ID: 920447045

View in Genome Browser
Species Human (GRCh38)
Location 1:206025422-206025444
Sequence CAGTGAAAGATCAACAAGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 191}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920447045_920447054 22 Left 920447045 1:206025422-206025444 CCCGTCTTGTTGATCTTTCACTG 0: 1
1: 0
2: 1
3: 14
4: 191
Right 920447054 1:206025467-206025489 AGGGCAGCTTGAGTCAGAAGTGG 0: 1
1: 0
2: 1
3: 31
4: 222
920447045_920447051 2 Left 920447045 1:206025422-206025444 CCCGTCTTGTTGATCTTTCACTG 0: 1
1: 0
2: 1
3: 14
4: 191
Right 920447051 1:206025447-206025469 GAGAGTGGTCTAAACCTAGAAGG 0: 1
1: 0
2: 0
3: 23
4: 738
920447045_920447052 3 Left 920447045 1:206025422-206025444 CCCGTCTTGTTGATCTTTCACTG 0: 1
1: 0
2: 1
3: 14
4: 191
Right 920447052 1:206025448-206025470 AGAGTGGTCTAAACCTAGAAGGG 0: 1
1: 0
2: 0
3: 7
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920447045 Original CRISPR CAGTGAAAGATCAACAAGAC GGG (reversed) Intergenic
902639500 1:17757700-17757722 CAGAAAAAGAACGACAAGACTGG + Intronic
903786606 1:25865376-25865398 GAATGAAAGAACAACATGACCGG + Intronic
905423610 1:37865499-37865521 GGGTGATAGATCAACGAGACTGG + Intronic
907792981 1:57685487-57685509 CAGTGTTAGATCAACAAGGTAGG + Intronic
908077488 1:60536325-60536347 CAGTGAAAGAGATACAGGACTGG + Intergenic
908386131 1:63643607-63643629 CAGTGGAAGACCAAGAGGACAGG + Intronic
910658980 1:89650448-89650470 CAGCCAAAAATCTACAAGACTGG + Intronic
911690437 1:100827086-100827108 GAGAGAAAGAACAAGAAGACGGG - Intergenic
912408626 1:109464515-109464537 GAGTTAAAGATTAACAAGGCTGG + Intergenic
915842864 1:159230300-159230322 CAATGAAATATCACAAAGACTGG - Intergenic
916757054 1:167782041-167782063 CAATGAAAGATCTGCAAGAGAGG - Intronic
918480465 1:184972592-184972614 GAGAGAAAGCTGAACAAGACTGG + Intronic
919713346 1:200750370-200750392 CACTGAAAGATCATCAAGTTTGG + Intronic
920149591 1:203894018-203894040 CATTGAAAGATTGAAAAGACTGG + Intergenic
920312837 1:205058601-205058623 CAGTGAAAGCTCATGAAGGCTGG + Exonic
920447045 1:206025422-206025444 CAGTGAAAGATCAACAAGACGGG - Intergenic
921322747 1:213958780-213958802 CAGTGCATGATAAACTAGACAGG - Intergenic
921512497 1:216049729-216049751 AATTAAAAGATCAACAAGCCAGG + Intronic
1064122234 10:12629886-12629908 CAGTGAATGAACAGCAAGAGGGG + Intronic
1064813781 10:19232821-19232843 CAGTGAAAGAGCAAGAAGCAGGG - Intronic
1065265128 10:23966688-23966710 CAGAGAAAGAGGAAGAAGACTGG + Intronic
1065658798 10:27983143-27983165 CCGTGAAAAATCAACAAACCTGG - Intronic
1066363690 10:34755827-34755849 TAATGACAAATCAACAAGACAGG + Intronic
1066364590 10:34764532-34764554 GAGTTACAGATAAACAAGACCGG + Intronic
1066532920 10:36359978-36360000 CAGTGAGAGATCAGAAATACAGG + Intergenic
1071491907 10:86141913-86141935 CAGTGACAGAACAAAAAGCCTGG - Intronic
1071592663 10:86889804-86889826 TAGTGAAAGACAAACAAGAGTGG - Intronic
1073674464 10:105629974-105629996 CAGTGAAAGAAAAAAAAAACAGG - Intergenic
1074407988 10:113196976-113196998 TATTAAAATATCAACAAGACTGG - Intergenic
1076424873 10:130360795-130360817 CAGTGCAAAATCCACAAGACTGG - Intergenic
