ID: 920449404

View in Genome Browser
Species Human (GRCh38)
Location 1:206047831-206047853
Sequence ACAGCCTTCCTTTCACCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 239}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920449395_920449404 25 Left 920449395 1:206047783-206047805 CCTCTGTCTTCCCAGGTTCTGTT 0: 1
1: 0
2: 9
3: 38
4: 457
Right 920449404 1:206047831-206047853 ACAGCCTTCCTTTCACCCTCAGG 0: 1
1: 0
2: 3
3: 19
4: 239
920449398_920449404 2 Left 920449398 1:206047806-206047828 CCTCCCTCCTTCTGCATCCTAGG No data
Right 920449404 1:206047831-206047853 ACAGCCTTCCTTTCACCCTCAGG 0: 1
1: 0
2: 3
3: 19
4: 239
920449397_920449404 14 Left 920449397 1:206047794-206047816 CCAGGTTCTGTTCCTCCCTCCTT 0: 1
1: 0
2: 6
3: 85
4: 865
Right 920449404 1:206047831-206047853 ACAGCCTTCCTTTCACCCTCAGG 0: 1
1: 0
2: 3
3: 19
4: 239
920449394_920449404 26 Left 920449394 1:206047782-206047804 CCCTCTGTCTTCCCAGGTTCTGT 0: 1
1: 2
2: 3
3: 49
4: 471
Right 920449404 1:206047831-206047853 ACAGCCTTCCTTTCACCCTCAGG 0: 1
1: 0
2: 3
3: 19
4: 239
920449396_920449404 15 Left 920449396 1:206047793-206047815 CCCAGGTTCTGTTCCTCCCTCCT 0: 1
1: 0
2: 2
3: 51
4: 593
Right 920449404 1:206047831-206047853 ACAGCCTTCCTTTCACCCTCAGG 0: 1
1: 0
2: 3
3: 19
4: 239
920449402_920449404 -5 Left 920449402 1:206047813-206047835 CCTTCTGCATCCTAGGTGACAGC 0: 1
1: 0
2: 1
3: 13
4: 215
Right 920449404 1:206047831-206047853 ACAGCCTTCCTTTCACCCTCAGG 0: 1
1: 0
2: 3
3: 19
4: 239
920449400_920449404 -1 Left 920449400 1:206047809-206047831 CCCTCCTTCTGCATCCTAGGTGA 0: 1
1: 0
2: 1
3: 21
4: 230
Right 920449404 1:206047831-206047853 ACAGCCTTCCTTTCACCCTCAGG 0: 1
1: 0
2: 3
3: 19
4: 239
920449401_920449404 -2 Left 920449401 1:206047810-206047832 CCTCCTTCTGCATCCTAGGTGAC 0: 1
1: 0
2: 2
3: 12
4: 185
Right 920449404 1:206047831-206047853 ACAGCCTTCCTTTCACCCTCAGG 0: 1
1: 0
2: 3
3: 19
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920449404 Original CRISPR ACAGCCTTCCTTTCACCCTC AGG Intronic
900142901 1:1145928-1145950 ACTGCCTTCCTGGCACCCTCTGG + Intergenic
901045658 1:6393948-6393970 ACAGCCTTCCATTCTCTCTTAGG - Intronic
902777640 1:18684845-18684867 TCAGCCTCCCTCACACCCTCCGG - Intronic
903374814 1:22859223-22859245 AATGCCTTCCCTTCACCATCAGG - Intronic
905957744 1:42013094-42013116 ACATCCTTCCTTCAGCCCTCGGG - Intronic
906687122 1:47769951-47769973 ACAGCCTTGCTTTCTGCCTTGGG - Intronic
907451216 1:54547159-54547181 ACAGCCTTCCTTCCATCCTCAGG - Intronic
908966674 1:69773412-69773434 ACAGCATTTCTTTCACACACTGG - Intronic
