic
1169083964 20:2815679-2815701 GCTGCTGCTGCTCATGGGGCTGG + Exonic
1169900210 20:10545092-10545114 GCTGCTGGTACTCTGGGAACCGG + Intronic
1170028528 20:11918493-11918515 GACGCTGGTGCTGCTGGAGTTGG - Exonic
1170571752 20:17636654-17636676 GCAGCTGGTGGCCCGGGAGCAGG - Exonic
1170993784 20:21331573-21331595 GATGCTAGTGCTCCTGGTGAAGG + Exonic
1171009444 20:21500584-21500606 GACGCTGGTGCTGCTGGGGCAGG - Intergenic
1171953804 20:31443746-31443768 ACTGCTGCTGCTGCGGGAGCTGG + Intronic
1172414998 20:34757952-34757974 GTTGCTGCTGCTGCTGCAGCTGG + Exonic
1172522725 20:35578835-35578857 GCTGCAGGAGCTCCAGGGGCAGG - Intergenic
1172555851 20:35840651-35840673 GCTGCTGCTGCTGCTGCTGCTGG - Intronic
1172694951 20:36816085-36816107 GCTGAAGGTGCACCTGAAGCTGG - Exonic
1172705456 20:36879163-36879185 GCTGCTGGTGCTCAGGGACCAGG + Exonic
1172884810 20:38223739-38223761 GCTTCTGATGCACCTGGAGTTGG - Intronic
1172970933 20:38872627-38872649 GCTGCTGCTGCTGCTGGTCCAGG + Intronic
1172987124 20:39000684-39000706 GCTCCTGGGTTTCCTGGAGCAGG + Intronic
1173266867 20:41491735-41491757 CCAGCTGGTACTCCCGGAGCTGG + Exonic
1173617879 20:44414596-44414618 GCTGCTGGTTCTCGTTGAGTGGG + Exonic
1173819024 20:46008947-46008969 GGTCCTGGTGCTCCTGGTGCTGG + Exonic
1174172855 20:48627951-48627973 GCTCAGGGTGCTCCTGCAGCAGG + Exonic
1174709268 20:52687427-52687449 GATGCTGATGCTCCTGGTCCAGG + Intergenic
1175012383 20:55752717-55752739 GGTGCTGCTGCTGCTGGTGCTGG - Intergenic
1175247766 20:57591873-57591895 GCTGCTGGGGCGCCGGGAGGGGG + Intergenic
1175276367 20:57773896-57773918 GTCCCTGGAGCTCCTGGAGCTGG + Intergenic
1175362638 20:58425693-58425715 GCTGCTGCTGCTGCTGGCCCAGG - Intronic
1175381756 20:58568600-58568622 CCTGCTGGTGCTGCTGCAGGAGG + Intergenic
1175541040 20:59747813-59747835 GCTGCTGGAGATGATGGAGCAGG + Exonic
1175678155 20:60965038-60965060 GCTGCTGGGGCTGCTAAAGCGGG - Intergenic
1175771374 20:61626675-61626697 GCAGCAGGTGGTCCTGGAGCCGG + Intronic
1175872306 20:62214278-62214300 TCTCCTGGGGCCCCTGGAGCAGG + Intergenic
1175913197 20:62414261-62414283 GCTGCTGCTGGGCCAGGAGCAGG + Exonic
1176111728 20:63413998-63414020 GCTGCCGGTGCTCATGGTGCTGG - Intronic
1176170237 20:63693427-63693449 GCTGCTGGTGCTGGTGGTGGAGG - Intronic
1176171529 20:63698473-63698495 GCTGCTGGTGCGGCTGCTGCAGG + Exonic
1176201307 20:63861906-63861928 GCTGCTGCCGCTGCTGCAGCAGG + Exonic
1178279267 21:31266784-31266806 GCTGGGGGTGCTGCTGGATCGGG + Exonic
1179098251 21:38334887-38334909 GCTGCCGCTGCCCCTGCAGCTGG + Intergenic
1179192354 21:39134120-39134142 GGTGTTGGTGATGCTGGAGCTGG - Intergenic
1179820448 21:43934155-43934177 GGAGCTGGTGCTCGGGGAGCTGG - Intronic
1179889915 21:44330287-44330309 CCTGCTGCTGCTGCGGGAGCTGG - Exonic
1179974462 21:44856273-44856295 GCTGCTGCTGCTGCTGCAGGAGG - Exonic
1180061015 21:45385114-45385136 GGAGCTGGAGCTGCTGGAGCTGG - Intergenic
1180222749 21:46369851-46369873 GGTGCTGATGCTCCAGGAGCAGG - Intronic
1180249035 21:46567394-46567416 GCTGGTGGTGGTGGTGGAGCTGG + Exonic
1180614983 22:17120978-17121000 GGTGCTGGTGCTGCTGTCGCCGG + Exonic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1180841481 22:18960863-18960885 GCTGCTGGCGCGCCCTGAGCAGG + Intergenic
1181060009 22:20277931-20277953 ACTGCTGGTGCGCCCTGAGCGGG - Intronic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1181104307 22:20564628-20564650 GCTGCTGCTGCTGCTGCTGCTGG - Exonic
