ID: 920472192

View in Genome Browser
Species Human (GRCh38)
Location 1:206240819-206240841
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 4, 1: 0, 2: 1, 3: 5, 4: 112}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920472192_920472196 17 Left 920472192 1:206240819-206240841 CCATAGGGCTGCTGAACCTGACC 0: 4
1: 0
2: 1
3: 5
4: 112
Right 920472196 1:206240859-206240881 ATGTTACTTCTTCCATTCCTTGG 0: 4
1: 0
2: 4
3: 21
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920472192 Original CRISPR GGTCAGGTTCAGCAGCCCTA TGG (reversed) Intronic
900685169 1:3943700-3943722 GTCCAGGCTCAGCAGCCCCATGG + Intergenic
902682060 1:18050556-18050578 GGTTAGGTGCAGAAGCCCTGAGG + Intergenic
902843596 1:19092146-19092168 GGGCAGGTTCATCAGCACAAGGG - Intronic
903071904 1:20730894-20730916 GGTCAGGCGCAGAAGCCCTCTGG + Intronic
903882336 1:26519863-26519885 GTTCAGGGTAAGCAGGCCTATGG + Intergenic
907460406 1:54602176-54602198 GGCCAGGATCAGCACCCCAATGG - Intronic
912148156 1:106820198-106820220 GATGAGGTGCAGCAGCCCTGGGG - Intergenic
913684877 1:121222264-121222286 GGTCAGGTTCAGCAGCCCTATGG - Intronic
914036716 1:144009885-144009907 GGTCAGGTTCAGCAGCCCTATGG - Intergenic
914152738 1:145058062-145058084 GGTCAGGTTCAGCAGCCCTATGG + Intronic
914680136 1:149933346-149933368 GGTTAGGCTCAGCAGACCTAGGG + Intronic
919303333 1:195798669-195798691 GCTCAGGTTCAGGAGGCCAATGG - Intergenic
920472192 1:206240819-206240841 GGTCAGGTTCAGCAGCCCTATGG - Intronic
921961440 1:221039102-221039124 GGTCAGTCTCAGCAGCCCTTTGG - Intergenic
922997233 1:229973680-229973702 AGTCAGGTTCTGCAGCCCCTGGG - Intergenic
1063179184 10:3582033-3582055 AAGCAGGTTCAGCAGCCCCAAGG - Intergenic
1065428850 10:25633246-25633268 GGTCAGATTTAACACCCCTAGGG + Intergenic
1067289843 10:44932713-44932735 TCTCAGGCTCACCAGCCCTAAGG + Intronic
1072256138 10:93622041-93622063 GGTCATGTCCAGCAGTCCAATGG - Exonic
1075778171 10:125001240-125001262 GGGCAGGGTCAGCACCCGTATGG + Intronic
1080837098 11:35949343-35949365 TGGGAGGTTCAGCAGCCCTGAGG + Intronic
1084178819 11:67436695-67436717 GGTCAGGTTCAGCCTCACTGGGG - Intronic
1087508690 11:99061709-99061731 GGTCAGGTGCAGTGGCCCCACGG + Intronic
1102060640 12:109928414-109928436 AGTCTGGTTCAGCAGCTCTGGGG - Intronic
1105511379 13:21054518-21054540 GGGGAGGTGCAGCTGCCCTAGGG - Intronic
1114184643 14:20391230-20391252 GGTCAGCTTCAGCAGCCCTCAGG + Intronic
1115777465 14:36731595-36731617 GGAAAGCTTCAGCAGCCCCAGGG - Intronic
1115936101 14:38554418-38554440 GGTCAAGTGCAGCAGCCATTTGG - Intergenic
1118602864 14:67482605-67482627 GGACAGCTTCAGGAGCCCTTGGG + Intronic
1122088126 14:99320899-99320921 GAGCAGGTGCAGCAGCCCTGTGG - Intergenic
1122088566 14:99323194-99323216 GGGCAGGTGCAGAAGCCCAAAGG + Intergenic
1122116673 14:99531088-99531110 GGTCTCTTTCAGCAGCCCTTTGG + Intronic
1122863612 14:104593674-104593696 GGTCAGGGTCAGAAGCCGTTGGG + Intronic
1128767577 15:70260588-70260610 AGTCTGGTGCGGCAGCCCTAGGG + Intergenic
1128939931 15:71779696-71779718 GGTAACCTTCAGCAGCCATAGGG - Exonic
