ID: 920453803

View in Genome Browser
Species Human (GRCh38)
Location 1:206082136-206082158
Sequence AGTGAGCTGTGATACATCAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 179}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920453803 Original CRISPR AGTGAGCTGTGATACATCAA CGG Intronic
900339523 1:2181369-2181391 AGTGACCTGAGATACAACAGGGG - Intronic
902269574 1:15293779-15293801 AGAAATCTGTGATACATCCATGG - Intronic
904577221 1:31512767-31512789 AGTGAACTGTGGTACATCCTTGG - Intergenic
906444501 1:45883153-45883175 ATAGAGCTGTGATAAAACAATGG + Intronic
907993237 1:59603509-59603531 AGTAAGCTGTCACATATCAATGG - Intronic
909023116 1:70453591-70453613 AGTGATATGTGATACATGAGGGG + Intergenic
910542994 1:88382375-88382397 GGTAAGCTGTGACAAATCAAAGG - Intergenic
914885933 1:151584473-151584495 AGTGTGCTGCCATACATGAAAGG + Intergenic
915009505 1:152672371-152672393 AATAAGATGAGATACATCAAGGG + Intergenic
915265751 1:154716162-154716184 ACTGAGCTGAGACATATCAATGG + Intronic
917328754 1:173860973-173860995 AGTGAGCTGTGTCACACCACTGG - Intergenic
917757816 1:178120545-178120567 AGTGAGTTGATGTACATCAATGG - Intronic
918777285 1:188650122-188650144 AGTATGCTTTGATACATAAAAGG - Intergenic
919754959 1:201060981-201061003 AATGGGCTGTGATAACTCAAGGG - Intronic
919861613 1:201742376-201742398 AGTGAGCTGTGATCAGTCCATGG + Intronic
920167118 1:204043901-204043923 AGTGACCTGGGATAGGTCAAGGG - Intergenic
920449557 1:206048956-206048978 AGTGTGCTATGCTACATCCAGGG - Intronic
920453803 1:206082136-206082158 AGTGAGCTGTGATACATCAACGG + Intronic
920547591 1:206831332-206831354 ATTGAGCTCTGATATCTCAATGG + Intronic
920925146 1:210334221-210334243 AGTGAGCTGTGATCCAGCCTGGG - Intronic
922825800 1:228517394-228517416 AGTGAGATGGGATACAGCAAGGG + Intergenic
923392871 1:233531268-233531290 AATCACCTGTGATAAATCAAAGG + Intergenic
923672887 1:236055935-236055957 AGATAGCCGTGATAGATCAACGG + Intronic
1064836894 10:19543139-19543161 AGTGAGCTGTGAAAAATCCAGGG - Intronic
1067004951 10:42651772-42651794 AGTCAGCTGTGATGGATCTAAGG - Intergenic
1067253608 10:44612055-44612077 AGTGAACTGTGCACCATCAAGGG + Intergenic
1070969371 10:80550648-80550670 ATTAAACTATGATACATCAATGG + Intronic
1071918943 10:90327835-90327857 TGAGAGCTGTGATAAATCACTGG + Intergenic
1073744557 10:106451208-106451230 AATGAACTGTGATAAATCAAGGG - Intergenic
1074514441 10:114152283-114152305 AGTGAGCTGTGATCCCACCATGG + Intronic
1075245669 10:120820157-120820179 TCTGAGCTGTGATACATCTTTGG + Intergenic
1075402821 10:122173232-122173254 AGTCAGCTGTTCTAGATCAAAGG - Intronic
1075677466 10:124305399-124305421 AGTGTGCTGGGAACCATCAAAGG + Intergenic
1076980377 11:201002-201024 GGTGACCTGTTACACATCAATGG + Intronic
1077627334 11:3784380-3784402 AGTGAGCTTTGTTTAATCAAAGG - Intronic
