ID: 920468895

View in Genome Browser
Species Human (GRCh38)
Location 1:206209472-206209494
Sequence GCCCCAACCCTACCCCAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 4, 1: 0, 2: 2, 3: 20, 4: 222}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920468886_920468895 27 Left 920468886 1:206209422-206209444 CCCTATAAACCACCTGCTTGCAT 0: 4
1: 0
2: 3
3: 13
4: 143
Right 920468895 1:206209472-206209494 GCCCCAACCCTACCCCAGAGTGG 0: 4
1: 0
2: 2
3: 20
4: 222
920468890_920468895 15 Left 920468890 1:206209434-206209456 CCTGCTTGCATGTGCCCTGAGGA 0: 4
1: 0
2: 0
3: 10
4: 167
Right 920468895 1:206209472-206209494 GCCCCAACCCTACCCCAGAGTGG 0: 4
1: 0
2: 2
3: 20
4: 222
920468885_920468895 30 Left 920468885 1:206209419-206209441 CCTCCCTATAAACCACCTGCTTG 0: 4
1: 0
2: 2
3: 7
4: 115
Right 920468895 1:206209472-206209494 GCCCCAACCCTACCCCAGAGTGG 0: 4
1: 0
2: 2
3: 20
4: 222
920468888_920468895 18 Left 920468888 1:206209431-206209453 CCACCTGCTTGCATGTGCCCTGA 0: 4
1: 0
2: 0
3: 27
4: 226
Right 920468895 1:206209472-206209494 GCCCCAACCCTACCCCAGAGTGG 0: 4
1: 0
2: 2
3: 20
4: 222
920468887_920468895 26 Left 920468887 1:206209423-206209445 CCTATAAACCACCTGCTTGCATG 0: 4
1: 0
2: 0
3: 10
4: 132
Right 920468895 1:206209472-206209494 GCCCCAACCCTACCCCAGAGTGG 0: 4
1: 0
2: 2
3: 20
4: 222
920468892_920468895 1 Left 920468892 1:206209448-206209470 CCCTGAGGAACTCCTGAGGCTTC 0: 4
1: 0
2: 1
3: 25
4: 224
Right 920468895 1:206209472-206209494 GCCCCAACCCTACCCCAGAGTGG 0: 4
1: 0
2: 2
3: 20
4: 222
920468893_920468895 0 Left 920468893 1:206209449-206209471 CCTGAGGAACTCCTGAGGCTTCA 0: 4
1: 0
2: 4
3: 10
4: 173
Right 920468895 1:206209472-206209494 GCCCCAACCCTACCCCAGAGTGG 0: 4
1: 0
2: 2
3: 20
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920468895 Original CRISPR GCCCCAACCCTACCCCAGAG TGG Intronic
900883842 1:5401700-5401722 GCCCCAACCTTACAGCAGGGAGG + Intergenic
903164152 1:21509316-21509338 GCCCCAACCCCTCCCCAGCCCGG - Intergenic
903284525 1:22268483-22268505 GTCCCCACCCTGCCCCAGAGTGG - Intergenic
904279700 1:29410091-29410113 GCCCCAGCCCCACCCCAGCCAGG - Intergenic
904773622 1:32894140-32894162 GCCCGACCCCTCCCCCAAAGGGG + Exonic
905029275 1:34870643-34870665 GTCCCAACCCCCACCCAGAGAGG + Intronic
906250611 1:44308128-44308150 GCCCACACCCTGCTCCAGAGAGG + Intronic
906479568 1:46191205-46191227 GCCCCATTCCTCTCCCAGAGAGG - Intronic
907440328 1:54474821-54474843 GCCCCAAGCCCACCCCAGCTGGG - Intergenic
911798655 1:102106873-102106895 GCCCAAACCCCACCCTAGAAGGG + Intergenic
913681579 1:121190954-121190976 GCCCCAACCCTACCCCAGAGTGG + Intronic
914033414 1:143978591-143978613 GCCCCAACCCTACCCCAGAGTGG + Intergenic
914156031 1:145089380-145089402 GCCCCAACCCTACCCCAGAGTGG - Intronic