1079427417 11:20356819-20356841 CAGTGAAGGAACAACCAGATGGG - Intergenic
1080175661 11:29359714-29359736 CAGTCACTGACCAACAAGACAGG - Intergenic
1080201572 11:29677589-29677611 CAGTGAAAAATAAAGAAGAGAGG + Intergenic
1080316982 11:30960322-30960344 CAGTGTAAGTTGAACATGACCGG - Intronic
1080914444 11:36641838-36641860 AATAGACAGATCAACAAGACAGG - Intronic
1081748295 11:45488371-45488393 CAGAGAAAGAGCTAGAAGACAGG + Intergenic
1082912977 11:58397482-58397504 CAGGGGAAGATCAGAAAGACTGG + Intergenic
1085372051 11:76018247-76018269 CAGTGGAAGACTAACAGGACAGG - Intronic
1085753216 11:79180676-79180698 CAGTTAAACATAAATAAGACTGG + Intronic
1085893943 11:80614365-80614387 TAGTGAGAGATGAACAAGACTGG - Intergenic
1085911067 11:80827426-80827448 CAGTGTAACATCAATAAGACTGG + Intergenic
1086332119 11:85764479-85764501 CAGTGAAAGATGAAAAATAGTGG - Intronic
1086365129 11:86101196-86101218 CATTGAAAGATCTCCTAGACTGG - Intergenic
1087425804 11:97984104-97984126 GAGTGAAAAATCACCAATACTGG + Intergenic
1089773513 11:120819956-120819978 CAGGGCAAAATCAACAAGACTGG - Intronic
1095449901 12:42319431-42319453 CAGTGAAAGATGAAGGAGATGGG - Intronic
1097043083 12:56167865-56167887 CAGTGAAAGATAAGCAACAGTGG - Intronic
1097201771 12:57284949-57284971 CAGTGAGAGCTCAACAAGACAGG - Intronic
1099767326 12:87004437-87004459 CAGAGACACATCAACAAAACAGG - Intergenic
1099918559 12:88927592-88927614 CAGTCCAAGATGACCAAGACAGG - Intergenic
1106765736 13:32911935-32911957 CAGAGAAAGATATACAAGTCTGG - Intergenic
1108293554 13:48988226-48988248 CAGTATTAGATCAACGAGACAGG + Intronic
1108820003 13:54336657-54336679 CAGTGAAAAAACAATAAAACAGG - Intergenic
1110504751 13:76272308-76272330 CAGAGAAAGATCAACAGGTGAGG - Intergenic
1111486304 13:88905376-88905398 CAGTGAAACAGCAACAAAACTGG - Intergenic
1111863843 13:93743209-93743231 CACTGAAAGGTCAAGTAGACAGG + Intronic
1114946496 14:27688312-27688334 CAGTGAAAAATTAACAACATGGG + Intergenic
1115759393 14:36563066-36563088 CATTTTAAGATCAACAAGAGGGG + Intergenic
1119976099 14:79025588-79025610 CAGGGAAAGATCAATATGCCAGG - Intronic
1122189779 14:100031995-100032017 CAGTGAAAAATGAATAAGAGTGG - Intronic
1122839389 14:104448192-104448214 CAGGGAAAGATCCACCAGAAAGG + Intergenic
1124682298 15:31743798-31743820 CATTGAAAGATTCATAAGACCGG + Intronic
1125057282 15:35376164-35376186 CAGACAAAGATGAACAAAACTGG - Intronic
1127236861 15:57062899-57062921 CAGTCAAGGATGAAAAAGACTGG + Intronic
1127249517 15:57216917-57216939 CAGTAAATCATCAACAAAACTGG - Intronic
1127872897 15:63088179-63088201 CAGTGAAAGAATGACAAGGCTGG - Intergenic
1128422376 15:67505943-67505965 CTGTCAAAGATAAATAAGACTGG + Intergenic
1130265564 15:82399148-82399170 TAGTGAGAGACCATCAAGACAGG + Intergenic
1130506445 15:84547745-84547767 TAGTGAGAGACCATCAAGACAGG - Intergenic
1131535707 15:93236042-93236064 CACTGAAAGATCACAATGACAGG + Intergenic
1133724640 16:8526147-8526169 AAGTGAAGGAGAAACAAGACGGG - Intergenic
1138284290 16:55796403-55796425 CAGTGAAAAAAAAACAAAACAGG + Intergenic
1138284712 16:55800584-55800606 CAGTGAAAAAAAAACAAAACAGG - Intergenic
1140869224 16:79091352-79091374 CAGTGAAAGAGCTTCAACACAGG - Intronic