909227785 1:73046798-73046820 TCAGCCTTCTCTTCTCCCTCAGG - Intergenic
909923286 1:81407824-81407846 ACAGCCCCCCTTCAACCCTCTGG - Intronic
910810932 1:91235590-91235612 ACAGCCTTCATTTTTCACTCAGG - Intergenic
911652124 1:100401705-100401727 ACAGCCATCCTTGCAGTCTCAGG + Intronic
912441727 1:109704137-109704159 ACAGCTTTCCTCTCCCACTCGGG + Intronic
912681260 1:111730407-111730429 ATATCTTTCCTTCCACCCTCAGG + Intronic
914336070 1:146715998-146716020 TCAGATTTCCTTTTACCCTCAGG - Intergenic
914869269 1:151459306-151459328 GGAGGCTTCCTTTCACCCTTGGG - Exonic
915130347 1:153691458-153691480 GCAGCCTTTCTTTCACCATAAGG - Intronic
915173750 1:153997491-153997513 ACAGCCTTTCTTTCTCACTCAGG + Intronic
916217275 1:162408266-162408288 ACAACATTTCATTCACCCTCAGG - Intronic
917503192 1:175604437-175604459 TCAGCCTTCCTTTCACAGTTGGG + Intronic
917906646 1:179592002-179592024 CCTGCCTTCCTTTCCACCTCAGG + Exonic
918108273 1:181432032-181432054 TCAGGCTTCCTTTTGCCCTCAGG - Intronic
918123160 1:181557351-181557373 ACAGCCTTTGTTTTGCCCTCTGG + Intronic
918534479 1:185558863-185558885 ATAGCCTTTCTTTCAACCTTAGG - Intergenic
919931922 1:202226656-202226678 AAAGCCTTCCTGCCACCCCCAGG + Intronic
920183711 1:204147842-204147864 ACAGCCTTCCTCTCTCACCCAGG - Intronic
920449404 1:206047831-206047853 ACAGCCTTCCTTTCACCCTCAGG + Intronic
920670594 1:208001233-208001255 TCAGCCTTCCTCTTGCCCTCTGG + Intergenic
920706532 1:208255199-208255221 ACAGCCTTATTTTCCTCCTCTGG + Intergenic
921601367 1:217110060-217110082 TCAGCCTTCTTTTCATCATCTGG + Intronic
921925616 1:220707984-220708006 ACAGCCTTCCTTTCCTCCAGAGG - Intergenic
922769937 1:228176292-228176314 ACAGCCTCCTGTTCACCCACTGG + Exonic
923836482 1:237616681-237616703 CCAGCCTCCCTTTCAGCCACAGG - Intronic
923962164 1:239097966-239097988 ACAGGCTTTCTTTCTCACTCAGG - Intergenic
1063700335 10:8378349-8378371 ACAGCCTGCCTTTCCCCCTCTGG + Intergenic
1066012393 10:31206905-31206927 ACAGTTCTCCTTTCACTCTCAGG - Intergenic
1066222251 10:33346634-33346656 ACATTCTTCCTTTCCCCCTGAGG + Intergenic
1066278086 10:33888203-33888225 TCAGCCTTCATTTCACCATCAGG + Intergenic
1067171090 10:43906554-43906576 ACAGCCTCCCTCTTCCCCTCTGG - Intergenic
1067223009 10:44357374-44357396 ACAGGCTCCCTCTCACCCTGTGG + Intergenic
1067789206 10:49275080-49275102 ACAGGCTGCATTTGACCCTCAGG - Intergenic
1070620139 10:78003356-78003378 AGAGCCTTTCTTCCACACTCAGG + Intronic
1074022874 10:109602459-109602481 AAAGCCCCACTTTCACCCTCAGG - Intergenic
1075051759 10:119187477-119187499 TCAGCCTTCCTTTCCTTCTCTGG + Intergenic
