ID: 920447842

View in Genome Browser
Species Human (GRCh38)
Location 1:206033389-206033411
Sequence TGGTGAACTGCATTCCTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920447839_920447842 2 Left 920447839 1:206033364-206033386 CCTCACTGGGCTAAAAGAAAGGG No data
Right 920447842 1:206033389-206033411 TGGTGAACTGCATTCCTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920447842 Original CRISPR TGGTGAACTGCATTCCTTTC TGG Intergenic
No off target data available for this crispr