ID: 920460733

View in Genome Browser
Species Human (GRCh38)
Location 1:206137950-206137972
Sequence GTGTAGCTTTTCAGTAAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920460730_920460733 -8 Left 920460730 1:206137935-206137957 CCATCACCAATATTTGTGTAGCT No data
Right 920460733 1:206137950-206137972 GTGTAGCTTTTCAGTAAGGATGG No data
920460729_920460733 -7 Left 920460729 1:206137934-206137956 CCCATCACCAATATTTGTGTAGC No data
Right 920460733 1:206137950-206137972 GTGTAGCTTTTCAGTAAGGATGG No data
920460728_920460733 -2 Left 920460728 1:206137929-206137951 CCTCTCCCATCACCAATATTTGT No data
Right 920460733 1:206137950-206137972 GTGTAGCTTTTCAGTAAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920460733 Original CRISPR GTGTAGCTTTTCAGTAAGGA TGG Intergenic
No off target data available for this crispr