ID: 920457747

View in Genome Browser
Species Human (GRCh38)
Location 1:206113934-206113956
Sequence AGCAGGGAGGTCCCTACAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 137}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920457737_920457747 23 Left 920457737 1:206113888-206113910 CCTGTGCCTAGGAAACCCTCCTT 0: 1
1: 1
2: 0
3: 12
4: 169
Right 920457747 1:206113934-206113956 AGCAGGGAGGTCCCTACAGTTGG 0: 1
1: 0
2: 1
3: 14
4: 137
920457741_920457747 4 Left 920457741 1:206113907-206113929 CCTTCCTTCTATTCTGTGCTTGG 0: 1
1: 0
2: 3
3: 28
4: 352
Right 920457747 1:206113934-206113956 AGCAGGGAGGTCCCTACAGTTGG 0: 1
1: 0
2: 1
3: 14
4: 137
920457739_920457747 8 Left 920457739 1:206113903-206113925 CCCTCCTTCCTTCTATTCTGTGC 0: 1
1: 0
2: 7
3: 172
4: 1973
Right 920457747 1:206113934-206113956 AGCAGGGAGGTCCCTACAGTTGG 0: 1
1: 0
2: 1
3: 14
4: 137
920457740_920457747 7 Left 920457740 1:206113904-206113926 CCTCCTTCCTTCTATTCTGTGCT 0: 1
1: 0
2: 4
3: 54
4: 724
Right 920457747 1:206113934-206113956 AGCAGGGAGGTCCCTACAGTTGG 0: 1
1: 0
2: 1
3: 14
4: 137
920457738_920457747 17 Left 920457738 1:206113894-206113916 CCTAGGAAACCCTCCTTCCTTCT 0: 1
1: 0
2: 2
3: 63
4: 507
Right 920457747 1:206113934-206113956 AGCAGGGAGGTCCCTACAGTTGG 0: 1
1: 0
2: 1
3: 14
4: 137
920457743_920457747 0 Left 920457743 1:206113911-206113933 CCTTCTATTCTGTGCTTGGCTAG 0: 1
1: 0
2: 0
3: 7
4: 127
Right 920457747 1:206113934-206113956 AGCAGGGAGGTCCCTACAGTTGG 0: 1
1: 0
2: 1
3: 14
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920457747 Original CRISPR AGCAGGGAGGTCCCTACAGT TGG Intronic
900429820 1:2596278-2596300 AGCAGGGAGGACCCTGAAGTTGG - Intronic
901159193 1:7162170-7162192 AGCTGTCAGGTCCCAACAGTTGG + Intronic
903461675 1:23525017-23525039 CCCAGGGAGGTGCCCACAGTGGG + Intronic
907758805 1:57337752-57337774 AGCAGGGAAGCCCCAGCAGTGGG - Intronic
908570565 1:65405981-65406003 AGCAGGGAGGTGCCTACAACTGG + Exonic
911730020 1:101283135-101283157 AGCAGGGAAGACCATGCAGTAGG + Intergenic
913537495 1:119786980-119787002 ATCAGGGGTCTCCCTACAGTTGG + Intergenic
915623445 1:157099767-157099789 AGCGGGGAGGTCCCCAGAGGGGG - Exonic
919560264 1:199109628-199109650 AGCAGAGAGTTGCCTACAGCTGG - Intergenic
919576994 1:199322622-199322644 AGCAGGCAGTTGCCAACAGTGGG - Intergenic
920457747 1:206113934-206113956 AGCAGGGAGGTCCCTACAGTTGG + Intronic
920543178 1:206794531-206794553 AGTAGGGAGGACCCAACAGGAGG - Intergenic
921309351 1:213827388-213827410 AGCATGGAGGTTCCTCCTGTGGG - Intergenic
922464955 1:225840143-225840165 AGCTGGGAGGTCCTTACAAGAGG - Intronic
1062813283 10:481325-481347 AGGGAGGAGGTCCCTGCAGTTGG - Intronic
1063331190 10:5161199-5161221 AAGAATGAGGTCCCTACAGTTGG + Intergenic
1064296047 10:14080032-14080054 AGCAGGGAGGTCCAGGCAGGAGG - Intronic
1067183372 10:44006954-44006976 AGCAGGGAGGTGCCTTAAGTGGG - Intergenic
1069746476 10:70717904-70717926 AGCTGGTAGGACCCTACAATTGG - Intronic
1071198874 10:83194452-83194474 AGAAGGGGGGTCCATTCAGTTGG - Intergenic
1074935221 10:118171763-118171785 AGCAGGGAGATGCCTACAAAGGG + Intergenic