1075493648 10:122898700-122898722 ACAGACTTCCTTACACTTTCTGG - Intergenic
1076245954 10:128948046-128948068 ACAACCCTCCTTGCACCCACTGG - Intergenic
1078390474 11:10931762-10931784 TCCGCCTTCCTCTCTCCCTCCGG - Intergenic
1079107304 11:17579718-17579740 ACAGCCTGCCTCTCAGCCTGAGG + Intronic
1079478494 11:20857118-20857140 ACAGCTTCCCTCTCTCCCTCTGG - Intronic
1080744963 11:35100606-35100628 ACAGCCTTCCTCTCACCCCTGGG - Intergenic
1082072589 11:47950986-47951008 AATGCCTTCCTTTTTCCCTCAGG + Intergenic
1082817934 11:57522681-57522703 AAAGGCTTCCTGTGACCCTCGGG + Intergenic
1083608450 11:63993023-63993045 CCTGCCTCCCCTTCACCCTCTGG - Intronic
1084236728 11:67792440-67792462 ACTGCCGTCATTTCACCTTCTGG - Intergenic
1084388016 11:68856125-68856147 ACACCCTTCCACTCCCCCTCTGG + Intergenic
1084415650 11:69031483-69031505 ACAGCCTTCCTTCCACTTGCAGG - Intergenic
1084835692 11:71800532-71800554 ACTGCCTTCATTTCAGCTTCCGG + Exonic
1085654892 11:78304980-78305002 AAAGCCTTCCTTACTCTCTCTGG + Intronic
1085996105 11:81916118-81916140 ACACCCTGCCTTTCACTATCTGG + Intergenic
1087882897 11:103439682-103439704 GCAGCCTTGCATTCACTCTCTGG + Intronic
1090091565 11:123702768-123702790 ACAGCATTTCTGTCACTCTCTGG - Intergenic
1090379781 11:126318405-126318427 CCAGCCTTCCCTCCACCCTCTGG + Intronic
1090413417 11:126524492-126524514 AAATCCTTCTTTTCTCCCTCCGG + Intronic
1090799564 11:130161797-130161819 AGAGCCTTCCCTTCACCCATGGG - Intronic
1091024498 11:132129975-132129997 ACAGCCTTCCTCTTTCTCTCTGG + Intronic
1091168134 11:133498506-133498528 CCAGCCTTCCTCGCACCATCTGG + Intronic
1091719998 12:2805981-2806003 ACAGTCCTCCATTCACCCTCAGG - Intergenic
1092367209 12:7886673-7886695 ACAGTCTTCCTTCCTTCCTCTGG - Intronic
1094300728 12:28962271-28962293 TCAGCCTTTTTTTCTCCCTCTGG - Intergenic
1094509654 12:31088642-31088664 TCAGCCTTCCTTTTTCCCTTTGG + Intronic
1095491130 12:42734750-42734772 GCAGCATTCCCTTCACTCTCTGG + Intergenic
1097806116 12:63966846-63966868 ACTGTCTTCCTTTTAGCCTCTGG + Intronic
1103175863 12:118862590-118862612 ATAGACTTCTATTCACCCTCTGG + Intergenic
1103369089 12:120404555-120404577 AGAGCCTTCTTGTCACCCTGGGG + Intergenic
1104742420 12:131188393-131188415 CCAGGCTTTCCTTCACCCTCAGG + Intergenic
1106236190 13:27862492-27862514 ACTGCCTTTCTCTGACCCTCTGG - Intergenic
1107580611 13:41780152-41780174 ACAGCCCTCCCTCAACCCTCAGG - Intronic
1112455108 13:99553217-99553239 ACAGTCTTTCTTTTACCCTGTGG - Intronic
1113735560 13:112676558-112676580 ACATCCCTCCTGTCACCCTTTGG - Intronic
1113926858 13:113946605-113946627 AGTGCCCTCCTTTCACCCTGGGG - Intergenic