1181672198 22:24430905-24430927 GCTGCTGGTGGTGCTGGGCCTGG + Intronic
1181973498 22:26711557-26711579 GCTGCTGCTGCTACTGCAGCAGG - Intergenic
1182122981 22:27798959-27798981 GCTGCTGCTGCTGCTGTTGCAGG + Exonic
1183038409 22:35157920-35157942 GGTGCTGATGCTGCTGGATCTGG - Intergenic
1183103406 22:35598045-35598067 GCTGGTAGTCTTCCTGGAGCCGG - Intergenic
1183218736 22:36498121-36498143 GGTGGCGGTGCTCCAGGAGCCGG + Exonic
1183371667 22:37436000-37436022 GCTCCTGGTTCTCCTGCAGCAGG - Intergenic
1183411734 22:37658908-37658930 GCTGCTGGAGCGGCTGGCGCGGG + Exonic
1183721000 22:39561304-39561326 GCTTTTGGGGCTCCTTGAGCAGG + Intergenic
1183850888 22:40586896-40586918 GCTGCTGGTGCTGCTGGTGCTGG + Intronic
1184314188 22:43670863-43670885 GCTGCTGCTGCTGCTGCTGCTGG - Intronic
1184519747 22:44986379-44986401 GATGGTGGTGCTCCTGGTGATGG - Intronic
1184769367 22:46588696-46588718 GGTGCTGGGGCTCCTGGATCAGG - Intronic
1185059667 22:48599719-48599741 GCCCCTGGTTCTGCTGGAGCAGG + Intronic
1185298135 22:50064147-50064169 GCTGCTAGTGCTCCTGCTGCAGG - Exonic
1185341753 22:50294122-50294144 GCTGCCTGTGTTCCTGGAACAGG + Intronic
1185372085 22:50465638-50465660 CCTGCTTCTGCTACTGGAGCCGG + Intronic
1185391886 22:50566454-50566476 GCTCCTGGTGGTGGTGGAGCTGG - Intergenic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
950304241 3:11906015-11906037 GCTGCTGGTGCTCTGGGTGAAGG - Intergenic
950304601 3:11908232-11908254 GCTGCTGGTGCTCAGGGTGGAGG - Intergenic
950304633 3:11908390-11908412 GCTGCTGGTGCTCTGGGTGAAGG - Intergenic
950403271 3:12787632-12787654 GATCCTGCTGCACCTGGAGCTGG - Intergenic
950405513 3:12801870-12801892 GCTGCTGGTGATTCTGATGCTGG + Intronic
950408003 3:12816555-12816577 CCTGGTGGTGCTGCAGGAGCTGG + Exonic
950469184 3:13174110-13174132 GCTCTGGGTGCTCCTGGGGCAGG + Intergenic
950476023 3:13215359-13215381 GCTCCGTGTGCTCCTGGAGCAGG - Intergenic
950604244 3:14064355-14064377 GCTGCTGGGGCTGCTGCTGCTGG - Exonic
950604250 3:14064382-14064404 GCTGCTGGGGCTGCTGCTGCTGG - Exonic
950604313 3:14064811-14064833 GCTGCTGGGACTGCTGGTGCTGG - Exonic
950604318 3:14064841-14064863 GCTGCTGGGGCTGCTGCTGCTGG - Exonic
950912081 3:16605231-16605253 GCCTCTGCTCCTCCTGGAGCCGG - Intronic
951144661 3:19213145-19213167 GCTGCTTGTGCACATGGAACAGG + Intronic
951529181 3:23682754-23682776 GCTGCTGTTGCTGCTGCTGCTGG + Intergenic
951995198 3:28719745-28719767 GCTGCTGCTGCTGCTGCTGCTGG + Intergenic
953023953 3:39134244-39134266 GGTCCAGGTGCCCCTGGAGCAGG - Exonic
953627136 3:44580469-44580491 GCTGCTGCTGCTGCTGCTGCTGG + Intronic
953657025 3:44862131-44862153 GCTGTTGGTGCTGCTGCTGCGGG + Intronic
953748904 3:45595044-45595066 GCTGCTGCTGCTGCTGGAGGTGG - Exonic
954200551 3:49021098-49021120 GCCCCTGGTGCTCCGGGCGCTGG - Exonic
954388733 3:50258087-50258109 GCTGGAGGTGCACATGGAGCTGG - Intronic
954912269 3:54120843-54120865 GCACCTGGCGCTCCTGGAGAGGG + Intergenic
955246378 3:57228164-57228186 GCCGCTGGTGCTCGTGGGCCGGG + Intronic
955379395 3:58424778-58424800 GCTGCTGGTGGTGGTGGAGGTGG - Exonic
955778806 3:62462246-62462268 GCTGCTACTGCTGCTGAAGCTGG + Intronic
955916492 3:63912682-63912704 GCTGCTGCTGCTGCTGCTGCCGG - Exonic
956609967 3:71112592-71112614 GCTGCTGTTGCTGCTGAAGAAGG + Exonic
956801594 3:72764650-72764672 GATGCTGCTGCTCCTGGTCCAGG - Intronic
960687416 3:120307916-120307938 GCTGCTGCTGCTCCTGCTCCAGG - Intergenic