1080954863 11:37081673-37081695 AATGGGCTGTGATACATTAGTGG + Intergenic
1082729597 11:56779267-56779289 ATTAAGCTGTGATACCTAAAGGG - Intergenic
1085219083 11:74858237-74858259 AGGGACCTGTGATACATCTATGG + Intronic
1088948837 11:114544048-114544070 AGAAAGCTGTGAAACATTAATGG + Intronic
1089160625 11:116434337-116434359 AGTGAGGTGTGCTCCTTCAAGGG - Intergenic
1089361442 11:117890463-117890485 AATGAGCTGTGATCCAACCACGG - Intergenic
1089584441 11:119501469-119501491 AGTGAGCTGTGATTGTGCAATGG + Intergenic
1091940114 12:4471821-4471843 GGTGAGTTGTGATACACCGATGG - Intergenic
1098873364 12:75841390-75841412 AGTGAGATGTGATAGATGTATGG - Intergenic
1099878799 12:88440947-88440969 TTTGAGATGTGTTACATCAATGG - Intergenic
1102400894 12:112628692-112628714 AGTGAGCTGTGATCATGCAAAGG + Intronic
1106762151 13:32877903-32877925 AGAGATGTGTGATACATCTAGGG + Intergenic
1109314025 13:60728248-60728270 GGAGAAATGTGATACATCAATGG - Intergenic
1109850608 13:68058121-68058143 ATTGAGCTGTGTAACATAAAAGG + Intergenic
1109933192 13:69244233-69244255 AGTGAATGGTGATATATCAAGGG + Intergenic
1110104308 13:71651602-71651624 AGTGAGCTGTGATAGTGCCATGG + Intronic
1110236130 13:73219982-73220004 AGTGAGCTGTGATAGCACCACGG - Intergenic
1114491043 14:23102183-23102205 AGTGCGCTGGGCTCCATCAAAGG + Intergenic
1115679544 14:35720874-35720896 AGTGAGCTATGATCCAACAAAGG + Intronic
1116061933 14:39934472-39934494 ACTGAGCAGTTATATATCAAGGG - Intergenic
1116789051 14:49320087-49320109 AGAGAGCTGCCATACTTCAAGGG - Intergenic
1118280531 14:64424191-64424213 AGTGAGCAATGATGCATCATTGG + Intronic
1118733511 14:68685811-68685833 CGTCAGCTTTGAAACATCAAAGG - Intronic
1119164798 14:72483357-72483379 AGTCAGCTGTGACACACGAATGG - Intronic
1119591744 14:75895307-75895329 TGTGAGCTGTGATTCATAATTGG - Intronic
1119992575 14:79215930-79215952 AGTGGTCTGTGACACAGCAATGG - Intronic
1122162761 14:99797670-99797692 GGTGAGCTGTGATTGATCAAAGG - Intronic
1122971031 14:105152321-105152343 AGTGAGCTGTGGTGCCTGAAAGG + Intronic
1123180815 14:106468521-106468543 GCTGAGGTGTGATAGATCAATGG + Intergenic
1202946082 14_KI270726v1_random:28137-28159 GCTGAGGTGTGATAGATCAATGG - Intergenic
1125214251 15:37251944-37251966 AGTGAGCATTAATAAATCAATGG + Intergenic
1127032815 15:54882426-54882448 GATGAGCTGTGATATACCAATGG - Intergenic
1129100853 15:73261917-73261939 AGGAAGATGTTATACATCAATGG + Intronic
1132624524 16:885174-885196 GGTGAGCTGTGATGGATTAAAGG + Intronic
1137044726 16:35644340-35644362 AGTGGACTGGGATACATAAAAGG - Intergenic
1137816447 16:51402198-51402220 AGAGATGTGTGATAGATCAATGG - Intergenic
1139087726 16:63608268-63608290 AATGAGCAGTGGTAGATCAAAGG - Intergenic
1139509643 16:67419765-67419787 TGTGTTATGTGATACATCAAAGG + Intergenic