1129314319 15:74732016-74732038 GGTCAGCTACAGTAACCCTATGG - Intergenic
1129363016 15:75036345-75036367 GATCTGATTCATCAGCCCTATGG - Intronic
1130975202 15:88768573-88768595 CCTCAGGCTCAGCAGCCCCAGGG - Intergenic
1131558308 15:93418232-93418254 GGTTGGGTGCATCAGCCCTAGGG + Intergenic
1133966685 16:10536879-10536901 GGTCAGGTGCAGGAGCACTTTGG - Intronic
1136188518 16:28601751-28601773 TGTCAGGTCCAGCAGCACAATGG - Intergenic
1136190987 16:28614745-28614767 TGTCAGGTCCAGCAGCACAATGG - Intronic
1136580985 16:31150520-31150542 GGTCTGGGACAGGAGCCCTAGGG + Intergenic
1139965289 16:70741944-70741966 GGTCAGGTTCTGCTCCCCCATGG + Intronic
1141509725 16:84504626-84504648 GGTCCGGTCCAGCAGCCCACGGG + Exonic
1142139361 16:88465885-88465907 GGACAGGTGAAGCAGCCATAGGG + Intronic
1142158683 16:88546016-88546038 AGTCAGGTGCAGCAGCCTTCAGG - Intergenic
1151802800 17:76387638-76387660 GGACAGGCCCTGCAGCCCTAGGG - Exonic
1152260803 17:79266029-79266051 GGTCCGGGTGAGCAGCCCTCTGG - Intronic
1163234034 19:16020737-16020759 GGTCAGGTCCCGCAGGCCCAGGG - Intergenic
1163444475 19:17338596-17338618 GGTCAGGTTCAGCTTCCCATTGG - Exonic
1164645303 19:29854951-29854973 GATCAGGTTCAGCTGCCCAAGGG - Intergenic
1165425765 19:35744669-35744691 GTACAGGTTGAGCAGCACTATGG + Exonic
1165879424 19:39032012-39032034 GGCCAGGATCAGCAGCCACAGGG + Exonic
925488844 2:4369205-4369227 GGTCTGCTCCAGCAGACCTAGGG - Intergenic
926331536 2:11829753-11829775 GGTGAGATTCAGCAGGTCTAGGG - Intergenic
927955309 2:27203736-27203758 GGTCAGGTGCACCAGGCCTGAGG + Intronic
930887118 2:56338669-56338691 AGTCAGGCTCAGCTGACCTATGG + Intronic
932049406 2:68383815-68383837 GGTCAGGATCAGCAAGGCTAAGG + Intronic
932421756 2:71605494-71605516 GGTCAGGATCACAAGCCCCATGG - Intronic
936375234 2:111935338-111935360 CGTCAGGTGCGGCAGCGCTAAGG + Intronic
938631536 2:133173046-133173068 GTTCAGGTTCAGGAGCACTGAGG + Intronic
940983152 2:160024912-160024934 GGTCAGGTTCAGTAGCAGCAAGG - Intronic
943013985 2:182489187-182489209 GGGCAGATTCACAAGCCCTAGGG + Intronic
948364454 2:237445796-237445818 GCTCAGGTGCAGGAGCCCCAGGG + Intergenic
948862899 2:240761470-240761492 GGTCAGCTTAGGCAGCCCCATGG - Intronic
948877142 2:240835668-240835690 GGTCACCCTCAGCAGCCCCAGGG - Intergenic
1174795749 20:53521405-53521427 GTTCAGATTCAGCGGCACTAGGG - Intergenic
1174866519 20:54141757-54141779 AGTAAGCTCCAGCAGCCCTATGG + Intergenic
1176190919 20:63809214-63809236 GGGCAAGGTCAGCAGCCCTGGGG + Intronic
1178592717 21:33924929-33924951 CGTCAGGTTCTGCAGCCCCAGGG + Intergenic
1181632213 22:24157185-24157207 GGCCAGGTTGAACACCCCTAGGG - Intronic
1185364888 22:50432921-50432943 GCTCAGGCTCAGCACCCCAAGGG - Intronic
953009289 3:39008932-39008954 AGTCAGGTCCAGTGGCCCTAGGG + Intergenic
953485834 3:43294568-43294590 GTACAGGTTGAGCATCCCTAAGG - Intronic
953886888 3:46719168-46719190 GGTCAGGCTCTGCAGACCCATGG + Intronic
954139871 3:48599332-48599354 GGACAGGCTCAGCACCCCTGGGG - Intronic
954539210 3:51382605-51382627 GGTCAGGTTCAGCAGGCTCCTGG + Exonic
955595710 3:60588210-60588232 GATCAAGTTCAGCTGCCTTAAGG - Intronic