915379985 1:155431648-155431670 CCCCCATCCCTCCCCCACAGTGG - Intronic
915917866 1:159951893-159951915 ACCCCAACCCTACCACTGATGGG - Intronic
916920462 1:169460795-169460817 CCCCCAACCCTTCCCCACTGCGG + Intergenic
917519743 1:175737967-175737989 GCCCCAATCTTATGCCAGAGAGG - Intronic
919879459 1:201892182-201892204 CCCCCCACCCCAGCCCAGAGGGG - Exonic
920188856 1:204179561-204179583 GCCCCAGCCCTTTCCCAGCGGGG + Intergenic
920468895 1:206209472-206209494 GCCCCAACCCTACCCCAGAGTGG + Intronic
922615863 1:226960886-226960908 GCTCCAACCCAAACCCACAGGGG - Intronic
922772239 1:228192129-228192151 GCCCCCGCCCTGCCCCACAGTGG - Intergenic
924775839 1:247114048-247114070 GCCCCAACCTTGACCCAGACAGG - Intergenic
1063352090 10:5365221-5365243 GCCACAAGCTTACCCGAGAGTGG - Exonic
1065919014 10:30374630-30374652 GCCCCTCCCCTCTCCCAGAGTGG - Intergenic
1069353079 10:67552665-67552687 TCCCCAACCCAACCCCTGACAGG + Intronic
1069864746 10:71495034-71495056 GCCCCAGCCCTGCCCCTGAGTGG + Intronic
1070479503 10:76868657-76868679 ATCCCAACCCTCCCCCAGACTGG + Intergenic
1070925307 10:80216936-80216958 ACCCCAACCCTAACCCTCAGAGG - Intergenic
1071482305 10:86073947-86073969 TCCCCCACCCTCCCCCAGACTGG - Intronic
1074997428 10:118769979-118770001 GGTCCAACCCTAGCCAAGAGGGG + Intergenic
1075426649 10:122347045-122347067 GCCCCTGCCCTGTCCCAGAGAGG + Intergenic
1075552201 10:123400872-123400894 GCCCAGTCCCTGCCCCAGAGGGG - Intergenic
1076003706 10:126931583-126931605 GCCCCACCCCAACCCCAGTGGGG - Intronic
1077025822 11:439447-439469 GACCCCACCCTACTCCTGAGAGG + Intronic
1077138646 11:1013833-1013855 CTCACAACCCCACCCCAGAGAGG - Intronic
1077145763 11:1043537-1043559 ACCCCAACCCTCCCCCAGATAGG + Intergenic
1080615929 11:33944833-33944855 GCCACAGCCCTGCCTCAGAGGGG - Intergenic
1081669402 11:44934761-44934783 GCCCCAGTCCTGCCCCAGGGAGG - Exonic
1083620526 11:64047190-64047212 TCCCCTCCCCTGCCCCAGAGAGG + Intronic
1083758166 11:64802357-64802379 CCCCCACCCCTACCCCACTGGGG - Intronic
1084179299 11:67438566-67438588 AACCCACCACTACCCCAGAGAGG + Intronic
1087236424 11:95723827-95723849 GCACCAATCCTACCCCTGATGGG + Intergenic
1087605015 11:100366684-100366706 GCCCCTACCCTGCTCCAGAGTGG + Intergenic
1088295775 11:108292242-108292264 TGCCCACCCCTACCCCAGCGTGG - Intronic
1089071975 11:115707590-115707612 CCCCCAACCCCATCCCAGAGAGG + Intergenic
1089525580 11:119094697-119094719 GCCCGAACCCTACCGGAGGGCGG + Exonic
1089715432 11:120354254-120354276 GGCTCAGTCCTACCCCAGAGTGG + Intronic
1091325023 11:134679604-134679626 GCATCAACCCCACCCCAGAAAGG - Intergenic
1091678707 12:2510756-2510778 ACTCCAAACCCACCCCAGAGGGG + Intronic
1095970968 12:47901822-47901844 GCCCCACCCCAACCTCAGACAGG - Intronic
1096785608 12:54015609-54015631 GCCTCAACCCTGACCAAGAGGGG - Intronic