960688147 3:120314238-120314260 GCTGCTGCTGCTGCTGCAGCTGG + Intergenic
960933917 3:122883855-122883877 TCTGCTGGGGATCCTGGAGAGGG - Intergenic
961221637 3:125205635-125205657 GAGGCTTATGCTCCTGGAGCTGG - Intronic
961376115 3:126467199-126467221 GCAGATGGTGCTCCTGCCGCAGG + Intronic
961522631 3:127475815-127475837 GCTTCCTGTGCTCTTGGAGCTGG - Intergenic
961656550 3:128445603-128445625 GCTGCTGGTGGTGCTGGAGGTGG + Intergenic
961827451 3:129606516-129606538 GTTGCTGCTGCTCCTGGGGGCGG - Exonic
962425028 3:135262136-135262158 GCTGCTGATGCTGCTGGTCCAGG + Intergenic
962754710 3:138458717-138458739 GCTGCTGGGGCTGGTGGAGGTGG - Intronic
962844129 3:139260461-139260483 GCTGCTGGTTCTCCTAGAGGAGG - Intronic
963969722 3:151416308-151416330 GCTGCTGGGGCTGCTGCATCTGG - Exonic
964421548 3:156509386-156509408 GCTGCTGCTGCTGCTGCTGCTGG + Intronic
964421549 3:156509392-156509414 GCTGCTGCTGCTGCTGGTCCAGG + Intronic
964714923 3:159711950-159711972 GCTGCTGCTGCTGCTGCTGCTGG + Intronic
964720550 3:159764480-159764502 GCTGCTGCTGCTGCTGCTGCCGG - Exonic
964771194 3:160225701-160225723 GCTGCTGCTACTGCTGGCGCTGG + Exonic
967073793 3:185984095-185984117 GATGCTGGTGCTCCTGCTGCTGG + Intergenic
967328448 3:188266172-188266194 GCTGCTGCTGCTGCTGGTGAGGG - Intronic
968509606 4:989648-989670 GCTGCTGGTGCTGCTGGCGCTGG - Exonic
968548081 4:1208603-1208625 CCTGCTGGAACCCCTGGAGCAGG - Exonic
968725765 4:2247188-2247210 GATGCTGTGGCGCCTGGAGCTGG - Intergenic
968850557 4:3074876-3074898 GCTGCTGCTGCTGCTGCTGCTGG - Exonic
969321783 4:6417069-6417091 GCTGCCGGTGCTGCAGGACCTGG - Intronic
969485104 4:7467783-7467805 GCTGCTGTGGCTCCCGGAGCCGG + Intronic
969582320 4:8072483-8072505 GCTGTTGCTGCTGCTGGTGCAGG - Intronic
969662258 4:8537153-8537175 TCTGCTTGTGCTGGTGGAGCTGG + Intergenic
972144037 4:35999112-35999134 GATGCTGGTGCTTCTGGCTCAGG - Intronic
972773343 4:42218867-42218889 GCTGCTTGTTCTTCAGGAGCAGG + Intergenic
972871541 4:43306007-43306029 GCTGCTAATGCTGCTGGTGCAGG + Intergenic
973605100 4:52579065-52579087 GCTGCTGGTGCTGCTGGTGCTGG + Intergenic
973636416 4:52865448-52865470 GCTGCACGTGCTGGTGGAGCTGG - Exonic
975878392 4:78870928-78870950 GCTGCTGCTGCTGCTGCTGCTGG - Exonic
976085956 4:81407416-81407438 GCTACTGTTGATCCTGGAGGAGG - Intergenic
976161971 4:82211256-82211278 GCAGCTGGTACTCCAGGGGCAGG - Intergenic
977323676 4:95549163-95549185 GCTGCGGCTGCTCCTGCTGCTGG - Exonic
977536572 4:98261406-98261428 GCAGCTGGTGCTGCTGCAGGCGG - Intronic
977795348 4:101158237-101158259 GCTGGTGATGCACCAGGAGCAGG - Intronic
979378786 4:119983451-119983473 GTTCCTGGAGCTCCAGGAGCAGG - Intergenic
979632204 4:122916108-122916130 GCTGCTGCTGCTGCTGGTGGTGG - Intronic
979675182 4:123401953-123401975 ACTGCTGTTGCTCCCAGAGCTGG - Exonic
981331400 4:143513998-143514020 GCTGCTGTTGCTCCCGCCGCTGG - Exonic
981511964 4:145567037-145567059 GCTGCTGCTGCTGCTGCTGCTGG + Intergenic
982215600 4:153080295-153080317 GCTGCTGCTGCTACTGGTGCTGG - Intergenic
983309765 4:166044358-166044380 TCTCCTGGTGCTCCTGCTGCAGG - Intronic
983563193 4:169122166-169122188 GCTGCTGCTGCTGCTGGAATGGG - Exonic
985093822 4:186392083-186392105 GCTGCTGCTGCTGCTGCTGCAGG - Intergenic
985279452 4:188270835-188270857 GCTGCTGCTGCTGCTGGTGCTGG - Intergenic
985279453 4:188270841-188270863 GCTGCTGCTGCTGCTGCTGCTGG - Intergenic
985279457 4:188270868-188270890 GCTGCTGCTGCTGCTGCTGCTGG - Intergenic