1075862671 10:125690654-125690676 AGCAGGGAGGTCCTTGAAGGAGG - Intergenic
1076064984 10:127441705-127441727 GGCAAGGAGGACACTACAGTGGG - Intronic
1077530643 11:3093255-3093277 CACAGGGAGGTCCCTGCAGGCGG - Intronic
1081661707 11:44892430-44892452 AGCACGGAGGTCACTCCATTAGG - Intronic
1081994091 11:47352565-47352587 AGCAGGGGGGTGTCTACAATTGG - Intronic
1083656760 11:64233803-64233825 AGCTGTGAGGCCCCTAGAGTGGG + Intronic
1083710915 11:64547789-64547811 AGCAAGGAGGTTCGTCCAGTGGG - Intergenic
1084575585 11:69986145-69986167 CCCAGGGAAGTCCCCACAGTCGG + Intergenic
1088746596 11:112809318-112809340 AGCAGGGAGGACTCTTCAGTGGG - Intergenic
1089603429 11:119628400-119628422 AGCAGGGCTGTCTCTACCGTGGG - Intronic
1093441087 12:19197098-19197120 AACAGAGAGGTCCCTAGTGTTGG - Intronic
1095065000 12:37761814-37761836 AGTAGGGAGGGCCAGACAGTGGG + Intergenic
1096680328 12:53251730-53251752 TGCATGGAGGTCACTGCAGTGGG + Exonic
1097459782 12:59846735-59846757 AGAAGAGGGGTCCATACAGTTGG + Intergenic
1097550097 12:61056974-61056996 AGCAGGTAGGTCTCAACAGTAGG - Intergenic
1100713175 12:97278834-97278856 AGCATGTTGGTCCCTGCAGTAGG + Intergenic
1101325257 12:103709934-103709956 AGTAGGGAGGTTCCTAGATTGGG - Intronic
1103954383 12:124568031-124568053 CGCAGGGAGGGCCCTACACAGGG + Intergenic
1104634255 12:130427759-130427781 AGCAGGGAGCTCCTTAAAGGAGG - Intronic
1104646412 12:130500949-130500971 AGCAGGGAGGTCCGTAGAGTGGG + Intronic
1104766339 12:131332810-131332832 AGCAGGGAGGCCCCATGAGTCGG + Intergenic
1104813068 12:131629787-131629809 AGCAGGGAGGCCCCATGAGTCGG - Intergenic
1110002641 13:70224452-70224474 AGCAGGGCAGTCTCTAAAGTTGG + Intergenic
1113669485 13:112165953-112165975 TGCAGTGAGGTCCTTCCAGTGGG - Intergenic
1113927554 13:113950155-113950177 AGCAGTGAGGTCCCCAAGGTGGG - Intergenic
1113927618 13:113950403-113950425 AGCAGTGAGGTCCCCAAGGTGGG - Intergenic
1117066080 14:52014375-52014397 AGCAGGAAGGTGCCCACAGATGG + Exonic
1117154238 14:52922143-52922165 AGCAGTGAGGAACCTCCAGTTGG - Intronic
1117330514 14:54707462-54707484 AGCAGGGAAGACACAACAGTAGG - Intronic
1121514518 14:94540570-94540592 GGCAGGGATGTTCCTTCAGTGGG - Intergenic
1122879193 14:104682444-104682466 AGCAGGCAGCTGCCTGCAGTGGG + Intergenic
1128033166 15:64499723-64499745 AACAGGGAAGTCCCTGGAGTGGG - Exonic
1135123115 16:19783773-19783795 AGCAGGGATGTCACTAAAGGTGG + Intronic
1136247627 16:28984816-28984838 AGCAGGGAGGCCCTGACAGTGGG - Exonic
1137454218 16:48605924-48605946 AGCAGGGAGGTCCTGGCAGAGGG - Intronic
1137932240 16:52600086-52600108 AGGAGGGAGTTCCTTACAGAGGG - Intergenic
1138496602 16:57412768-57412790 AGCATGGGCGTCCCTACAGTAGG - Intronic
1140869859 16:79096424-79096446 AGCAGGGAGGCCCGCACAGCTGG - Intronic
1144443658 17:15306865-15306887 AGCAGAGAGGTGCCTCCAGTTGG + Intronic
1144492835 17:15729542-15729564 AGCATGGAGGGCCATTCAGTAGG - Intergenic
1144867645 17:18347176-18347198 AGCAACCAGGTCACTACAGTTGG - Intronic
1146469790 17:33115027-33115049 AGCAGAGAGGTCTTTATAGTGGG + Intronic
1150833865 17:68547034-68547056 AGCAGTAAGGTCTCAACAGTGGG + Intronic
1151402350 17:73864149-73864171 AGCAGGGAGCTACCTGGAGTTGG - Intergenic