1139649697 16:68356124-68356146 CCTGAGCTGTGATCCAACAAGGG - Intronic
1141298169 16:82789390-82789412 GGTGAGCTGTGTATCATCAAAGG - Intronic
1143341643 17:6215851-6215873 AGTGAGCTCTGCTGCATCCATGG + Intergenic
1147942221 17:44057097-44057119 AGTGAGCTGAGATAGAGCCATGG + Intronic
1150356586 17:64491451-64491473 AGTGAGCTGTGATTGTGCAACGG + Intronic
1150955296 17:69852184-69852206 AGTGATTTGCTATACATCAAAGG - Intergenic
1151779588 17:76235706-76235728 AGACAGATGTGATACATCTATGG + Intronic
1152675075 17:81636027-81636049 AGTGAGCTGAGATCCCTCCATGG - Intronic
1153908761 18:9687908-9687930 AATGAGATGTGATACATCATCGG + Intergenic
1159486570 18:69067468-69067490 AGAAAGCTGAGATTCATCAAAGG - Intergenic
1160922497 19:1527543-1527565 AGTGAGCTGTGATTGCACAACGG + Intronic
1162280314 19:9691547-9691569 AGTGAGCTGTGATTCTGCCATGG - Intronic
1165667562 19:37646630-37646652 AGTGAGCTGTAATCAATAAATGG - Intronic
1166187972 19:41154315-41154337 AGTGAGCTGTGATCACTCCATGG + Intergenic
1167092189 19:47352196-47352218 AGGGAGCTGTGGGACACCAAAGG - Intronic
1167924001 19:52808754-52808776 AGTGAGCTGTGATCCCACCAGGG + Intronic
927136572 2:20101021-20101043 AGTGAGCTGAGATACGTTAGAGG - Intergenic
927773101 2:25880688-25880710 AGTAACCAGAGATACATCAAAGG - Intergenic
929975057 2:46625562-46625584 AGTGTGATGAGATACATGAATGG + Exonic
930340475 2:50107566-50107588 ATAGAAATGTGATACATCAATGG + Intronic
933071529 2:77864586-77864608 AGTGAGCTATGATCCATCCCAGG - Intergenic
934131109 2:88949966-88949988 AGTGAGCAGAGGTACAGCAAAGG - Intergenic
934146771 2:89102538-89102560 AATGAGCAGAGATACAGCAAAGG - Intergenic
934220791 2:90080598-90080620 AGTGAGCAGAGGTACAGCAAAGG + Intergenic
934222493 2:90098054-90098076 AATGAGCAGAGATACAGCAAAGG + Intergenic
934233438 2:90207847-90207869 AGTGAGCAGAGGTACAGCAAAGG + Intergenic
935861994 2:107341144-107341166 AGTGAACTGTGGTAACTCAAAGG + Intergenic
937032691 2:118753517-118753539 AGTGAGCAGTGATTCAGAAAGGG + Intergenic
937085214 2:119167165-119167187 ACTGAGTTTTGATAGATCAATGG - Intergenic
937770743 2:125718152-125718174 ACTGAGCTTTGGTTCATCAAAGG + Intergenic
941349670 2:164416658-164416680 AGTGAAGGGTGATAGATCAACGG - Intergenic
944663168 2:201938000-201938022 ATTGGGCTGTGATTAATCAAGGG - Intergenic
946565773 2:220963800-220963822 GGTGGGCTGTGCTAGATCAAAGG - Intergenic
946643540 2:221809498-221809520 AGGGAGCAGTGATTCATCCAGGG + Intergenic
946713872 2:222533280-222533302 CGGGAGCTGGGATACATGAATGG - Intronic
948146872 2:235714852-235714874 AGTGAGCCGAGATACACCACTGG - Intronic
1169129109 20:3154624-3154646 AGTGAGCTGTGATCCTGCTATGG + Intronic
1170826011 20:19796394-19796416 AGTGAACTGTGGTTCATTAAGGG + Intergenic
1172644132 20:36459431-36459453 AGTGAGCTGTGATCCTGCCACGG - Intronic