956845421 3:73178020-73178042 GATAATGTTGAGCAGCCCTATGG + Intergenic
957588192 3:82159717-82159739 GCTGCGGTTGAGCAGCCCTAAGG + Intergenic
958921437 3:100110359-100110381 GGTCAGGAGCAGCAACTCTAAGG + Intronic
960437589 3:117646064-117646086 GGTCAGCTTCGTCAGCTCTAAGG - Intergenic
965010279 3:163079052-163079074 GTTGAAGTGCAGCAGCCCTAGGG - Intergenic
970223675 4:13835547-13835569 GTTCAGGTTCAGCTTCCCCAGGG + Intergenic
980733827 4:136856295-136856317 GGTCAGGATGAGAAGCTCTAAGG + Intergenic
993919545 5:93783798-93783820 TTTCAGGTTCACCAGCCCTTAGG + Intronic
1001707981 5:173755763-173755785 GGTCAGGTTTTGAAGCCCAATGG + Intergenic
1008045042 6:46843092-46843114 GCTGAGGTTCAGAAACCCTAAGG - Intergenic
1008617876 6:53243636-53243658 TCTCAGGTTCAGCAGGTCTAGGG + Intergenic
1012917601 6:105187299-105187321 GCTCAGGTCCTGCTGCCCTAAGG - Intergenic
1017914375 6:158819678-158819700 GGCCAGGTGCAGCCGCCCCAGGG - Intergenic
1018850755 6:167588793-167588815 GGCCAGGCTCAGAAGCCCTGCGG + Intergenic
1019506273 7:1393077-1393099 GGTCAGTTTCATCTGCCCCAGGG - Intergenic
1020085678 7:5308983-5309005 GGTCGGGTGCAGCAGCCCCCGGG - Intronic
1023868026 7:44248094-44248116 GCTCAGTTCCAGCAGCACTAGGG + Intronic
1025208633 7:57008181-57008203 GGTCAGGTGCTGCAGCCCCTGGG + Intergenic
1025284190 7:57649259-57649281 GGTCAGCTTCCGGAGCCCCAGGG - Intergenic
1025663314 7:63568697-63568719 GGTCAGGTGCAGCAGCCCCTGGG - Intergenic
1026600386 7:71772828-71772850 GCCCAGGTTCAGAAGTCCTATGG - Intergenic
1031960656 7:127986724-127986746 GGTCAGGAGCAGCAGCCACATGG + Intronic
1032741344 7:134742564-134742586 GGTGTGGTTCAGCAGCCCCCAGG + Intergenic
1033157260 7:138967735-138967757 GGTAAGGTGAAGCAGCCCCAAGG + Intronic
1035301446 7:157900205-157900227 GGTCAGGCTCGGCAGGCCCACGG + Intronic
1036676924 8:10841713-10841735 CATCTGGTTCAGCAGGCCTAGGG + Intergenic
1039629227 8:39090647-39090669 GGTCACTTTCAGCAGCCTAAAGG - Intronic
1044068260 8:87723999-87724021 GGTAAGGTTCAGCTGCACTGAGG + Intergenic
1047926500 8:129687865-129687887 GGTCACGTTCAGAGGTCCTAAGG - Intergenic
1047952720 8:129948477-129948499 GGTGTGGTTCAGCAGCACGAAGG + Intronic
1049200864 8:141339931-141339953 GGCCTGGGTCTGCAGCCCTACGG - Intergenic
1049431100 8:142565422-142565444 GGTCAAGTGCAGCAGCTCTTGGG + Intergenic
1049436193 8:142587319-142587341 GTCCAGGCTCAGCAGCCCCAAGG - Intergenic
1053652526 9:40183665-40183687 GCTGAGGTTCAGAAACCCTAGGG + Intergenic
1053902926 9:42812972-42812994 GCTGAGGTTCAGAAACCCTAGGG + Intergenic
1054532055 9:66192556-66192578 GCTGAGGTTCAGAAACCCTAGGG - Intergenic
1055014644 9:71602961-71602983 GGACAGCTTCAACAACCCTATGG + Intergenic
1056712459 9:89001863-89001885 GGTGAAGTCCAGCAGCCGTAAGG + Exonic
1058211678 9:102177251-102177273 GGCCAGGTTCAGCAGCGACAAGG + Intergenic
1059204096 9:112447030-112447052 AGAGAGGTTCAGCAGCTCTAAGG - Intronic
1062469433 9:136696076-136696098 GAACAGGTTCACCAGCCCTGCGG - Intergenic
1186792311 X:13011164-13011186 GATGAGGGTCAGCACCCCTAGGG - Intergenic
1188331452 X:28876540-28876562 GCTCAGAATCAGCAGCTCTAGGG - Intronic