985279461 4:188270895-188270917 GCTGCTGCTGGTGCTGGTGCTGG - Intergenic
985279462 4:188270901-188270923 GCTGCTGCTGCTGCTGGTGCTGG - Intergenic
985279468 4:188270940-188270962 GCTGCTGCTGCTGCTGGTGCTGG - Intergenic
985495132 5:199897-199919 CCTGCACCTGCTCCTGGAGCAGG + Exonic
985566343 5:620236-620258 GCTGCTGGAGCTTGGGGAGCAGG - Exonic
985636670 5:1039047-1039069 GCTGCTGTGGCTCCGGGACCAGG - Intergenic
986335147 5:6749134-6749156 GCTGCAGGTGCTGGTGGTGCTGG + Intronic
986350910 5:6878598-6878620 GCTGCTGGTGCTGTTGCATCTGG - Intergenic
986669149 5:10127527-10127549 TCTGCAGCAGCTCCTGGAGCTGG - Intergenic
987067318 5:14302969-14302991 GCTGTTGATGATCCTGGAGATGG + Intronic
988280194 5:29135250-29135272 GCTGGTGATGATCCTGGTGCTGG + Intergenic
989207376 5:38824476-38824498 GGTGCTGGTGGTGCTGGTGCTGG - Intergenic
989207377 5:38824482-38824504 GGTGCTGGTGCTGGTGGTGCTGG - Intergenic
989716323 5:44467844-44467866 GCTGCTGCTGCTGCTGCTGCTGG - Intergenic
990006841 5:50954073-50954095 GCTTTTGGAGTTCCTGGAGCAGG + Intergenic
991288849 5:65011249-65011271 GCTGCAGGTGCTCTTGAAGGTGG - Intronic
992151557 5:73909585-73909607 GCCGCTGCTCCTGCTGGAGCTGG - Exonic
992151584 5:73909735-73909757 TGTGCTGGTACTCCTGGAGCTGG - Exonic
992467008 5:77016047-77016069 GCTCAGGGTGCTCCAGGAGCAGG - Intergenic
992875318 5:81048695-81048717 GGGGATGGTTCTCCTGGAGCAGG - Intronic
993486232 5:88489623-88489645 GCTGCTGCTGCTGCTGCTGCAGG + Intergenic
994046370 5:95314906-95314928 GCTGCTGCTGCTGCTGGTCCAGG + Intergenic
995650388 5:114362289-114362311 GCTGCTGGTGCGCGAGGTGCGGG - Exonic
995650438 5:114362480-114362502 GCTGCTGCTGCTCGTCGCGCCGG + Exonic
995650484 5:114362703-114362725 GCTGGTGGTGCGCCGGGTGCGGG - Exonic
995696689 5:114885804-114885826 GCTGCTGCTGCTGCTGCTGCTGG - Intergenic
995727845 5:115201494-115201516 ACTGCTGCTGCTGCTGGAGAAGG - Intergenic
997759337 5:136429811-136429833 GCTACTGCTGCTACTGGAACTGG - Intergenic
998137245 5:139680555-139680577 GCTGCTGCTGCTACTGCCGCCGG - Exonic
998321532 5:141236525-141236547 GCTGCACGTGCTCCTGGTGGAGG + Intergenic
998461723 5:142314800-142314822 GCTGCTGCTGCTCACAGAGCTGG + Exonic
998508522 5:142691744-142691766 GCTGCTACTGCTCCTGGTCCAGG + Intronic
998903428 5:146878740-146878762 GCTGCTGCTGCTGCTGCTGCAGG + Intronic
998903429 5:146878743-146878765 GCTGCTGCTGCTGCTGCAGGAGG + Intronic
999252364 5:150190382-150190404 GCTGGGGGTGCACCTGGAGGAGG + Intronic
999970856 5:156861018-156861040 GCTGCTGCTGCTGCTGCTGCTGG - Intergenic
1000088239 5:157907409-157907431 GCTGCTGCTGCTGCTGGTTCAGG + Intergenic
1000907403 5:166979188-166979210 GCTGCTGCTGCTGCTGGTGGTGG - Intergenic
1000907405 5:166979194-166979216 GCTGCTGCTGCTGCTGCTGCTGG - Intergenic
1001700075 5:173700478-173700500 GATGCTGGTGCTGCTGGTCCCGG + Intergenic
1002047266 5:176549159-176549181 GCTCCTGGCGCTCCTGGGGCTGG - Intronic
1002252608 5:177939059-177939081 GCTGCTGGGGAGCCTGGAGCTGG + Intergenic
1002306314 5:178286017-178286039 GCTGGTCTTGCTCCTGGTGCTGG + Intronic
1002382291 5:178839493-178839515 GCTGCTGAGTGTCCTGGAGCAGG + Intergenic
1002427481 5:179184870-179184892 GAGGCCGGTGATCCTGGAGCTGG - Intronic
1002433560 5:179218215-179218237 GCTGCTGGTGCTCCAGGCTTTGG - Intronic
1002465442 5:179406044-179406066 CCTGCTGCTGCTGCTGGACCTGG + Intergenic
1002690707 5:181048069-181048091 GCTCCTGCTGCTCCTGGTACAGG - Exonic
1002717098 5:181234487-181234509 GCTGCTGGGGCAGGTGGAGCCGG - Exonic