1115999000 14:39223211-39223233 ACACCCATCCTTTTACACTCAGG - Intergenic
1118780198 14:69002930-69002952 ACCTCTTTCCTTCCACCCTCAGG + Intergenic
1119105474 14:71919297-71919319 ACAGCCTTCCTCTAACTCTAGGG + Intergenic
1119184477 14:72630175-72630197 ATAGCCTCCCTTGCACCCTAAGG - Intronic
1121035714 14:90701627-90701649 ACATCCTTCCTTTCAACCTCTGG + Intronic
1121569354 14:94935952-94935974 ACAACCTTCTCTTCCCCCTCTGG + Intergenic
1125753983 15:42049791-42049813 ACAGCATTCCTCTGCCCCTCTGG - Intronic
1128865351 15:71110949-71110971 ACAGCCTCCCTTTCTTCTTCCGG - Exonic
1130222245 15:82029417-82029439 GCAGCCATCCTTTGACCCTGAGG + Intergenic
1131465343 15:92650527-92650549 ACAACGTTCCTTTCATCCTGGGG - Intronic
1132931910 16:2462924-2462946 TCAGCCTTCCTCTCCTCCTCAGG + Intronic
1133097037 16:3454350-3454372 TCATGCCTCCTTTCACCCTCTGG - Intronic
1137002869 16:35246483-35246505 ACAACCTCCCTTGCACCTTCAGG + Intergenic
1137597888 16:49737004-49737026 ACAGCCTCCCCTACACCCTGAGG + Intronic
1139236048 16:65340609-65340631 AGAGCCTTACTTTCACCTTTTGG + Intergenic
1139997552 16:70995221-70995243 TCAGATTTCCTTTTACCCTCAGG + Intronic
1141409998 16:83826555-83826577 ACATCCTTCCTTACAGCCTTGGG - Intergenic
1141440299 16:84025725-84025747 ACAGCTGTCCTCTCACCCCCAGG + Intronic
1144887927 17:18476688-18476710 ACACCCTACCTTTCTCTCTCTGG + Intergenic
1145144281 17:20467613-20467635 ACACCCTACCTTTCTCTCTCTGG - Intergenic
1146510601 17:33444721-33444743 ACAGCCTTCATGTCAGCCTCTGG + Intronic
1147906335 17:43825508-43825530 ACAGCCTTCCTTCCTTCCCCTGG - Intronic
1148132434 17:45270296-45270318 AGAGCCTTAGTTTCCCCCTCTGG - Intronic
1149985604 17:61344707-61344729 ACCTCCTTCCTTTCACCCCAGGG - Intronic
1150343311 17:64385964-64385986 ACACCCCTCCTGACACCCTCAGG - Intronic
1151175404 17:72284111-72284133 ACAGCCTCCCAATCACTCTCAGG - Intergenic
1151681305 17:75624243-75624265 AAAGCCTTCATTTCACCCGGTGG - Intergenic
1153502933 18:5767478-5767500 ATAGCCTTCCTTTCCCCCCAGGG + Intergenic
1153643793 18:7176829-7176851 ATAACCTTCCTTACACCCCCTGG + Intergenic
1154493457 18:14938904-14938926 ACAGCTTTCATTTCCCCCCCAGG + Intergenic
1155158885 18:23179783-23179805 ACGGCCTTCCCTTCAGCCTGAGG - Intronic
1155814045 18:30281281-30281303 ATATCCTCCCTTTCACCCACAGG + Intergenic
1156587428 18:38446831-38446853 AAAGCCTTCCTGACACCCTTGGG + Intergenic
1156648683 18:39198793-39198815 ACAGCCTTCCCTGACCCCTCAGG + Intergenic
1157429862 18:47615763-47615785 CCGGCCTTCCTTTCCCCCTTGGG - Intergenic
1158500232 18:57994264-57994286 AGAGCCTTCCTATCAGCCACTGG + Intergenic