1173728502 20:45312949-45312971 AGTGAGCTGTGATAGCACCACGG + Intronic
1174376937 20:50132485-50132507 AGTGAGCTGTGTTGCATCTTAGG - Intronic
1174527330 20:51184066-51184088 AGTGAGCTGTGACATGTCATTGG - Intergenic
1175728577 20:61336211-61336233 AGTGAACTGTGATTCACCCATGG - Intronic
1176987794 21:15456943-15456965 AGTGTGCTCTGATGCATAAAGGG + Intergenic
1178122289 21:29481532-29481554 AGTGAGCTGTGATCATTCCACGG - Intronic
1178835314 21:36092547-36092569 AGTGAGCTGAGATGCACCACTGG - Intergenic
1178968943 21:37153913-37153935 ACTGAGCTGTGGTAAATCACAGG + Intronic
1179945920 21:44675803-44675825 AATCAGCAGTGATACATGAAGGG - Intronic
1182800479 22:33028301-33028323 AAGGAGCTGTGATAAATCCAGGG - Intronic
1183999242 22:41660191-41660213 CATGAGCTGTGTCACATCAAGGG - Intronic
1184329654 22:43819269-43819291 AGTGAGCTGGGATTCATTCATGG + Intergenic
952195800 3:31074213-31074235 AGGGAGCTGGGACACATGAATGG - Intergenic
954683987 3:52360786-52360808 ACTGAGCTGAGAGACATCATGGG + Intronic
954824838 3:53363612-53363634 ACTGAGCTGTGAAACAAGAAAGG + Intergenic
954928114 3:54255300-54255322 ATAGAGCTTTGATACATCAGAGG + Intronic
957264643 3:77947277-77947299 AGTGAGCTTTCATTTATCAAAGG - Intergenic
958843547 3:99238175-99238197 AGAAAGCTGTGATAACTCAAAGG - Intergenic
960356857 3:116664253-116664275 AGTGAGCTGTGATTGCTCCATGG - Intronic
960451159 3:117809884-117809906 AGCAAGCTGTGATACATCACTGG - Intergenic
961483825 3:127202837-127202859 AGTAGGCTATAATACATCAAGGG - Intergenic
961684985 3:128623651-128623673 AGTGAGCTGTGATTGATCGGGGG + Intronic
962685476 3:137843431-137843453 ACTGAGCTGTACTACATCTAGGG + Intergenic
963367817 3:144361426-144361448 AATATGCTGTGATACATCCAGGG + Intergenic
964187814 3:153967536-153967558 AGTGAGATGGGAAACACCAAAGG - Intergenic
966257456 3:177933597-177933619 ACATAGCTGTAATACATCAATGG - Intergenic
966967630 3:185010940-185010962 AGTGAGCTGTGATTGTTCCATGG + Intronic
970885255 4:20980705-20980727 AGGAAGCAGTGATACCTCAATGG - Intronic
972286265 4:37651426-37651448 AGTGAGGTTTTCTACATCAAGGG + Intronic
972927768 4:44033027-44033049 AGTGAGCTGAGAAAATTCAAAGG + Intergenic
976621600 4:87134064-87134086 AGGAAGCTGTGATATATCCAGGG + Intronic
980381294 4:132021588-132021610 ACTGAGCTGTGATACAACTTTGG - Intergenic
981015601 4:139970760-139970782 AGTGAACTGTGAAAATTCAATGG - Intronic
982559375 4:156911220-156911242 AGTGAGATGTAATACATTTAGGG - Intronic
984028215 4:174570550-174570572 AATGAACTGTGAAACATAAAAGG - Intergenic
990554237 5:56914010-56914032 TGTGAGATGAGATATATCAATGG + Intronic
992969459 5:82041759-82041781 AGTGAGCTGTGAGACATAAGTGG - Intronic
993148286 5:84125525-84125547 AGTGAACTCTGATACAAGAAAGG + Intronic
994351519 5:98751802-98751824 AGTGAGCTGTCATAAGTAAATGG - Intergenic
