ID: 920448845

View in Genome Browser
Species Human (GRCh38)
Location 1:206041704-206041726
Sequence GTGAGGAATGCTATGATTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 100}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920448845 Original CRISPR GTGAGGAATGCTATGATTGC AGG Intronic
902571922 1:17352505-17352527 GTGAGGGATGCTGGGAGTGCAGG + Intronic
904616906 1:31754904-31754926 GTGAGGGCTGCTAGGAGTGCTGG - Intronic
911230683 1:95358099-95358121 GTGAGGAGTGCTCTGTCTGCAGG + Intergenic
912881252 1:113417701-113417723 GTGATAAATGCTATGAATGAGGG - Intronic
917324549 1:173818706-173818728 TTGAGGAAAGCTATGTGTGCTGG - Intronic
917969478 1:180197644-180197666 GTGAGGCAAGCCATGGTTGCTGG + Exonic
920448845 1:206041704-206041726 GTGAGGAATGCTATGATTGCAGG + Intronic
921910229 1:220540510-220540532 CTGAGGAATGCTCAGATAGCTGG - Intronic
1064582111 10:16805243-16805265 GTTACGTTTGCTATGATTGCTGG - Intronic
1065294917 10:24265127-24265149 GTGATGAGTGCTAAGATTACAGG + Intronic
1065907383 10:30269815-30269837 GTGAGGCATGCTCTGATGTCAGG + Intergenic
1070436566 10:76399551-76399573 TTCAGGAATGCTATGAAGGCTGG - Intronic
1073835468 10:107436148-107436170 CTGATGAATTCTATGATGGCTGG - Intergenic
1078577367 11:12513597-12513619 GTGGGGAAGGCTGAGATTGCTGG - Intronic
1086184110 11:83992774-83992796 GAGATGAATGCTAAGATTGTAGG + Intronic
1087933187 11:104001783-104001805 GTCAGGGAAGCTATGCTTGCTGG + Intronic
1094758868 12:33504506-33504528 GACAGCAATGCAATGATTGCAGG - Intergenic
1098745884 12:74236159-74236181 GTGTGGAATACTATGATGGTTGG - Intergenic
1100796786 12:98190431-98190453 CAGAGGAATGGTAGGATTGCAGG + Intergenic
1100864222 12:98838980-98839002 GTGAGGATTTCTAAGATTGCAGG - Intronic
1106706658 13:32287741-32287763 GTGAGCAATGCTAATACTGCTGG + Intronic
1109862131 13:68213676-68213698 GTGAGAAATGCTAAGGTTGTAGG - Intergenic
1114950426 14:27744455-27744477 GTCAAGAATCCTATGATTTCAGG + Intergenic
1115125917 14:29993678-29993700 TTAAGGAATGCTCAGATTGCTGG - Intronic
1118815140 14:69306952-69306974 GTGAGGAATGACATTATTGCAGG - Intronic
1120453893 14:84707107-84707129 GTGAGGAAATCTATGAATGGAGG - Intergenic
1125673101 15:41487374-41487396 GTGAGGAATGTTTTGGATGCAGG + Intergenic
1133501997 16:6375602-6375624 GTGTGGAATCATGTGATTGCTGG + Intronic
1135564984 16:23505148-23505170 GTGCTGAATTGTATGATTGCCGG - Intronic
1135764378 16:25164855-25164877 GTCAGGAGTACTAAGATTGCTGG - Intronic
1138118998 16:54383070-54383092 GGAAGGAATGCTATCATTGTAGG + Intergenic
1138700011 16:58852560-58852582 GTCAGGAAAGCTATGTTTTCAGG - Intergenic
1141039652 16:80661974-80661996 GTGGGGTATGTTGTGATTGCTGG - Intronic
1141266070 16:82498443-82498465 GTGAGGAAAGGCATGAATGCAGG - Intergenic