1003398109 6:5770409-5770431 GCTGCTGCTGCTGCTGCTGCTGG + Intronic
1003624157 6:7727276-7727298 GCTGCTGCTCCTCCTGCTGCCGG - Exonic
1003964906 6:11243504-11243526 GCTGGGGGTTCCCCTGGAGCAGG - Intronic
1004273697 6:14216792-14216814 GCTGCCGCCGGTCCTGGAGCGGG + Intergenic
1004518900 6:16344036-16344058 GCTGCTGATGCTGCTGGTCCAGG + Intronic
1005835001 6:29702328-29702350 CCTGCTGCTGCTCCTGCAGGTGG - Intergenic
1006073765 6:31516172-31516194 CCTGCAGGTGCTCCTGGGCCTGG + Intergenic
1006860740 6:37170245-37170267 GCTGCTGCTGCTGCTGCTGCCGG - Exonic
1007241994 6:40432847-40432869 GCTGATGGTGTTCCTGGACAGGG + Exonic
1007423492 6:41733616-41733638 GTTGCTCGTGGTCCTGGGGCTGG + Intronic
1007576682 6:42929627-42929649 GCTGCTGCTGCTGCTGCTGCCGG + Exonic
1007584212 6:42978892-42978914 GCTGCTGCGGCTCCTGGCACTGG - Exonic
1007924639 6:45641415-45641437 CGTGCTGGTGGTCCGGGAGCTGG + Intronic
1008686467 6:53930881-53930903 GCTGCTGCTGCTACTGGTTCAGG + Intronic
1008716393 6:54295093-54295115 GCTGCTGCTGCTGCTGCTGCTGG - Intergenic
1011319051 6:86069720-86069742 GCTGCTGCTGCTGCTGTACCTGG - Intergenic
1011669675 6:89671038-89671060 CTTGCTGGTGCGCCTGGTGCCGG - Exonic
1011806281 6:91076071-91076093 GCTGCTGCAGCTCCTGCTGCTGG - Intergenic
1011941486 6:92848502-92848524 GATGCTGCTGCTCCTGGAAAAGG + Intergenic
1012247163 6:96938628-96938650 GCTGCTGCTGCTGCTGCTGCAGG - Intronic
1012400053 6:98835242-98835264 GCTGCTGATGCTGCTGCTGCAGG - Exonic
1012582827 6:100889840-100889862 GGTGCTGGGGGTCCTGGAGGTGG - Intergenic
1013464984 6:110410215-110410237 GTGGCTGGTTCTCCTGGACCAGG - Intronic
1014882705 6:126743293-126743315 GCTGCTGGGGATCCTCTAGCTGG + Intergenic
1015376143 6:132512828-132512850 GCCGCAGGCGCTCCGGGAGCTGG + Intronic
1015571062 6:134621905-134621927 GCTGCTGGAGCTCCCTGACCAGG - Intergenic
1017233217 6:152094503-152094525 GCCGCTGGTGCTGCTGCTGCAGG - Exonic
1017342852 6:153346478-153346500 GCTGGTGGTGATCATGGAGGTGG + Intergenic
1017672125 6:156778262-156778284 GCTGCTGCTGCTGCTGGAACTGG - Exonic
1017672126 6:156778268-156778290 GCTGCTGCTGCTGCTGCTGCTGG - Exonic
1018174454 6:161166897-161166919 GGTGCTGGGGCTCCTGCGGCTGG - Intronic
1018247810 6:161839278-161839300 GCTGAGGGAGCGCCTGGAGCTGG + Intronic
1018667950 6:166156548-166156570 GGTGCTGGTTCTGCTGGAGGAGG - Intergenic
1018903079 6:168060789-168060811 GCTGCGGCTGGTCCTGGGGCTGG + Exonic
1019352394 7:560764-560786 CGTGCTGGAACTCCTGGAGCTGG - Intronic
1020440901 7:8215409-8215431 GCTGCAGGAGCTCCTGGAAGGGG - Intronic
1021610644 7:22454673-22454695 GCTGCAGGTGCTGCAGGAGCTGG + Intronic
1022285814 7:28955904-28955926 GCTGCTGGTGCTCCTGGCCTTGG - Exonic
1022799401 7:33761399-33761421 GATGCTGATGCTGCTGGACCAGG + Intergenic
1022896091 7:34751625-34751647 GCAGCTGGTCCACTTGGAGCAGG - Intronic
1023353063 7:39339661-39339683 GGAGCTGGAGCTGCTGGAGCTGG - Exonic
1023353065 7:39339676-39339698 GCTGCTGCTGGAGCTGGAGCTGG - Exonic
1023353066 7:39339682-39339704 GCTGCTGCTGCTGCTGGAGCTGG - Exonic
1023353067 7:39339688-39339710 GCTGCTGCTGCTGCTGCTGCTGG - Exonic
1023865415 7:44235980-44236002 GCTGCTGCTGCTGCTGGGGTTGG - Intronic
1024002890 7:45202642-45202664 GGAGCTGGTGCTGCTGGGGCTGG - Intergenic
1024027958 7:45430264-45430286 GCGGGTGGTGCACCTGGAGAGGG + Intergenic
1024156359 7:46629697-46629719 GCTGCTGGTGGTCATGGCACAGG - Intergenic
