ID: 920447839

View in Genome Browser
Species Human (GRCh38)
Location 1:206033364-206033386
Sequence CCCTTTCTTTTAGCCCAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920447839_920447849 28 Left 920447839 1:206033364-206033386 CCTCACTGGGCTAAAAGAAAGGG No data
Right 920447849 1:206033415-206033437 CTGGAGGGGAGACTGTTTCTTGG No data
920447839_920447846 13 Left 920447839 1:206033364-206033386 CCTCACTGGGCTAAAAGAAAGGG No data
Right 920447846 1:206033400-206033422 ATTCCTTTCTGGAGGCTGGAGGG No data
920447839_920447842 2 Left 920447839 1:206033364-206033386 CCTCACTGGGCTAAAAGAAAGGG No data
Right 920447842 1:206033389-206033411 TGGTGAACTGCATTCCTTTCTGG No data
920447839_920447844 9 Left 920447839 1:206033364-206033386 CCTCACTGGGCTAAAAGAAAGGG No data
Right 920447844 1:206033396-206033418 CTGCATTCCTTTCTGGAGGCTGG No data
920447839_920447845 12 Left 920447839 1:206033364-206033386 CCTCACTGGGCTAAAAGAAAGGG No data
Right 920447845 1:206033399-206033421 CATTCCTTTCTGGAGGCTGGAGG No data
920447839_920447847 14 Left 920447839 1:206033364-206033386 CCTCACTGGGCTAAAAGAAAGGG No data
Right 920447847 1:206033401-206033423 TTCCTTTCTGGAGGCTGGAGGGG No data
920447839_920447843 5 Left 920447839 1:206033364-206033386 CCTCACTGGGCTAAAAGAAAGGG No data
Right 920447843 1:206033392-206033414 TGAACTGCATTCCTTTCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920447839 Original CRISPR CCCTTTCTTTTAGCCCAGTG AGG (reversed) Intergenic
No off target data available for this crispr