1142900635 17:3009356-3009378 GTGAGGAAGGCTATTATTTGGGG + Intronic
1144397643 17:14860708-14860730 GTGAGAAATGCTTAGCTTGCGGG - Intergenic
1147317814 17:39629205-39629227 GTGAGGAGTGCTCTGAGAGCCGG - Exonic
1150470169 17:65430637-65430659 TTCAGGAATGCCATGAATGCCGG - Intergenic
1151167668 17:72219265-72219287 GTGGGGAAGGCTAAGATTACAGG + Intergenic
1157970504 18:52262206-52262228 TTGAGGAATTCTTTGTTTGCTGG - Intergenic
1160213639 18:76906657-76906679 GTGACCAATGCTGTAATTGCGGG + Intronic
1162678039 19:12315181-12315203 GTGAGGAAGTCAATGATTTCAGG + Intergenic
1162681563 19:12347392-12347414 GTGAGGAAGTCAATGATTTCAGG + Intergenic
1163243673 19:16079021-16079043 GTGTGGAAGGCTTTGATTGCAGG + Intronic
1165497471 19:36161847-36161869 GTGTGGAATGCCATGATGGTGGG + Intergenic
1165500155 19:36182616-36182638 GTGAGAAACCCTATGAATGCAGG - Exonic
1165966994 19:39590286-39590308 CTGAGCAATGCTGTGTTTGCTGG - Intergenic
925367204 2:3318717-3318739 GTGAGGAGAACTCTGATTGCCGG - Intronic
937246370 2:120496696-120496718 GTGAGGAATGTGAGGTTTGCAGG + Intergenic
937800827 2:126078458-126078480 GTGTGGAATACCATGATTGCTGG - Intergenic
1172015112 20:31868936-31868958 GTGGGGAATGCAAAGCTTGCCGG + Intronic
1175175294 20:57108211-57108233 GTGAGAAATGCCATGGTGGCTGG - Intergenic
1176661874 21:9644449-9644471 GAGAGGAATCCCATGATTTCTGG + Intergenic
1178890814 21:36519851-36519873 GTGAGCAATGATCTGAATGCTGG - Intronic
1183579095 22:38712655-38712677 GTGAGGAATGTGATGCATGCTGG + Intronic
1185116995 22:48943625-48943647 GTGAGTAATGGTGTGATTTCAGG - Intergenic
951753092 3:26058860-26058882 ATGAAGAATGCTATTCTTGCAGG + Intergenic
952259215 3:31723364-31723386 GTGAGGAAGGCTATGGTCCCGGG + Intronic
954028893 3:47803731-47803753 GTGAGGTATTCTTTGTTTGCTGG + Intronic
954940793 3:54370874-54370896 GGGAGGAATGCTGAGATTGAAGG - Intronic
956520796 3:70101735-70101757 ATGAGGAATTCTATAATTCCAGG - Intergenic
957187910 3:76966698-76966720 GTGAGAATAGCAATGATTGCAGG - Intronic
957386738 3:79505860-79505882 GTGAGGTATGCTTTGAATGATGG + Intronic
958259188 3:91359893-91359915 GTGATTAATGCTATTATTACAGG - Intergenic
958981588 3:100726444-100726466 GTGAGGAATGCCTAGATGGCTGG - Intronic
960358051 3:116677863-116677885 GAAAGGAATGCTATGTCTGCAGG - Intronic
960811188 3:121628944-121628966 TTGAGGACTGCTAGGACTGCTGG - Exonic
965195949 3:165594640-165594662 GTGAAGAATTCAATGATTACTGG + Intergenic
966785839 3:183621948-183621970 GTGAGAAATGTTATGATAGCAGG + Intergenic
970320954 4:14874930-14874952 GTGAGAAATGCTATAACTCCTGG + Intergenic
971786562 4:31111073-31111095 GTGAAGAATACTGTGATTGAGGG + Intronic
973098718 4:46234664-46234686 TTGAGGAATGCTATAATTTTAGG + Intergenic