1098097821 12:66978948-66978970 GCCACAACCCAAGCCCACAGAGG + Intergenic
1099178495 12:79451367-79451389 GGCCAAACCCTACCAAAGAGAGG + Exonic
1101950903 12:109174203-109174225 GTCCCAACCCTGCCCTGGAGTGG + Exonic
1103043058 12:117711848-117711870 GGCACAACCCAACCACAGAGGGG - Intronic
1104224672 12:126819893-126819915 GGCCCAACCCTAGCCAATAGGGG + Intergenic
1108185826 13:47887576-47887598 TTACCAACCCTACCCCATAGGGG - Intergenic
1110647285 13:77902666-77902688 GGTCCAACCCTACCCAATAGGGG + Intronic
1111348294 13:86993841-86993863 CCCCCATCCCTAGCCAAGAGAGG + Intergenic
1113778524 13:112962730-112962752 GCCCCAACCCCTACCCAGAGAGG + Intronic
1118137623 14:63046090-63046112 GCCCTTACCCCACCCCGGAGCGG + Intronic
1118289189 14:64504474-64504496 GTCCCAAGCCTACCCTTGAGAGG + Intronic
1119293605 14:73515817-73515839 GCACACACCCTACCCCAGAAAGG - Intronic
1119293669 14:73516292-73516314 GCACACACCCTACCCCAGAAAGG - Intronic
1122599787 14:102915514-102915536 GCTTCAACCCCACCCCAGATGGG - Intergenic
1124145096 15:27117474-27117496 GACCCAACCCTACCCCAAAATGG - Intronic
1124334838 15:28848826-28848848 GCCCCGCCCCTCTCCCAGAGTGG - Intergenic
1126845994 15:52761007-52761029 ACCCCCACCCCACCCCAGAGTGG - Intronic
1128528472 15:68428468-68428490 ACCCCATCTCTACCCCACAGTGG - Intronic
1128688183 15:69702787-69702809 ACCCCAACCCAGCCCCAGACTGG + Intergenic
1129028952 15:72604919-72604941 GCCCCTCCCCTCTCCCAGAGTGG + Intergenic
1129463867 15:75712987-75713009 CCCTCACCCCTGCCCCAGAGAGG - Intergenic
1129877458 15:78984958-78984980 GCCCCAATCCAGCCCCAGGGAGG + Intronic
1130268281 15:82429789-82429811 GCCCCTCCCCTCTCCCAGAGTGG + Intergenic
1131598532 15:93824109-93824131 GCCCCAAACCCACCCCAGTCAGG - Intergenic
1132184282 15:99790839-99790861 GCCCCTCCCCTCTCCCAGAGGGG + Intergenic
1132285245 15:100657947-100657969 GCCCCCTCCCCACCCCACAGTGG + Intergenic
1132434093 15:101782311-101782333 GCCCCTCCCCTGTCCCAGAGTGG - Intergenic
1132766527 16:1537160-1537182 GCCCCACCCCGACCCTAGACTGG - Intronic
1135193031 16:20370379-20370401 GCCCCTACCTTACCCCATCGGGG - Intronic
1136450791 16:30353370-30353392 ACCCCAACCCCTACCCAGAGAGG - Exonic
1137614429 16:49838519-49838541 CCCCCAGCCCCACCCCAAAGCGG + Intronic
1137904562 16:52307453-52307475 GCCCCAACCCAATTGCAGAGGGG + Intergenic
1139390874 16:66605558-66605580 GCGCCACCCCTACCCCACAGCGG - Intronic
1139515024 16:67447604-67447626 GCCCCACCCCCACCCCACAAGGG - Intronic
1141405161 16:83786050-83786072 GCACCATCCCTCCTCCAGAGAGG + Intronic
1141841322 16:86576020-86576042 GCCCCAGCCCCGCTCCAGAGCGG - Intergenic
1142145094 16:88489595-88489617 GGCCCCACCCCACTCCAGAGCGG + Intronic
1142739109 17:1920251-1920273 GCCCCAACCCAACCCCACTTGGG - Intergenic