1024259123 7:47560673-47560695 GCTGCTGTTGCCCCTGGAAAGGG - Intronic
1024279917 7:47710372-47710394 TCTGCTGGTGCTGCAGGAGTTGG - Intronic
1025610347 7:63071889-63071911 GCTGCAGGAGCTGCAGGAGCTGG - Intergenic
1026734545 7:72941376-72941398 GCTGCTGGTGTTCCCGGCCCAGG + Intronic
1026784879 7:73296284-73296306 GCTGCTGGTGTTCCCGGCCCAGG + Intergenic
1026905458 7:74060447-74060469 GGTGCTGGTGTTCCTGGACTTGG + Exonic
1026929510 7:74216014-74216036 GCTGCTGGTGCTGTTGGGGGTGG + Exonic
1026957642 7:74387771-74387793 GCTGCTTGGGCTCCTGGTGTGGG - Intronic
1027109198 7:75423646-75423668 GCTGCTGGTGTTCCCGGCCCAGG - Intronic
1027232990 7:76282764-76282786 GCGGCTGGAGCTCCAGGAGCGGG - Exonic
1027859831 7:83563479-83563501 GCTGCTGCTGCTGCTGTTGCTGG - Intronic
1028458958 7:91070250-91070272 GCTGCTGCTGCTGCTGCTGCTGG + Intronic
1028458960 7:91070256-91070278 GCTGCTGCTGCTGCTGGTGGTGG + Intronic
1028909523 7:96192440-96192462 GATTCTGGTGCTCCACGAGCAGG + Intronic
1029189354 7:98760830-98760852 GCTGCTGGTGCCCCTGCTGAGGG + Intergenic
1029506482 7:100966482-100966504 GCTGCTGGTGCTGCTGCTGCTGG + Exonic
1029506483 7:100966488-100966510 GGTGCTGCTGCTGCTGGCGCTGG + Exonic
1029537013 7:101163037-101163059 GCTCCTCCTGCTCCTGCAGCCGG + Exonic
1029595505 7:101535560-101535582 GCTGCTGGAGGCCATGGAGCTGG - Intronic
1029596036 7:101538066-101538088 GGCCCTGGTGCTCCTGGGGCTGG - Intronic
1029701402 7:102248846-102248868 GCTGCTGCTGCTGCTGTTGCTGG - Exonic
1030303127 7:107993857-107993879 CCTGCTGTTCCTGCTGGAGCAGG - Intronic
1030495184 7:110289829-110289851 GCTGCTGGTGCTGCTAGTTCAGG - Intergenic
1030861171 7:114631524-114631546 GCTGCTGCTGCTGCTGCTGCTGG - Exonic
1031020278 7:116620369-116620391 CCTGCTGATGATCCTGGAGCTGG + Intergenic
1031123043 7:117742912-117742934 GCTGCTGCCCCTCCTGGAGATGG + Intronic
1032125380 7:129189199-129189221 GCTGCTGCTGCTGCTGCTGCTGG + Exonic
1032731419 7:134646901-134646923 GCTGCTGCTGCTGCTGCTGCTGG + Exonic
1032848623 7:135773198-135773220 GATGCTGGTGCTGCTGGTTCAGG - Intergenic
1034166410 7:149028363-149028385 GCTCCTGCTGCTCTTGGGGCTGG - Exonic
1034225478 7:149477672-149477694 GGGCCTGCTGCTCCTGGAGCTGG + Exonic
1034546952 7:151795317-151795339 GCTGCTGGTCCTCGAGGAGACGG - Intronic
1034731177 7:153388779-153388801 GCTGCTGCTGCTCCTGGTGGAGG - Intergenic
1034849109 7:154477260-154477282 GGTGCTGGTGCTGCTGGTGGTGG - Intronic
1034908082 7:154968613-154968635 GTTGCTGCTGCTGCTGGAGCAGG + Exonic
1034937985 7:155211995-155212017 GAGGCTGGTGCTGCAGGAGCTGG - Intergenic
1035326807 7:158070919-158070941 GCTGGAGGTGCTCCTGGTGGTGG + Intronic
1035563765 8:627985-628007 CCTGCTGCTGCCCCTTGAGCTGG - Intronic
1035686672 8:1528482-1528504 GCTGCTGCTGCTCCTGGTGGAGG - Intronic
1036422129 8:8606885-8606907 GCTGCTGCTGCTGCTGCTGCTGG + Intergenic
1036592761 8:10183810-10183832 GCTGCTGCTGCTGCTGCTGCTGG + Intronic
1036645928 8:10611473-10611495 GCTGCCGGTGCTCCCACAGCTGG + Exonic
1037560810 8:20072991-20073013 GAGGGTGGTGCTCCTGGAGAGGG - Intergenic
1038145563 8:24892080-24892102 GCTGCTGGTTCCCCTGGAGCTGG + Intergenic
1038535725 8:28351703-28351725 GCTGCTGCTGCTGCTGCCGCAGG - Exonic
1039453978 8:37696168-37696190 GCTGCAGGTACTCCGGGTGCAGG - Exonic
1039913323 8:41841939-41841961 CCTGCTGTTGCTCCTGTTGCTGG + Intronic
1041167202 8:55102129-55102151 GCCGCTGCTGCTCCTGCTGCTGG + Intergenic
1042021090 8:64371769-64371791 GCTGCTGCTGCTACTGCAGGAGG - Intergenic