1159067616 18:63587663-63587685 AAAGCTTTCATTTCAACCTCAGG - Intronic
1159378746 18:67629076-67629098 ACACCCCTCCCATCACCCTCTGG + Intergenic
1159658460 18:71061894-71061916 CCAGCTTTCCTTTCTCCCTATGG + Intergenic
1162177572 19:8842551-8842573 TCATCCTTCCTCTCTCCCTCTGG - Intronic
1162563372 19:11431002-11431024 AAAGCCTTCCGGTCACCCTCTGG + Exonic
1163361869 19:16851807-16851829 CCAGTCTCCTTTTCACCCTCAGG + Intronic
1163755065 19:19101690-19101712 AGTGCCTTCCTTACACCCTCTGG - Intronic
1163836418 19:19577474-19577496 ACAGCATACCTGTCACCCTCGGG + Intronic
1164742511 19:30586535-30586557 TCTGCCTTCCTTTCCCCTTCTGG + Intronic
1165353542 19:35290629-35290651 ACAGCCTTCAGTTCACACCCAGG + Intergenic
1165741402 19:38207190-38207212 ACAGCCTTCATCTCCTCCTCTGG + Exonic
1167076639 19:47254195-47254217 ACAGGCAGCCTCTCACCCTCCGG + Intergenic
1168082446 19:54020207-54020229 TCAGCCTTGCTGGCACCCTCTGG - Intergenic
925131349 2:1496309-1496331 ACGCCCTGCCTTACACCCTCAGG + Intronic
925716814 2:6791697-6791719 AGGGCCTCCCTTCCACCCTCAGG - Intergenic
926844248 2:17116776-17116798 ACAGGCTTCCCTTAACTCTCAGG - Intergenic
926983326 2:18594759-18594781 ACAGCCTTTCTGTGAGCCTCAGG - Intergenic
927809924 2:26175194-26175216 ACCTCCTTCCTTTCTCCTTCAGG - Intronic
928169468 2:28994134-28994156 CCAGCCCTCCCTTCAGCCTCTGG - Intronic
931274479 2:60732668-60732690 TCAGGCCTGCTTTCACCCTCTGG - Intergenic
932758666 2:74425707-74425729 GCAGCCTTCCTTTGTCCCTGTGG + Exonic
933088704 2:78091615-78091637 TCTGCCTCCCTTTCAGCCTCTGG - Intergenic
934720401 2:96571251-96571273 ACTGACTTCCTTTCACCCTATGG + Intergenic
934916055 2:98302040-98302062 ACATGCTTCGTGTCACCCTCAGG + Intronic
935359604 2:102236317-102236339 ACAGGCCTCCTGACACCCTCTGG - Intronic
935844484 2:107150108-107150130 ATAGCCTTCCGTTAACCTTCAGG + Intergenic
936381946 2:111994106-111994128 ACAGCATTCCTTTGTCACTCAGG - Intronic
936603764 2:113926637-113926659 ACAGCCTGCCTTCAACCCTCTGG + Intronic
936606490 2:113962373-113962395 ACAGGCCTCATTTCTCCCTCTGG + Exonic
941068472 2:160929518-160929540 ACAGTCTCTCTTTCTCCCTCTGG - Intergenic
941699707 2:168591676-168591698 AAAGACTTTCTTTCACCTTCGGG + Intronic
942526445 2:176857959-176857981 CCTGCCTTCGTTTCCCCCTCAGG + Intergenic
943594050 2:189833894-189833916 ACAATCTTCCTTTCATCCTTAGG + Intronic
945093831 2:206200701-206200723 AGATCCTCCCTTTCAGCCTCTGG + Intronic
948315849 2:237027630-237027652 ACTGCCTTCATGTCACCCACCGG - Intergenic
948620003 2:239228264-239228286 ACAGTCTTCCTGTCTCCCTTTGG - Intronic
1169136385 20:3200274-3200296 ACTGCCTTCCTTTTTCCCTAAGG - Intronic