1142762671 17:2051015-2051037 CCCCCATCCCCACCCCGGAGGGG + Intergenic
1143174864 17:4949935-4949957 ACCGCACCCCTACCCCAGGGTGG + Intronic
1145911658 17:28546813-28546835 GCCCCATCCCTCCCCATGAGGGG - Exonic
1146846064 17:36182945-36182967 GCCCCGACCCCTCCCCAGACCGG + Intronic
1147631484 17:41935125-41935147 GCCCAAACCCTCCTGCAGAGGGG - Intronic
1148716168 17:49717665-49717687 GCCCCAGCTCCTCCCCAGAGTGG - Exonic
1149034155 17:52115670-52115692 GCCCCAGCCCCAACCGAGAGGGG - Intronic
1150004826 17:61463130-61463152 CCCCCCACCCCACCCCAGAGTGG + Intronic
1151277302 17:73045116-73045138 TACCCAAGGCTACCCCAGAGAGG - Intronic
1155021138 18:21897968-21897990 GCCCCAACGCTAAGCCAGGGAGG - Intergenic
1160027584 18:75231173-75231195 GCCCCAAGCCTGGCACAGAGTGG + Intronic
1160673849 19:378263-378285 TCCCTAACCCTACTCCAGGGAGG + Intergenic
1160811451 19:1014697-1014719 GCCCCACTCCAACCCCGGAGGGG + Intronic
1161438301 19:4277155-4277177 ACCCCGACCCTACCCCAAGGAGG - Intergenic
1162345583 19:10116292-10116314 GCCCCGACCCCACCCCAGAGAGG + Intronic
1162562321 19:11423824-11423846 GCCCCCCCCCCACCCCAGACGGG - Intronic
1162948294 19:14056616-14056638 GCCCGAACCCTGCCCCAGCTGGG - Intronic
1163959528 19:20675699-20675721 GGTCCAACCCTACCCAATAGGGG + Intronic
1166996715 19:46722992-46723014 GACCCAGCCCTGCCCCAGGGTGG + Intronic
925308332 2:2865468-2865490 GGCCCGACACCACCCCAGAGAGG - Intergenic
925308451 2:2865798-2865820 GCCCCCACACCACCCCAGACAGG - Intergenic
925308613 2:2866243-2866265 GACCCCACCCCACCCCAGACAGG - Intergenic
925420520 2:3706936-3706958 CTCCCAACCGTACCGCAGAGTGG - Intronic
925876860 2:8318691-8318713 GCCCCAAGCCTGTCCCTGAGAGG - Intergenic
926055955 2:9774161-9774183 GGGCCCACCCTACTCCAGAGTGG + Intergenic
926324560 2:11773258-11773280 GCCCCAAACCGGCCCCAGGGCGG - Intronic
927120988 2:19963130-19963152 ACCCCACCCCTACCACACAGGGG + Intronic
927142404 2:20139535-20139557 CCCCCAGCCCCACCCCAGATAGG + Intergenic
927188009 2:20496394-20496416 GCCCCACCCCAAACCCAGAGTGG - Intergenic
928860985 2:35856760-35856782 CCCCCAACCCCACCCCCGACAGG + Intergenic
929920648 2:46169009-46169031 GCCTCAACCCTCCCTCACAGAGG + Intronic
930928126 2:56846486-56846508 GCTCCAACCCTAGCCAATAGGGG + Intergenic
931762753 2:65431908-65431930 GCCCCCACGCTGCCCCTGAGGGG + Intronic
932573517 2:72950634-72950656 GCCCCACACTTACCTCAGAGAGG - Intronic
933702495 2:85265454-85265476 GCCCAGACCTTCCCCCAGAGGGG + Intronic
933724382 2:85418433-85418455 GCCCCAACCCGGCCCCAGCCTGG + Intergenic
933781967 2:85808870-85808892 GGCCCTGCCCTACCACAGAGGGG + Intergenic
934561046 2:95313449-95313471 GGCCCCACCCTACCCAGGAGAGG + Intronic
936231151 2:110700510-110700532 GACCCCACCCTACCCCAAACTGG - Intergenic
936463186 2:112726302-112726324 GCCCCATCCCACCCCCAGAAAGG - Intronic