1151625501 17:75273037-75273059 AGGAGTCAGGTCCCTACACTTGG - Exonic
1151851651 17:76694157-76694179 AGCAGTGAGCTGCCTAGAGTGGG + Intronic
1152900868 17:82940388-82940410 AGCACGGAGGCCCTCACAGTCGG - Intronic
1153349607 18:4064292-4064314 AGAAGAGGGGTCCCTTCAGTTGG - Intronic
1158512751 18:58106150-58106172 AGCACGGATGTCCCTACACAGGG - Intronic
1160080566 18:75723163-75723185 ATCAGGGAGGTGCTTCCAGTAGG - Intergenic
1160405529 18:78643977-78643999 CACAGGGTGGTCTCTACAGTTGG + Intergenic
1161016978 19:1987981-1988003 TGACGGGTGGTCCCTACAGTGGG - Intronic
1162564014 19:11435259-11435281 AGAGGGGCGGTCCCAACAGTGGG + Intronic
1163688281 19:18724715-18724737 AGCCGGGAGGACCCTACATCGGG - Intronic
925059535 2:880451-880473 AGCAGGCAGGTCCCCTGAGTCGG + Intergenic
926359791 2:12075844-12075866 GGCAGGGTGGTTCGTACAGTAGG + Intergenic
927292662 2:21420059-21420081 TGTAGGGAGGGCCCTGCAGTGGG - Intergenic
932823789 2:74922524-74922546 AGCCTGGAGTTCCCAACAGTGGG + Intergenic
934475150 2:94588598-94588620 AGCAGGGAGGGCACTGAAGTGGG - Intronic
936093299 2:109514566-109514588 ACCAGGGCCGTCCCTAGAGTTGG + Intergenic
936626926 2:114158263-114158285 AGGAGGCAGGGCCCTAGAGTGGG - Intergenic
937179451 2:119977588-119977610 AGCAGGCAGGTCTCTACAGGGGG - Exonic
944262591 2:197693425-197693447 ACCAGGGAGGGCCAGACAGTGGG - Intronic
945101533 2:206266856-206266878 AGCAGCGAGGTGCCAACATTGGG + Intergenic
948002648 2:234580826-234580848 AGCAGCAAGGTCCATACAGCAGG - Intergenic
948616373 2:239201983-239202005 AGAAGGGTGGTCCCTGCAGTTGG + Intronic
1171359750 20:24578735-24578757 AGCAGGGAGCTCCCTGCAGGTGG + Intronic
1178903026 21:36612919-36612941 AGCAGGGCGTTCTCTCCAGTGGG + Intergenic
1180053548 21:45345055-45345077 AACAGGGAGGTCCCTGAAGATGG + Intergenic
1181629067 22:24140991-24141013 AGCAGAGTGGTCCCGACAGGTGG + Intronic
1182760446 22:32718236-32718258 AGCAGGGAGGGCCCTAGAAGGGG - Intronic
1183380895 22:37490039-37490061 AGCAGCCAGGCCCCTTCAGTCGG + Intergenic
1184503488 22:44887905-44887927 GGCATGGAGGTCCCCACCGTAGG - Intronic
1184935179 22:47715992-47716014 AGCTGGGAGTCCCCTGCAGTGGG + Intergenic
1185078123 22:48694243-48694265 AGCAGGGCGGCCCTGACAGTCGG + Intronic
1185310783 22:50153141-50153163 AGCAAGGAGGTCACCACTGTGGG - Exonic
950465961 3:13153786-13153808 GGCAGTGAGGTCTTTACAGTGGG + Intergenic
950630099 3:14276610-14276632 AGCAGGGGTGTCCCTGCAGCTGG + Intergenic
951416175 3:22424606-22424628 AGCAGAAAGTTCCCTACAATGGG + Intergenic
953128683 3:40116422-40116444 GGCAGGGAGTTACTTACAGTAGG - Intronic
955965576 3:64385611-64385633 GGGAGGCAGGTCCCTTCAGTGGG - Intronic
963037792 3:141047619-141047641 AGAAAGGAGGTCACAACAGTGGG + Intergenic
964673406 3:159251416-159251438 AGCAGGGAGCTCCATGCATTTGG - Intronic
967649829 3:191973190-191973212 AGGAAGGAGATACCTACAGTGGG - Intergenic
976145889 4:82042808-82042830 AGCAGGGAGATCCCAATAGTAGG - Intronic
981147613 4:141343461-141343483 AGCAGGTCGGTCCCAACTGTGGG + Intergenic
983778845 4:171642990-171643012 AAGAGGGAGGTCCATTCAGTTGG - Intergenic
985615803 5:920584-920606 AGCTGGGAGGTTCCGATAGTTGG + Intergenic