1169424909 20:5488502-5488524 ATAGCCATCCTTTGACCCACGGG + Intergenic
1169541353 20:6603388-6603410 ACAGGCTTCTTCTCATCCTCTGG - Intergenic
1170931706 20:20774460-20774482 AGAGCCTCCATTGCACCCTCCGG + Intergenic
1174083827 20:47990494-47990516 ACAGCCATCCGCTCAACCTCTGG + Intergenic
1174196709 20:48777369-48777391 ACAGCCTTCCGTTCACTGTCTGG - Intronic
1178830344 21:36051123-36051145 ACTGCCTCCCTTCTACCCTCTGG + Intronic
1179530425 21:42014770-42014792 AGTGCCTTGCTTTCAGCCTCTGG + Intergenic
1180593639 22:16960306-16960328 CCACCCCTACTTTCACCCTCAGG + Intergenic
1181801962 22:25353660-25353682 ACAGCCTTCATCGCACCCTGTGG - Intronic
1182431588 22:30302110-30302132 ACAGCCAGCCTTTCCCACTCTGG + Intronic
1183265402 22:36822110-36822132 ACAGCCATCTTGCCACCCTCAGG - Intergenic
1184638945 22:45858656-45858678 CCGGCCTTCCTTTCACTCTAGGG + Intergenic
1184793525 22:46717195-46717217 CCAGCCTGCATTCCACCCTCAGG - Intronic
1185152871 22:49176108-49176130 ACAGCCGTCCTTCCACTGTCTGG - Intergenic
1203292203 22_KI270736v1_random:5865-5887 ACTGCCTTCCTCCCACCATCTGG - Intergenic
949844392 3:8355034-8355056 ACAGGCTACATTTCAGCCTCAGG + Intergenic
951284664 3:20794692-20794714 GCAGACTTACTTTCACTCTCTGG + Intergenic
952623799 3:35379445-35379467 AAAGCCTTCCTGTCTCACTCAGG + Intergenic
952787481 3:37169963-37169985 TCTGCCTTCCTTTCCTCCTCGGG - Intronic
952865325 3:37851492-37851514 ATAGTTTTCCTTTCTCCCTCAGG - Intergenic
954304342 3:49717545-49717567 AGAGCCTCCCGTCCACCCTCAGG - Exonic
955058690 3:55477894-55477916 ACTGCCTTCCTCTCAACCTATGG - Intronic
955090156 3:55742742-55742764 ACAGCCTCTCTCTCACCCTTGGG + Intronic
955224646 3:57050634-57050656 ACAGCCTTTCCTTCCCACTCTGG - Intronic
955744452 3:62126143-62126165 CCAGCCTTGCTGTCACCCTGCGG + Intronic
957080073 3:75629908-75629930 ACACTCTTCCTTTCTCCCCCTGG - Intergenic
963572143 3:147011046-147011068 AAAGCCTTCATTTAACCTTCAGG - Intergenic
964541507 3:157784593-157784615 TCAGCTTTGGTTTCACCCTCAGG + Intergenic
965531111 3:169771842-169771864 AAAGCCATCCTTTCAGCTTCTGG - Intergenic
965554443 3:170004972-170004994 CCAGCCTTCCTTTCAATCTTGGG - Intergenic
965949802 3:174294901-174294923 AGAGCCTTCCTTTCACTGGCTGG - Intergenic
967979392 3:195056534-195056556 GCAGCCCTCCTTTCACTCCCAGG - Intergenic
968752079 4:2395532-2395554 ACAGCCTGGCTGTCACACTCAGG + Intronic
972093448 4:35317834-35317856 TCAGCATTCCCTTCACCTTCAGG - Intergenic
973587483 4:52408097-52408119 ACAGTCTTGCTTTCACCATTTGG + Intergenic
976137913 4:81958967-81958989 ACTGCTGTCCTTTCACACTCAGG + Intronic