937070854 2:119061953-119061975 CCCCCACCCCCACCCCAGGGTGG - Intergenic
937293572 2:120796559-120796581 ATCCCATCCCTACCCCAGAGAGG + Intronic
937428685 2:121820215-121820237 GCCCCAACACTATCCCAAATGGG - Intergenic
937909273 2:127067670-127067692 GCCCCAACCCTGCCCCTAACCGG + Intronic
937954941 2:127416838-127416860 CCCCCAACCCCACCCCAGGTTGG - Intergenic
938599716 2:132824662-132824684 GGCCCCACCCAACCACAGAGGGG - Intronic
938790529 2:134671732-134671754 GCCACAGCCCCACCCCTGAGGGG + Intronic
939356588 2:141110687-141110709 GCCCTAAAACTACCCTAGAGAGG + Intronic
943471418 2:188299014-188299036 GGTCCAACCCTACCCAATAGGGG - Intronic
946860918 2:223999672-223999694 GCCTCACCCCTACCCCAAAAGGG - Intronic
947814555 2:233027585-233027607 GGTCCAACCCTACCCAATAGGGG - Intergenic
947822760 2:233083458-233083480 GCCCCAACCCTCCCCCAACCAGG - Intronic
948485705 2:238279539-238279561 GCCCCAACTCTGGCCCAGTGTGG + Intronic
948796604 2:240406121-240406143 GCCCCAACCCCACACCAGGCAGG + Intergenic
948922528 2:241072444-241072466 GGCGCGACCCTGCCCCAGAGGGG + Intronic
1169208678 20:3753946-3753968 CCCCCACACCCACCCCAGAGAGG + Exonic
1172064121 20:32207468-32207490 GCGCCAACCCGGCCCCAGATAGG - Intronic
1173331570 20:42080081-42080103 GCCCAAGCCCTGCCCCAGGGAGG + Exonic
1173832989 20:46104636-46104658 GCCACAACCATATCTCAGAGTGG - Intergenic
1174287504 20:49483392-49483414 CCCCCAACCCTACCGCAGGAGGG + Intergenic
1175371603 20:58496348-58496370 GCCACAACCCTGCCCCAGGCTGG - Intronic
1175719798 20:61279252-61279274 GCCATAACCCTGCCCCAGTGGGG + Intronic
1175982507 20:62746158-62746180 GCCCCCACACTACCCCAGCCTGG + Intronic
1181111864 22:20607119-20607141 GCCCCAACCCTTCTCCTGACGGG + Intergenic
1181861008 22:25818160-25818182 GCCCCCAGCCCACTCCAGAGGGG - Intronic
1183217021 22:36487324-36487346 GGTCCAACCCTAGCCCATAGGGG - Exonic
1184387215 22:44182967-44182989 CCCCCCACCCTATCCCAGACAGG - Intronic
1185336128 22:50271612-50271634 GCCCCAACCCAGCCCGAGCGAGG - Intergenic
950623456 3:14226495-14226517 CCCCCCACCCTGCCCCACAGCGG + Intergenic
952884885 3:38006265-38006287 GCCCCTAGCCTTCCCCACAGTGG + Intronic
952943716 3:38461638-38461660 CCCCCAACTATACCCCAGGGTGG - Intronic
953334705 3:42084563-42084585 GCCACAACCCACCCCCAGTGGGG - Intronic
953383945 3:42494070-42494092 GCCTCAAACCTTCCCCAGTGGGG + Intronic
953404506 3:42653942-42653964 CCCCCATCCCTATCCCAGGGCGG - Intronic
953418176 3:42734805-42734827 GCCCCACCACCACCCCAGGGAGG + Intronic
953448000 3:42983839-42983861 GCCCCAACCATACCAAACAGAGG + Intronic
954072374 3:48152244-48152266 TCCCCTACCCTACCCTAGCGTGG + Intergenic
960741258 3:120836071-120836093 GCCCCAACTTGACCACAGAGTGG + Intergenic
960997920 3:123351790-123351812 GCTCCCACCCCACCCAAGAGTGG + Intronic
961504386 3:127360591-127360613 GCCCCAGCCCAAGCCCAGATGGG - Intergenic