1042689452 8:71481736-71481758 GCTGCTGTTGCTGCTGCTGCTGG - Intronic
1043982409 8:86657627-86657649 GGAGCTGGGGCACCTGGAGCGGG + Intronic
1043982422 8:86657724-86657746 GCTGCAGGAGCTGCAGGAGCTGG - Intronic
1044443862 8:92250787-92250809 GCAGCTGGTGCTGCTGGTCCTGG + Intergenic
1044608031 8:94064052-94064074 GATGCTGTTGCTCCTGGTCCAGG - Intergenic
1044740093 8:95317296-95317318 GCTCCTGTAGCTCCTTGAGCAGG + Intergenic
1045183433 8:99811532-99811554 GCTGCTGATGCTGCTGGTCCAGG + Intronic
1046098007 8:109583086-109583108 GCTGCTGCTGCTGCTGGTGGTGG - Intronic
1046652488 8:116852561-116852583 GCTGCTGATGCTGCTGTTGCTGG + Exonic
1047532111 8:125686165-125686187 GCTGCTGCTGCTGCTGGTGGTGG - Intergenic
1047807232 8:128373165-128373187 GGTGTTGGTGCTGCTGGTGCAGG + Intergenic
1047807240 8:128373243-128373265 GCTGCTGGTGCTGTTGGTACTGG + Intergenic
1047807257 8:128373393-128373415 GCTGCTGGTGGTACTGGTGCTGG + Intergenic
1047807262 8:128373450-128373472 GGTGCTGGTGCTGCTGCTGCTGG + Intergenic
1047807293 8:128373702-128373724 GTTGCTGGTGCTGCTGGTGCTGG + Intergenic
1047807295 8:128373726-128373748 GTTGCTTGTGCTACTGGTGCTGG + Intergenic
1048274466 8:133055824-133055846 GCTGCTGCTGCTGCTGCTGCTGG - Intronic
1048697957 8:137049782-137049804 GCTGCTGGAGCTGCTGGAGCTGG - Intergenic
1048752627 8:137697375-137697397 GCTGCTGCTGCTGCTGCTGCTGG - Intergenic
1049003680 8:139841656-139841678 GATGCAGGAGCTCCTGGTGCAGG + Intronic
1049284838 8:141768988-141769010 GCTGATTGTGCCCCTAGAGCTGG + Intergenic
1049456418 8:142693310-142693332 TCTGCTGGGGAGCCTGGAGCCGG - Intergenic
1049466240 8:142752418-142752440 GCGGCTGGCGCTCCTGGCGCTGG - Exonic
1049535695 8:143180292-143180314 GCTGCTGCTGCTGCTGGTGGTGG - Intergenic
1049612509 8:143562068-143562090 GCTGCTGGAGGGCCTGGAGGGGG + Exonic
1049659300 8:143812615-143812637 GCAGCTGGTGGTGCTGGAGGGGG - Intronic
1049724215 8:144138027-144138049 GCTGCAGGCGCTGATGGAGCTGG + Exonic
1049788233 8:144461534-144461556 GCAGCCAGTGCTCCAGGAGCCGG - Intronic
1049923771 9:389586-389608 GCTGCTGCTGCTGCTGGTCCAGG - Intronic
1049923772 9:389592-389614 GCTGCTGCTGCTGCTGCTGCTGG - Intronic
1050567102 9:6896871-6896893 TCTTCTGGTGTCCCTGGAGCAGG + Intronic
1051502618 9:17794456-17794478 GCAGCTGTGGCTCCTGGAGCTGG + Intronic
1051757147 9:20414381-20414403 GCTGCTGCTGCTGCTGCTGCTGG + Exonic
1051890796 9:21940744-21940766 GATGATGGTGCACCTGGAGAAGG - Intronic
1052115919 9:24648662-24648684 GCTGCAGCTGCACCTGGAGAGGG - Intergenic
1052591198 9:30497838-30497860 GCTGCTGCTGCTACTGGTGCTGG - Intergenic
1053105370 9:35403885-35403907 CCTGCTGGTGCCCCTTGGGCCGG + Exonic
1053351457 9:37416097-37416119 GCTGCTGGTGGTGCTGCTGCTGG - Intergenic
1053732781 9:41074466-41074488 CCTGCTGCGGCTCCCGGAGCCGG + Intergenic
1054695644 9:68357088-68357110 CCTGCTGCGGCTCCCGGAGCCGG - Exonic
1054828712 9:69599656-69599678 ACTGCTGGTGCTACTGGTCCAGG - Intronic
1057135835 9:92687197-92687219 GCAGCAGGTGCTCCAGGAGTAGG - Intergenic
1057138951 9:92715318-92715340 GCGGCTGGAGCTGCTCGAGCTGG - Exonic
1057222751 9:93266698-93266720 GCAGGTGGTGCTCCTGGGGTTGG + Intronic
1057440567 9:95080055-95080077 GCTGCTGGTGCTCCTTCCTCAGG - Intronic
1057592802 9:96388302-96388324 GCTCCCGCTGCTCCTGCAGCCGG + Exonic
1057600119 9:96450420-96450442 GCTGCAGCTGCTGCTGGCGCCGG - Exonic
1057842935 9:98500814-98500836 GGTGCTGGTGTTACTGGTGCAGG - Intronic