976874668 4:89837782-89837804 GTAGTCTCCCTTTCACCCTCAGG - Intronic
977259800 4:94784880-94784902 ACAGCCTTCCTGTGACCTTTAGG + Intronic
978499136 4:109389850-109389872 ACAGCTTTCCTGTCACCTGCTGG + Intergenic
983589767 4:169395767-169395789 ACTGCCTTCCTTTCTTCCCCAGG + Intronic
984323796 4:178226474-178226496 ACTGCCTTTCTTTCTCACTCTGG - Intergenic
984325099 4:178241653-178241675 AAGGCCCCCCTTTCACCCTCAGG + Intergenic
986588057 5:9339324-9339346 ACATCTTTCCTGTCACTCTCTGG - Intronic
990601862 5:57367098-57367120 CCAGCCTCCCTTTCAGCCACAGG - Intergenic
990987566 5:61655027-61655049 ACCTCTTTCCTTTGACCCTCAGG + Intronic
991084580 5:62636817-62636839 AAAGCTTTCCTATCCCCCTCAGG + Intergenic
991201540 5:63999889-63999911 TTAGCCTCCCTTTCACTCTCAGG - Intergenic
994220923 5:97193657-97193679 ACATCCTTCCTCTCACACTTTGG + Intergenic
995526208 5:113052585-113052607 GCAGCCATCCTGACACCCTCAGG - Intronic
996288377 5:121822816-121822838 ACACCCCTCCCTCCACCCTCTGG + Intergenic
1000790431 5:165600339-165600361 TATGCCTTCCTTCCACCCTCAGG + Intergenic
1001168379 5:169392435-169392457 ACTGCCTTCCTCTGAACCTCGGG - Intergenic
1001433044 5:171678581-171678603 ACAGCCTTCCATTCACTGTCTGG + Intergenic
1001915399 5:175556193-175556215 CCAGCTTTCTTTTCACCTTCAGG - Intergenic
1002417056 5:179126177-179126199 CCACCCCTCCTTGCACCCTCGGG - Intronic
1006185641 6:32180207-32180229 ACAGCTTTCCTCTCTCCCACAGG + Exonic
1006567388 6:34971832-34971854 TCAGCCTTCCTTTCCCCTTTTGG + Intronic
1006663957 6:35675868-35675890 ACACCATTCCTTCTACCCTCAGG + Intronic
1007116600 6:39347627-39347649 ACAACCCTCCTTTTACACTCTGG + Intronic
1007793729 6:44330167-44330189 ACTGACTTTCTTTCACCGTCTGG - Intronic
1011113178 6:83860378-83860400 ACTGCCTTTCTTTCTTCCTCTGG + Intronic
1013608422 6:111772391-111772413 CCAGCCTTCCTTTCATCCAGTGG - Intronic
1019186420 6:170223264-170223286 CCAGCCTTCCTTCCACCCGCAGG + Intergenic
1019385703 7:754920-754942 ACAGCGTTCCCCTCACCCCCGGG + Intronic
1019612024 7:1941484-1941506 ACACCAATCCTGTCACCCTCTGG + Intronic
1020319761 7:6930940-6930962 ACTGCCGTCATTTCACCTTCTGG - Intergenic
1021110549 7:16689465-16689487 ATTGCCTTTATTTCACCCTCTGG - Intronic
1021249727 7:18309512-18309534 ACATCCTTCCATTCTCCCTGAGG + Intronic
1021530441 7:21638522-21638544 ACAGCCTTCTTTTCCCCCACTGG - Intronic
1022329658 7:29365640-29365662 ACAGTGTTCCCTTCAACCTCAGG - Intronic
1024234376 7:47386692-47386714 ACAGCACTCCTTTCCCCCTGTGG - Intronic
1024486387 7:49925194-49925216 TCAGCCTTCCTATTAGCCTCTGG + Intronic
1024686264 7:51749212-51749234 ACAGGCTTCCTTCCAGCTTCGGG + Intergenic