961862251 3:129926313-129926335 ACCCCAGCCCTACCCCACCGAGG - Intergenic
963891571 3:150641285-150641307 GCCCCCACCCCAACCCCGAGTGG - Intergenic
964526065 3:157616352-157616374 TCACCAATCATACCCCAGAGAGG + Intronic
965628273 3:170704426-170704448 GCCCCCACCCCACCCCCGACAGG + Intronic
965770186 3:172173812-172173834 GCCCCACCCCTCCCCCAGACAGG - Intronic
965787712 3:172353304-172353326 GCACCGTCTCTACCCCAGAGTGG + Intronic
966869096 3:184278409-184278431 GCCCCACCCCTACCCCCGCTCGG + Intronic
967150131 3:186640703-186640725 CCCACATCCCTGCCCCAGAGTGG - Intronic
968230817 3:197003513-197003535 CCCCCACCCCCACCCCAGAGCGG - Intronic
968337348 3:197925154-197925176 ACCCCCACCCTCCCCCACAGGGG - Intronic
968832640 4:2940992-2941014 GCCCCAACCCTGCCCCTTATTGG - Intronic
969519610 4:7668345-7668367 TCCCCATCCCAGCCCCAGAGGGG - Intronic
969876815 4:10141528-10141550 CCCCCACCCCTCCCCCAGGGAGG - Intergenic
970144643 4:13022285-13022307 CCCCCCACCCTACCCCTGACAGG - Intergenic
985482203 5:120605-120627 GCCACAACCCTGCCCCAAATTGG + Intergenic
985631137 5:1014674-1014696 CCCCCAACCCTAGCCTAGACAGG - Intronic
986393685 5:7306836-7306858 GCCCCGCCCCTCTCCCAGAGTGG - Intergenic
988557787 5:32253063-32253085 GCCCCCACCCCACCCACGAGGGG + Intronic
995371866 5:111427491-111427513 GGACCCGCCCTACCCCAGAGGGG + Intronic
996342128 5:122450907-122450929 ACCCCAAGACTACCCCAGTGAGG + Exonic
996939483 5:128986884-128986906 GCCCCCACCAAACCCCAGAAAGG + Intronic
997262716 5:132476755-132476777 ACCCCACCCCTACCCCATATGGG + Intergenic
997445805 5:133939373-133939395 GCCCCCACCCCACCTCAGAGTGG + Intergenic
998169430 5:139863880-139863902 TCCCCACCCCAACCCCACAGGGG - Intronic
999512463 5:152267006-152267028 GTTCCAACCTTACCACAGAGAGG + Intergenic
1002189647 5:177472043-177472065 GTCCCAGCCCTGCCCCAGGGGGG - Intronic
1002709263 5:181184421-181184443 ACCCCTCCCCTACCCCAGCGCGG + Intergenic
1002908568 6:1470799-1470821 GCCCCACTCATACCCCAGGGAGG + Intergenic
1005021496 6:21423436-21423458 GCCTCAACCCTCTCCCAGATTGG + Intergenic
1005946688 6:30600989-30601011 TCCCCACCCCTCCCCCAGCGTGG - Exonic
1007660019 6:43478210-43478232 GCCCCAGTCCAACCCCAGAGCGG + Exonic
1008234376 6:49026267-49026289 GCCCCTATCCTACCCCAGAGTGG + Intergenic
1008496184 6:52136703-52136725 GCCACAGCCGTACCCAAGAGGGG + Intergenic
1009038462 6:58147494-58147516 CCCCCAACCCCACCCCTGACAGG + Intergenic
1009214252 6:60901146-60901168 CCCCCAACCCCACCCCTGACAGG + Intergenic
1010013367 6:71075443-71075465 CCCCCATCCCCATCCCAGAGGGG - Intergenic
1013967826 6:115976288-115976310 GCCCCAATTCTACCCCACACAGG + Intronic
1017747926 6:157463497-157463519 CCCCCAACTCTTCACCAGAGGGG + Intronic
1019576105 7:1738350-1738372 GTCCTAACCCTAACCCACAGGGG - Intronic
