ID: 920449398

View in Genome Browser
Species Human (GRCh38)
Location 1:206047806-206047828
Sequence CCTAGGATGCAGAAGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920449398_920449404 2 Left 920449398 1:206047806-206047828 CCTCCCTCCTTCTGCATCCTAGG No data
Right 920449404 1:206047831-206047853 ACAGCCTTCCTTTCACCCTCAGG 0: 1
1: 0
2: 3
3: 19
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920449398 Original CRISPR CCTAGGATGCAGAAGGAGGG AGG (reversed) Intronic
No off target data available for this crispr