ID: 920463190

View in Genome Browser
Species Human (GRCh38)
Location 1:206158043-206158065
Sequence ATCAGCTAAAAGACACCCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920463184_920463190 28 Left 920463184 1:206157992-206158014 CCAAAACAGCACCTTCAAAGTCA No data
Right 920463190 1:206158043-206158065 ATCAGCTAAAAGACACCCTAGGG No data
920463186_920463190 17 Left 920463186 1:206158003-206158025 CCTTCAAAGTCAGGAGCTACATG No data
Right 920463190 1:206158043-206158065 ATCAGCTAAAAGACACCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920463190 Original CRISPR ATCAGCTAAAAGACACCCTA GGG Intergenic
No off target data available for this crispr