1145925237 17:28642049-28642071 CAGTGAAAGCTCCACTAGGCAGG + Exonic
1146691109 17:34876773-34876795 CTGCCAAAGGTCAACAAGACAGG + Intergenic
1148219306 17:45850628-45850650 CAGTGCATGATGAACAAAACAGG - Intergenic
1149637157 17:58180181-58180203 CAGAAAAAGATCAACATGGCTGG + Intergenic
1154392606 18:13953396-13953418 CAGTGGAAGAACAACAATCCTGG - Intergenic
1155372880 18:25121655-25121677 CAGTGAAGGAACAACAGGAGGGG + Intronic
1155478195 18:26256464-26256486 CTGAGAAAAATCAACAAAACTGG - Intronic
1155530225 18:26759166-26759188 CAGTGGAAGAGGAACAAGTCTGG + Intergenic
1156240100 18:35245272-35245294 CAGTGAAACAGCAACAAAAGAGG + Exonic
1156823835 18:41405954-41405976 CATTGAAAGATCAAGAGGCCTGG - Intergenic
1158024334 18:52878030-52878052 CAGTGAAAGATCATGAATGCTGG - Intronic
1158752634 18:60281549-60281571 CAAAGAAAGACCAACAACACTGG - Intergenic
1160558469 18:79741104-79741126 CAGGGACAGATCAACCACACGGG - Intronic
1160558501 18:79741221-79741243 CAGGGACAGATCAACCACACGGG - Intronic
1161727474 19:5938332-5938354 CAGTGAAAGACCAAAAAGGCAGG + Intronic
1168329819 19:55561157-55561179 AAGAGAAAGAGAAACAAGACAGG + Intergenic
925923966 2:8657598-8657620 TAGTGACAGATGAAGAAGACGGG + Intergenic
930853102 2:55982803-55982825 CAGTGATAAATCCACAAGAACGG + Intergenic
931668922 2:64629454-64629476 CTGTCAAAGATAAACAACACAGG + Intergenic
931962026 2:67492930-67492952 CAGTGAAAGACCTAGAAGGCTGG + Intergenic
932053515 2:68421955-68421977 CAGTTAGAGATCTACAGGACTGG + Intergenic
932301386 2:70669688-70669710 CAGTGGAAGATCCACAAAGCAGG + Intronic
933677899 2:85074131-85074153 CTTTAAAAGATCAACAAAACTGG - Intergenic
934912639 2:98273608-98273630 AAGTGAAAGAGCAAGCAGACAGG - Intronic
936572985 2:113631736-113631758 CAGTGAAAGAATAAAAACACAGG - Intronic
937308673 2:120887862-120887884 CAGTGCTAGATCAATATGACAGG + Intronic
937654941 2:124364164-124364186 GAGTGAAAGAGCAACAAGAAAGG - Intronic
940381092 2:153015889-153015911 CAGTGAAAGAGAATAAAGACTGG - Intergenic
942641289 2:178063537-178063559 CAGGGAAGGATGAACTAGACAGG + Intronic
943111661 2:183613936-183613958 CAGGGAAAGATGAAGAACACTGG + Intergenic
943276605 2:185875959-185875981 CAGGGAAGGAGCAACGAGACTGG + Intergenic
943639381 2:190342740-190342762 CAGTGAGGAACCAACAAGACAGG - Intronic
944717218 2:202387124-202387146 CAATGAAAGTTGAGCAAGACAGG - Intronic
945768015 2:214004145-214004167 CTGTCAAAGATCAACAAAGCTGG + Intronic
948188497 2:236040659-236040681 CAGGGAAAGATCAAACAGATTGG - Intronic
948605354 2:239131482-239131504 CAGGGAAGGAGCAACAAGGCAGG + Intronic
1169538542 20:6574936-6574958 CAGGGAAACCTCAACAAGAAAGG - Intergenic
1177745575 21:25209121-25209143 CACTGAAAGGTCTACAAGTCAGG + Intergenic
1177786053 21:25672735-25672757 GAGAGAAAGAACAACAAGCCTGG - Intronic
1177857623 21:26417447-26417469 CAGGTTAAGAACAACAAGACAGG - Intergenic
1179287596 21:39991415-39991437 CAGTGAGAGGTCTTCAAGACTGG - Intergenic
1179943505 21:44654758-44654780 CACAGAAAGATCAACCAGACAGG - Intronic
1182613941 22:31573122-31573144 CAGTGAAACATCATCAGCACTGG + Exonic
1183287044 22:36973367-36973389 TAGAGAAAGATCTAGAAGACAGG - Intergenic