975457483 4:74609269-74609291 GTGAGCAAAGGTATGACTGCAGG - Intergenic
992290548 5:75275030-75275052 GTGAGGTTTGCAAGGATTGCCGG - Intergenic
992609521 5:78495180-78495202 GTGAGGGATGCTAGGAATGGAGG + Intronic
995424931 5:112010489-112010511 GTAAGGAATGCTGTAATTGCTGG + Intergenic
997002933 5:129784078-129784100 GTAAGGAAAGCAATGATTGTGGG + Intergenic
998601078 5:143585699-143585721 ATGAGAAATGCTAAGATTGCTGG + Intergenic
998641810 5:144020311-144020333 TTCAGGAATGCCATGATTGGAGG + Intergenic
1003653051 6:7978972-7978994 CTGAGGAAGGCCATGAATGCAGG - Intronic
1004587024 6:17012574-17012596 GTAAGGAATGCTAAGAGAGCTGG - Intergenic
1007151673 6:39699246-39699268 GTGAGGAATGCCATGGTGGTTGG + Intronic
1009184596 6:60559476-60559498 GTGATTAATGCTATTATTACAGG + Intergenic
1009899477 6:69794258-69794280 GTGAAGAATACAATGATTACTGG - Intronic
1013548643 6:111185420-111185442 GTGAAGCATGCTCTGAGTGCTGG - Intronic
1016114705 6:140265675-140265697 GTGAAGTCTGATATGATTGCAGG + Intergenic
1017906955 6:158763262-158763284 GTGTGGATGGCAATGATTGCAGG + Intronic
1022098697 7:27156700-27156722 GTGAGGACTGCTGAGATTGGCGG - Intronic
1022345299 7:29508793-29508815 GTGAGAAGTGCCATGAGTGCAGG + Intronic
1023471165 7:40521756-40521778 GGGATGAATACTATGATTGCTGG + Intronic
1026583585 7:71637789-71637811 GTGAGCAGTGCTAATATTGCTGG + Intronic
1029874009 7:103729096-103729118 GTTAGGAATGTAATGATTGTAGG - Intronic
1032242096 7:130170734-130170756 GTGAGGAATGCTATGAGAGGAGG + Intronic
1032873457 7:136011385-136011407 GTGAGGCATGCTATTATCTCTGG + Intergenic
1033543652 7:142380534-142380556 ATGAGGAATTATATCATTGCAGG + Intergenic
1038493736 8:27987535-27987557 GTGAGGATTCCTTTGATGGCAGG - Exonic
1038660867 8:29495508-29495530 GCAAGGAATGCTAAGGTTGCTGG + Intergenic
1041253254 8:55955182-55955204 GTGAGCAAGGCTATGATCCCAGG - Intronic
1045120764 8:99031743-99031765 GTGAGGAATGCTAGGCAGGCTGG + Intronic
1046727919 8:117694622-117694644 GTGAGGAGAGCTAAGATTTCTGG + Intergenic
1046752344 8:117939150-117939172 GTTATGAATGCTATTATTGATGG - Intronic
1047725689 8:127682229-127682251 TTGGGGAATGATATGAGTGCAGG + Intergenic
1054771317 9:69086732-69086754 GTGAAGAATGGGATCATTGCAGG - Intronic
1056048431 9:82743295-82743317 ATGAGGGATGCTAAGATAGCTGG - Intergenic
1057846160 9:98526316-98526338 GTCAGGAAGGCTATGATGACTGG - Intronic
1058705582 9:107635569-107635591 GTTGGGAATGCTATGGTGGCAGG + Intergenic
1059717682 9:116929009-116929031 GTGAGGAATGCCAGAAATGCAGG - Intronic
1203639436 Un_KI270750v1:146292-146314 GAGAGGAATCCCATGATTTCTGG + Intergenic
1186551738 X:10513409-10513431 GAGGGGAATGGAATGATTGCAGG - Intronic
1198155959 X:133961112-133961134 GTGGGGAAAGTGATGATTGCTGG + Intronic