986136596 5:4985582-4985604 ATCAGGGATTTTCCTACAGTAGG + Intergenic
986255586 5:6100413-6100435 GGTGGGGAGGTCCCTGCAGTGGG - Intergenic
986943650 5:12987796-12987818 ACCAGGGAGGTCACTGCAGCTGG + Intergenic
990944361 5:61234105-61234127 AGCAGCCAGGCCCCTACCGTGGG - Intergenic
993096488 5:83484930-83484952 AGCAGAAAGGTCACTATAGTTGG + Intronic
999243146 5:150138954-150138976 AGAAGGGAGGTCACTGCAGCGGG + Intronic
1000795456 5:165659013-165659035 AGCAGGGTGTTCCCCAAAGTAGG + Intergenic
1002149025 5:177211398-177211420 AGCAGGGAGGTCTCTCTTGTCGG - Exonic
1002997001 6:2296391-2296413 AGGAAGGAGCTCCTTACAGTAGG + Intergenic
1011416738 6:87129695-87129717 AGCAGGGTGGTTCCCAGAGTTGG + Intergenic
1020150950 7:5681229-5681251 GGTAGGGAGGTTCCTACATTAGG - Intronic
1020662432 7:10997726-10997748 ATGAGGGAGGTCCATGCAGTAGG - Intronic
1021878426 7:25070318-25070340 AGGAGGGAGGTCCCCAGAGAGGG + Intergenic
1024085091 7:45886023-45886045 GGCAGTGAGGTCACTGCAGTTGG - Intergenic
1026216148 7:68350889-68350911 AGGAGAGAGGGCCCTGCAGTTGG + Intergenic
1026444421 7:70471706-70471728 AGCAGGGAGGGAAATACAGTGGG + Intronic
1029309663 7:99650866-99650888 AGCAGGGATGACACTACAGTAGG - Intronic
1029435581 7:100562375-100562397 AGCAGGTAGGTACAGACAGTGGG + Exonic
1035070322 7:156139904-156139926 TGCATGGAGGTCCCTCCTGTGGG + Intergenic
1037832355 8:22196997-22197019 AGCAGGGAGGGCCCCAAAGGGGG + Intronic
1037837376 8:22222053-22222075 AGCAGGGAGGGCCCTGGAGAGGG + Intronic
1039951861 8:42179288-42179310 ACCAGGGAGGTCCCTGTTGTGGG + Intronic
1040408656 8:47133650-47133672 AGCAGGAGGGTCCCTGCAGGAGG - Intergenic
1040972533 8:53152355-53152377 AGTAGGAATGTGCCTACAGTGGG + Intergenic
1043977251 8:86597512-86597534 ACCTCGGAGGTCCCTATAGTGGG + Intronic
1044866081 8:96572468-96572490 AGCAGAGAGGTGCCTGCATTCGG + Intronic
1049317323 8:141976261-141976283 AGGAGGGGGGTCCCTGCCGTCGG - Intergenic
1049651008 8:143769682-143769704 AGCAGGGTGGTCCCAACACCAGG - Intergenic
1050867458 9:10520857-10520879 AGCAGGGTGGTCTCAACAGTGGG - Intronic
1053067094 9:35076436-35076458 AGCAAGCAGGTGCCTACAGACGG - Exonic
1053682922 9:40497493-40497515 AGCAGGGAGGGCACTGAAGTGGG + Intergenic
1053932903 9:43125807-43125829 AGCAGGGAGGGCACTGAAGTGGG + Intergenic
1054280792 9:63127435-63127457 AGCAGGGAGGGCACTGAAGTGGG - Intergenic
1054296022 9:63332993-63333015 AGCAGGGAGGGCACTGAAGTGGG + Intergenic
1054394038 9:64637488-64637510 AGCAGGGAGGGCACTGAAGTGGG + Intergenic
1054428687 9:65142700-65142722 AGCAGGGAGGGCACTGAAGTGGG + Intergenic
1054501692 9:65878842-65878864 AGCAGGGAGGGCACTGAAGTGGG - Intronic
1056221149 9:84451737-84451759 AGAAGGGAAGCACCTACAGTAGG + Intergenic
1056750618 9:89348364-89348386 GGAAGGGAGGTCCCCACAGATGG + Intronic
1058663789 9:107290185-107290207 AGCAGGTAGGTAGCTACGGTAGG - Intronic
1061365485 9:130170849-130170871 AGCAGTGAGGGGCCCACAGTGGG - Intergenic
1062158390 9:135066693-135066715 AGCAGGGAGATACATGCAGTTGG + Intergenic
1062371157 9:136239496-136239518 AGCAGGGAGGTCCCCACCTGAGG - Intronic
1200250100 X:154548201-154548223 AGCACGGAGGTCACTATAGCTGG + Intronic