1184420150 22:44375860-44375882 CAATGAAACAACAATAAGACTGG + Intergenic
950879331 3:16310308-16310330 CATTGAACAATCAACAAGATAGG + Intronic
951866191 3:27310973-27310995 CAGTCAAAGATCAAAGAGAATGG - Exonic
952891600 3:38045729-38045751 CAGTGAAATATCAACAGCCCGGG - Intronic
953244194 3:41175897-41175919 CTGTGAAGGTTAAACAAGACAGG - Intergenic
956467286 3:69531919-69531941 CAGTAAAAGAGCAGCTAGACTGG + Intronic
959246630 3:103879172-103879194 CAGTGCCAGTGCAACAAGACTGG - Intergenic
959841171 3:110977602-110977624 CATTGACAGAAAAACAAGACTGG + Intergenic
962753837 3:138453421-138453443 CAGTGACAAACCAGCAAGACAGG + Intronic
964609777 3:158600110-158600132 AAGTCAAAGAACAAGAAGACTGG + Exonic
965512017 3:169578831-169578853 AAATGAAAGAGCAACTAGACAGG - Intronic
967254145 3:187572602-187572624 CAGTGAAGGGTAAAGAAGACAGG + Intergenic
967596851 3:191335733-191335755 CACTGATAAATAAACAAGACCGG - Intronic
970681362 4:18512253-18512275 CAGTGAAAGCTAAAAAAGAAGGG - Intergenic
971577173 4:28290410-28290432 CAGTGAGAGATCTACTATACAGG + Intergenic
971695224 4:29893393-29893415 CTTTGAAAGCTCAAAAAGACAGG - Intergenic
974161059 4:58139839-58139861 CAGTGAAATATAAAAAAGTCAGG - Intergenic
974382189 4:61155159-61155181 CAGTAAAAGAACAAAAAGAAAGG + Intergenic
977614374 4:99071615-99071637 CAGTGAAAGTACAACAACACAGG + Exonic
978120578 4:105074430-105074452 CAGAGACAGATCAGCCAGACAGG - Intergenic
978373239 4:108050318-108050340 CAGTGAAGGGACAAGAAGACTGG + Intronic
978373341 4:108050939-108050961 CAGTGAAGGGACAAGAAGACTGG - Intronic
978657100 4:111077138-111077160 CAGTGTTAGATCAATGAGACAGG + Intergenic
980600684 4:135020311-135020333 ATGTGAAGAATCAACAAGACTGG - Intergenic
980993888 4:139762423-139762445 GCTTGAAAAATCAACAAGACAGG - Intronic
981704368 4:147643464-147643486 CAGTGAAAGAGAAAAATGACAGG + Intronic
982627307 4:157784255-157784277 CAGTTAGAGATAAACAAGAGTGG + Intergenic
985959501 5:3289846-3289868 GAGTGACAGATCTGCAAGACAGG + Intergenic
990272139 5:54154243-54154265 CATTGAAAGATCAACTATTCGGG - Intronic
990657776 5:57976536-57976558 AAGTCAAAGATCTACAAGATGGG - Intergenic
991383116 5:66053658-66053680 CATGGAAAGATCAAAAACACAGG + Exonic
991521774 5:67506907-67506929 AAGTGAAAGATAAAGAAGATAGG + Intergenic
994657701 5:102614231-102614253 CACTGACAGATCATTAAGACAGG - Intergenic
996341308 5:122441741-122441763 CAGTGACAGAGCAAAAAGAGGGG + Intronic
999577590 5:152996955-152996977 CAGGGAAATCTCAATAAGACAGG - Intergenic
1000365213 5:160484437-160484459 CACTGATAGATCAGCAAGAATGG - Intergenic
1001312952 5:170624193-170624215 TAGTGAAAGAACAACAAAATAGG - Intronic
1005739883 6:28781150-28781172 CAATGACAAATCAACAATACTGG - Intergenic
1005750944 6:28881981-28882003 CAGAGAAAAATCAACAAAAAGGG + Intergenic
1006247784 6:32755454-32755476 CAGTGAAAGAGACACAAGAAGGG + Intergenic
1006275704 6:33003999-33004021 GAGTGAAAGATCAAGAATGCAGG + Intergenic
1007514001 6:42396843-42396865 CAGAGTAAGAACGACAAGACAGG + Intronic
1009287531 6:61839720-61839742 GGGTGAAAGATCAAGAACACAGG + Intronic
1009603526 6:65836129-65836151 CAGTGAAAGTACAACAACACAGG + Intergenic
1010657087 6:78524351-78524373 CAGTGAAATATCTACAGGATTGG + Intergenic