1058619103 9:106864157-106864179 GCTGCTGCAGCTGCTGGTGCCGG + Intronic
1059119770 9:111631470-111631492 GCTGCTGGCGCCCCTGCTGCCGG + Exonic
1059780703 9:117523291-117523313 ACTGCTGGTGCTGCTGGTGAAGG + Intergenic
1060242700 9:121918137-121918159 GCTGCTGGAATTCATGGAGCAGG + Intronic
1060552330 9:124491517-124491539 GCTGCTGGTGCTGCTGGGCCTGG - Intronic
1060554259 9:124500254-124500276 GCAGCTGCTGCAGCTGGAGCCGG - Exonic
1061057933 9:128234017-128234039 GCCGCGGGTACTGCTGGAGCTGG - Exonic
1061062455 9:128257498-128257520 GCTGCTGGAGCTGCAGGAGCTGG - Exonic
1061208530 9:129177695-129177717 GCTGGTGGAGCTGGTGGAGCTGG + Exonic
1061208567 9:129177857-129177879 GCTGCTGTTGCTGCTGCTGCTGG + Exonic
1061208568 9:129177863-129177885 GTTGCTGCTGCTGCTGGCGCCGG + Exonic
1061433114 9:130543649-130543671 GCTGCTGCTGCTGCTGCTGCAGG + Intergenic
1061849346 9:133405292-133405314 GCTCCTTGATCTCCTGGAGCAGG - Exonic
1061898344 9:133660143-133660165 GGTGCGGGTACTGCTGGAGCGGG - Intergenic
1061917009 9:133760571-133760593 GCTGCTGGAGCTCCTGCCACAGG - Intergenic
1061920405 9:133779411-133779433 GCTGCTGCTGCTGCTGGGCCAGG - Intronic
1062252186 9:135603905-135603927 GCAGCTGGAGCTCCCGGGGCTGG + Intergenic
1062467393 9:136687306-136687328 GCTGCTGTTGCTGCTGCTGCTGG - Exonic
1062495593 9:136830124-136830146 GCTCCTGGTGCTCCGGGCACTGG - Intronic
1062497127 9:136837250-136837272 TCTGCTGCTGCTGCTGGGGCTGG - Intronic
1062707183 9:137952202-137952224 GCTGGGGGTGCTCCTGTGGCCGG + Intronic
1186785946 X:12956012-12956034 GCTTCTGCTGCTCCTGGTGCAGG - Intergenic
1187217011 X:17287002-17287024 GCTGCAAGTGCTTCAGGAGCAGG + Intergenic
1187320713 X:18235178-18235200 GCGGCTGCAACTCCTGGAGCTGG - Intergenic
1187472949 X:19585690-19585712 GCTGCTGCTGCTGCTGCTGCTGG - Intronic
1187701508 X:21968156-21968178 GCTGCTGGCCATCCTAGAGCAGG - Intronic
1187940702 X:24378068-24378090 GCTGCTGCTGCTGCTGGATCAGG + Intergenic
1188024890 X:25197936-25197958 GCTGCTGATGCTCCTCCAGTTGG - Intergenic
1190287691 X:48971748-48971770 GCTGTTGCTGCTCCTGCAGCGGG - Intergenic
1191081750 X:56519057-56519079 GCTGCTGCTGCTGCTGCTGCTGG - Intergenic
1192196580 X:69032809-69032831 GCTGCTGCTGCTCCCAGAGGTGG + Intergenic
1192457677 X:71290709-71290731 GCTGCTGGTGGTGCTGCTGCTGG - Exonic
1194193089 X:90860817-90860839 GCTGCTGTTGCTGCTGTAGTTGG - Intergenic
1194724828 X:97383299-97383321 GATGATGGTGGTCCTGGTGCTGG - Intronic
1194977292 X:100408561-100408583 GCTGCCGGTGCTGCTGCTGCTGG - Exonic
1195762001 X:108256639-108256661 GATGCTGATGCTCCTGGTCCAGG - Intronic
1195771770 X:108358913-108358935 GAGGGTGGTGCTTCTGGAGCAGG + Intronic
1195961221 X:110388743-110388765 GATGCTGATGCTCCTGGTCCAGG + Intronic
1196052797 X:111323132-111323154 ACTGCTGGTTTTCCTGGTGCAGG + Intronic
1196117579 X:112014135-112014157 GCTGCTGGTGCTGCTGGTCCAGG + Intronic
1196473677 X:116058315-116058337 GCTGCTGCTGCCACTGCAGCTGG - Intergenic
1199711253 X:150471046-150471068 GCTGCTGCTGCTGCTGTTGCTGG - Exonic
1200139754 X:153893905-153893927 GCTAGTGGTGCTGCTGCAGCAGG + Intronic
1200292628 X:154886881-154886903 GCAGCTGGGGCAGCTGGAGCTGG - Exonic
1200339472 X:155382621-155382643 GCAGCTGGGGCAGCTGGAGCTGG - Exonic
1200346998 X:155458072-155458094 GCAGCTGGGGCAGCTGGAGCTGG + Exonic
1200539704 Y:4443267-4443289 GCTGCTGTTGCTGCTGTAGTTGG - Intergenic
1201291525 Y:12425132-12425154 GATGCTGATGCTGCTGGACCAGG - Intergenic