995788297 5:115855393-115855415 AGTGAGCCGTGATATACCACCGG - Intronic
1001091569 5:168745801-168745823 AGTGAGGTTTGTCACATCAATGG - Intronic
1003365699 6:5472752-5472774 ACTCAGCTGTGATACATAAGGGG - Intronic
1006691548 6:35891761-35891783 AGTAAGCAGTGATACTTCTAAGG - Intronic
1008375952 6:50792111-50792133 AGTGAGTTATCATTCATCAACGG + Intergenic
1012908113 6:105090806-105090828 AGTGAGCTGTGATAGCGCCACGG + Intergenic
1013567107 6:111377391-111377413 AGTGAGCTGTGATTGCTCCATGG - Intronic
1013850898 6:114514251-114514273 AGGAATCTGTGAAACATCAAAGG + Intergenic
1014930914 6:127334816-127334838 ACTGAGCTGGGATAAATAAAGGG - Intronic
1017994977 6:159524280-159524302 AGTGAGCTGTGAAACAACACTGG - Intergenic
1019141032 6:169943217-169943239 AGTGGACTGTGATACACAAAAGG + Intergenic
1021547166 7:21827025-21827047 AGGGAGCTGTCAGACATGAAAGG - Intronic
1022925498 7:35052434-35052456 AGTGTGCTGTGATACCACCATGG + Intergenic
1028829993 7:95316847-95316869 AGTGAGGTGTGATAAAGAAATGG - Intronic
1029823507 7:103167131-103167153 AGTGTGCTGTGATACCACCATGG + Intergenic
1035656423 8:1310105-1310127 AGGGAGCTGTTATAAATCTAGGG + Intergenic
1038838871 8:31160358-31160380 AGTAAGCTGTAAAACATCCAAGG + Intronic
1041330139 8:56715386-56715408 TGTGAGCTTTGGTAAATCAAGGG + Intergenic
1041519315 8:58737843-58737865 AGTGAGCTGAGATGGTTCAAAGG - Intergenic
1045557324 8:103227017-103227039 AATGAGCTATGGTCCATCAAAGG - Intronic
1045745696 8:105418435-105418457 AGTGAGGTGCGCTACATTAATGG - Intronic
1045789202 8:105961916-105961938 AGTGATCTGTTATACATAATGGG - Intergenic
1046604965 8:116361287-116361309 AGGCAGCTGAGATACATGAAAGG + Intergenic
1047025609 8:120820465-120820487 AGTGTTTTGTGATACCTCAAAGG - Intergenic
1048970873 8:139644424-139644446 CGTGGGCTGTGATCCATTAATGG - Intronic
1050696434 9:8284487-8284509 AGTCTGCTGTGAGAAATCAATGG - Intergenic
1051714858 9:19971838-19971860 AATGAGTTGACATACATCAAGGG - Intergenic
1055031738 9:71777111-71777133 AGTGAGCTGTGATAGCACCATGG + Intronic
1056310976 9:85340611-85340633 AGCTATCTGTGATACATCAGAGG + Intergenic
1060025528 9:120167710-120167732 AGTTAGCTTTCACACATCAAGGG + Intergenic
1185685898 X:1928065-1928087 AATGAGCCGTGAAAAATCAATGG + Intergenic
1186539638 X:10387494-10387516 AGTGATCTATGATGCAGCAATGG + Intergenic
1189265349 X:39711709-39711731 AGTGAGCTGTGATAGCACCACGG - Intergenic
1194784347 X:98063398-98063420 AGTGGGCTGTGATATAGGAAAGG - Intergenic
1195618369 X:106930363-106930385 AGTGAGGGGTCATACACCAAAGG + Exonic
1197346620 X:125331836-125331858 ACTGTGCTATGATACATTAAAGG + Intergenic
1198814897 X:140579502-140579524 GATGATCTGTGATACCTCAAGGG - Intergenic
1199458246 X:148053605-148053627 ACTGATCTGTGATACATAATAGG + Intergenic
1200323200 X:155211639-155211661 AGTGAGCTGTGCAATATCATGGG + Intronic