1010739990 6:79490046-79490068 AAATGGAATATCAACAAGACAGG + Intronic
1012628058 6:101428849-101428871 CAGTGGAAGAGCAGGAAGACAGG - Intronic
1013778475 6:113704529-113704551 GAGTGAGTGATCAACAATACTGG + Intergenic
1014982966 6:127966910-127966932 CATTGAAAGATAAACAAAAGGGG - Intergenic
1015000914 6:128214114-128214136 CAAACAAAGATGAACAAGACAGG + Intronic
1015620268 6:135124792-135124814 CAGAGAAAGATCAAGAAGTCAGG + Intergenic
1017740381 6:157400919-157400941 GAGACAAAGATCAATAAGACAGG - Intronic
1019786758 7:2982108-2982130 CAGCGAAAGATACACAAGTCAGG - Intronic
1019883106 7:3880735-3880757 CACTGAAAGACAAACCAGACGGG + Intronic
1020475155 7:8585545-8585567 CAATGTAAGAGCAGCAAGACTGG - Intronic
1020947477 7:14631168-14631190 CAGTGCTAGATCACCAAGATGGG + Intronic
1022320408 7:29282884-29282906 CAGAGAAAGATGAAAAAGATTGG + Intronic
1023263337 7:38379995-38380017 CAGAGAAGGAACAACAAGAGAGG + Intergenic
1027473790 7:78605060-78605082 CAGTGGAAGAGAAATAAGACTGG + Intronic
1028442766 7:90882522-90882544 ATGAGACAGATCAACAAGACAGG + Intronic
1029543183 7:101196527-101196549 CAAAGAAAGATCTAGAAGACAGG + Intronic
1030275985 7:107722257-107722279 AAGTGAAAGATCAGCAGGACTGG + Intergenic
1032784129 7:135187141-135187163 CAGTGGAACATCCACAAGAGTGG - Exonic
1035330467 7:158093478-158093500 CAGTGAACAAGGAACAAGACTGG - Intronic
1037397528 8:18458803-18458825 CACTGTAAGATCAAGAACACAGG - Intergenic
1039020580 8:33200788-33200810 CAGAGAAAGCTCACCAATACAGG - Intergenic
1040935061 8:52773845-52773867 CAGTGAAAGATTACCAAGGCCGG + Intergenic
1041648099 8:60274291-60274313 CAGAGCAACATGAACAAGACTGG + Intronic
1042202722 8:66296368-66296390 CATTGATAGAACAACTAGACAGG - Intergenic
1044553799 8:93540395-93540417 CAGTAAAAGAAAAAGAAGACAGG + Intergenic
1045070908 8:98503954-98503976 CAATATTAGATCAACAAGACAGG - Intronic
1045607355 8:103791998-103792020 AAGAGACAGATCAACGAGACAGG + Intronic
1045994537 8:108347381-108347403 CAGTGAAAGATAAATACAACAGG - Intronic
1049051446 8:140200123-140200145 AAGTTACAGATAAACAAGACAGG + Intronic
1050312923 9:4371588-4371610 CAGTGAGAGATCAGCAAGGAGGG - Intergenic
1050948349 9:11555144-11555166 TAGAGAAAAATCAACAAAACTGG - Intergenic
1052565544 9:30145329-30145351 CAGTGACAGATCATCAGGAATGG - Intergenic
1052740353 9:32386337-32386359 AAGTGAAAGAACGTCAAGACTGG - Intronic
1055003564 9:71481080-71481102 CAGTGAAATATGTACAAGAAAGG - Intergenic
1061803405 9:133125328-133125350 CAGTGAGAGGTGAACAAGAGTGG + Intronic
1186866686 X:13727181-13727203 CAATATCAGATCAACAAGACAGG + Intronic
1187666208 X:21612976-21612998 CAGTCAAAGGAAAACAAGACAGG - Intronic
1187969066 X:24641226-24641248 CAGTGAAAGATCAAGGGGCCAGG - Intronic
1190416410 X:50184475-50184497 GAGCTAAAGAGCAACAAGACAGG - Intergenic
1195246279 X:102998497-102998519 AAGTGTAAGATCAGCAAGACAGG - Intergenic
1197239095 X:124104222-124104244 AAGGCAAAGACCAACAAGACAGG + Intronic
1198992794 X:142535273-142535295 ATGTGAAAGATCTAGAAGACTGG - Intergenic
1199639300 X:149844665-149844687 AAATGAAACATCAACAAGTCAGG - Intergenic
1201673028 Y:16546411-16546433 CAATGACAAATCAACAAAACAGG + Intergenic