1027657406 7:80947704-80947726 ACAGCCTTACTGTCATTCTCTGG - Intergenic
1030342462 7:108395660-108395682 ACTGCCTTCCTTGTACCCTGTGG - Intronic
1031499049 7:122488927-122488949 GCTGCCTTCCTCTCACCCTCTGG - Intronic
1031659335 7:124400551-124400573 ACAGCCTTTCTATCCCTCTCTGG - Intergenic
1031970619 7:128062423-128062445 AGTCCCTTCCTTTCACCCTCTGG + Intronic
1034504303 7:151474202-151474224 ACAGCCTTGCTTTGTCGCTCAGG + Intronic
1035642630 8:1195283-1195305 ACTGGCTTCCCTGCACCCTCAGG + Intergenic
1036647708 8:10622584-10622606 ACAGCCTACCTTTTTCCCGCTGG + Exonic
1036708121 8:11059900-11059922 ACACCCATCCTGTCACCTTCAGG - Intronic
1038498644 8:28025056-28025078 ACTGCCTGCCTTCCACCCACTGG + Intronic
1039810457 8:41043707-41043729 ACAGAGTCCCTTTCACCCGCCGG - Intergenic
1043190805 8:77220523-77220545 ACAGTTTTCATTTCTCCCTCTGG - Intergenic
1043742932 8:83836824-83836846 ACAGCATTGCCCTCACCCTCTGG + Intergenic
1043745107 8:83865415-83865437 ACATCCTTCCTTTCACTCATGGG + Intergenic
1044687879 8:94845209-94845231 ATAGCCTTCCTTTCACGTTTAGG + Intronic
1048035498 8:130673686-130673708 TCAGTCCTCCTTTGACCCTCTGG + Intergenic
1048220016 8:132532539-132532561 TCTTCCTTCCTCTCACCCTCCGG - Intergenic
1049598191 8:143494233-143494255 AGAGACTTCCTGCCACCCTCAGG + Intronic
1049661853 8:143823100-143823122 ACAGCCAGCCTTTGACCTTCAGG - Intronic
1049939899 9:535366-535388 AGATCCTTCCTTTCTCCCACAGG - Intronic
1051625458 9:19095257-19095279 ACTGCTTTCCTTTCACAGTCAGG + Intronic
1057207924 9:93184513-93184535 ACTGCCTTCCTCCCACCCCCGGG + Intergenic
1057288188 9:93777625-93777647 AGAGCCTTCTTTTCCTCCTCAGG - Intergenic
1057375238 9:94515227-94515249 TCTGCCTTCCTCTCTCCCTCAGG - Intergenic
1060421058 9:123469890-123469912 ACAGACTTCGTTTCAAACTCTGG - Intronic
1061887644 9:133600611-133600633 CCACCCATCCTTTTACCCTCTGG - Intergenic
1185803867 X:3039284-3039306 AGAGTCTTCCTTTATCCCTCAGG + Intergenic
1188732301 X:33664940-33664962 TCAGCCTTCCTCTCCCCTTCTGG + Intergenic
1189283955 X:39838909-39838931 ACAGCCCTCCTTTCATCCAAAGG + Intergenic
1192037111 X:67575566-67575588 ACTGCCTTCCTTTAAGCATCTGG - Intronic
1196784178 X:119407794-119407816 ACTACCTTCCTTTCACCCCGTGG + Intronic
1197010626 X:121558318-121558340 ACAGGCTTCTTTTCACACTCTGG + Intergenic
1197494026 X:127154623-127154645 ACAGCAGGCCTTTCACACTCTGG + Intergenic
1197627419 X:128817838-128817860 ACAGCCCTCTTTTCAGACTCTGG - Intergenic
1197838742 X:130722952-130722974 AGACCCTTCCTTACACCCACAGG + Intronic
1201266609 Y:12212948-12212970 ACACACTTCCTGTTACCCTCTGG + Intergenic