1022452383 7:30526487-30526509 GCCCCTCCCCTCTCCCAGAGTGG - Intronic
1023630185 7:42155967-42155989 GCCCCATCTCTACCCCCGGGAGG + Intronic
1023909780 7:44545473-44545495 GCCCCACCCCTTCCCCAGCATGG + Intergenic
1024567893 7:50697819-50697841 ACCCCCACCCCACCCCAGGGAGG + Intronic
1026895720 7:74008927-74008949 GCCCCTACCTTACCTTAGAGAGG - Intergenic
1026903109 7:74047813-74047835 ACCCCAACCCTGCCCCAGCGAGG - Intronic
1030124816 7:106143774-106143796 GCCCGAACCCTGCTCCAGACAGG + Intergenic
1030740877 7:113108472-113108494 GCCCCAACACAACAGCAGAGTGG + Intergenic
1031947608 7:127858067-127858089 ACCCCAACCCCTACCCAGAGAGG - Intronic
1032011084 7:128348481-128348503 GCCTCATCCCTTACCCAGAGTGG - Intergenic
1033595948 7:142857680-142857702 GCCCCAAACCGAGCCCAGACAGG - Intronic
1037882569 8:22580153-22580175 TCACCAGCCCTCCCCCAGAGTGG + Intronic
1038152459 8:24955320-24955342 GCCCCACCCCTCCCACACAGTGG + Intronic
1038451347 8:27641278-27641300 TCCCCATCCCTCCCCCAGACTGG + Intronic
1038571149 8:28663863-28663885 TCCTCAGCCCTGCCCCAGAGAGG - Intronic
1038879760 8:31595704-31595726 GCCTCAGCTCTACCACAGAGTGG - Intergenic
1039219630 8:35315307-35315329 GACCCAAGCCTGCCCCATAGGGG - Intronic
1048256215 8:132906938-132906960 GTCCCAGCCCTAGCCCTGAGAGG - Intronic
1048469236 8:134692406-134692428 GCCCCAGCCCTACCTCAATGGGG + Intronic
1048926433 8:139276548-139276570 GGCCCACCCCTGCCCCTGAGCGG - Intergenic
1051369146 9:16343606-16343628 GCCCCAACCCAGCCTCAGAGTGG + Intergenic
1052362317 9:27573954-27573976 GCGCCAACGCTCCTCCAGAGCGG - Intergenic
1056836443 9:89959592-89959614 GGCCCAGTCCTACCCCACAGCGG + Intergenic
1056963298 9:91145475-91145497 ACCCCAACCCCACCCCAGCTTGG - Intergenic
1057134516 9:92678099-92678121 ACCCCAACTCCACCCCAGTGAGG + Intergenic
1057200141 9:93135325-93135347 GCCCCAGCTCTGCCTCAGAGGGG + Intergenic
1057974804 9:99593914-99593936 ACCTCCACCCTACCTCAGAGGGG - Intergenic
1059971444 9:119672956-119672978 CCCCCAACCCCACCCCTGACAGG + Intergenic
1060520593 9:124291970-124291992 GCACCCACCCCAGCCCAGAGAGG + Intronic
1060656334 9:125374964-125374986 GCCCCAAGGCTCCTCCAGAGAGG - Intergenic
1060759830 9:126237848-126237870 GCCCCCACCCTATTCCAGTGTGG - Intergenic
1061973007 9:134054872-134054894 CCTCCCACCCCACCCCAGAGAGG + Intronic
1185447083 X:264169-264191 TCCCCAACCCTGCCCCTTAGAGG - Intergenic
1187941960 X:24391423-24391445 GCCCCAGCCCGATCCCACAGGGG + Intergenic
1190225820 X:48544291-48544313 GTCCCACATCTACCCCAGAGGGG + Intronic
1191884453 X:65874370-65874392 CCCACAGCCCTTCCCCAGAGCGG - Intergenic
1192313692 X:70036019-70036041 GCCACTACCCTACCCAAGAGAGG - Exonic
1200281325 X:154779387-154779409 GCACCACCCCCAGCCCAGAGAGG + Intronic
1200754527 Y:6977640-6977662 GCCCCAACCTTTACCAAGAGTGG - Intronic