ID: 920478235

View in Genome Browser
Species Human (GRCh38)
Location 1:206297552-206297574
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 3, 1: 0, 2: 0, 3: 1, 4: 49}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920478235_920478240 9 Left 920478235 1:206297552-206297574 CCCAATGGGGAGCGCGGGCTGAT 0: 3
1: 0
2: 0
3: 1
4: 49
Right 920478240 1:206297584-206297606 GTGCTGGCAACAGAGCCTGTGGG 0: 3
1: 0
2: 1
3: 18
4: 206
920478235_920478237 -7 Left 920478235 1:206297552-206297574 CCCAATGGGGAGCGCGGGCTGAT 0: 3
1: 0
2: 0
3: 1
4: 49
Right 920478237 1:206297568-206297590 GGCTGATCTGCTCCACGTGCTGG 0: 3
1: 0
2: 2
3: 8
4: 181
920478235_920478239 8 Left 920478235 1:206297552-206297574 CCCAATGGGGAGCGCGGGCTGAT 0: 3
1: 0
2: 0
3: 1
4: 49
Right 920478239 1:206297583-206297605 CGTGCTGGCAACAGAGCCTGTGG 0: 3
1: 1
2: 2
3: 11
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920478235 Original CRISPR ATCAGCCCGCGCTCCCCATT GGG (reversed) Intronic
901068260 1:6504924-6504946 TTCAGCCTGCGGTCCACATTGGG - Intronic
902333477 1:15742326-15742348 TGCTGCCCGGGCTCCCCATTTGG - Intergenic
913690913 1:121279077-121279099 ATCAGCCCGCGCTCCCCATTGGG - Intronic
914146627 1:145000886-145000908 ATCAGCCCGCGCTCCCCATTGGG + Intronic
920478235 1:206297552-206297574 ATCAGCCCGCGCTCCCCATTGGG - Intronic
1067223070 10:44357648-44357670 CTCAGCCCAGGCTGCCCATTTGG - Intergenic
1081449260 11:43156702-43156724 ATCACCCCCCTCTCCCCTTTTGG + Intergenic
1093666954 12:21825684-21825706 ATCAACCCGTGATCCACATTGGG - Intronic
1093835082 12:23819527-23819549 ATCAGCCCGTGATCTACATTAGG + Intronic
1096186806 12:49586944-49586966 ATCAGGACCCTCTCCCCATTGGG + Intronic
1102144584 12:110645231-110645253 TTCAGCCCGCGCTCCCACTCAGG - Intronic
1105303738 13:19155448-19155470 ACCAGCACGTGCTCCCCAGTGGG + Intergenic
1106755889 13:32822241-32822263 ATCATCCCTCCATCCCCATTTGG - Intergenic
1113629874 13:111874916-111874938 ATCATCCCGCTCTCCCTGTTTGG - Intergenic
1113629877 13:111874948-111874970 ATCATCCTGCTCTCTCCATTTGG - Intergenic
1124953314 15:34343082-34343104 ATAAGCCAGCGGTCCCAATTCGG + Exonic
1125514415 15:40309671-40309693 ATCAGCCCCCTCTCCACTTTGGG + Intergenic
1150287705 17:63963324-63963346 ATTAGCCTGTGCTTCCCATTGGG + Intronic
1154170894 18:12049153-12049175 ATCAACCCCTGCTCCCCTTTGGG - Intergenic
1156975765 18:43220006-43220028 ATCACCACCCGGTCCCCATTGGG - Intergenic
1160304221 18:77717148-77717170 CTCAGCCCGTGCCCCCCACTTGG - Intergenic
1162565771 19:11445319-11445341 ATCAGCCCCCGCACCCCACAGGG - Intronic
1163775307 19:19213805-19213827 ATCATCCCGGGCTTCCCCTTGGG - Intronic
1163869726 19:19809993-19810015 ATCAGCCCAGGCTTCTCATTAGG - Intronic
1163874141 19:19852219-19852241 ATCAGCCCAGGCTTCTCATTAGG - Intergenic
1163880189 19:19913276-19913298 ATCAGCCCAGGCTTCTCATTAGG + Intronic
1163903993 19:20135177-20135199 ATCAGCCCAGGCTTCTCATTAGG - Intergenic
1163912478 19:20209195-20209217 ATCAGCCCAGGCTTCCCATTAGG - Intergenic
1163913541 19:20217744-20217766 ATCAGCCCAGGCTTCTCATTAGG - Intergenic
1163921350 19:20292754-20292776 ATCAGCCCAGGCTTCTCATTAGG + Intergenic
1163930598 19:20387240-20387262 ATCAGCCCAGGCTTCTCATTAGG + Intergenic
1163932705 19:20412553-20412575 ATCAGCCCAGGCTTCTCATTAGG - Intergenic
1163936439 19:20448911-20448933 ATCAGCCCAGGCTTCTCATTAGG + Intergenic
1163984383 19:20931332-20931354 ATCAGCCCAGGCTTCTCATTAGG + Intronic
1164021659 19:21312564-21312586 ATCAGCCCAGGCTTCTCATTAGG - Intronic
1166274705 19:41744952-41744974 ACCACCCCGCCCTCCCCACTTGG + Intronic
934545446 2:95211015-95211037 ATCTGCCCGCGTCCCCCAGTTGG - Intronic
943870103 2:192984013-192984035 ATCAGCCCGTCCTCTACATTAGG - Intergenic
946673278 2:222129178-222129200 AGCAGCACGTGCTCCCCATAAGG + Intergenic
1173460990 20:43243279-43243301 ATCTGCCCTCGCTGCCCAGTGGG - Intergenic
1176196365 20:63837943-63837965 ATCAGCACGCGCTCCAGCTTGGG - Intergenic
1182757374 22:32690835-32690857 ATGAGCCCTCGCTTCCCATGTGG - Intronic
950941893 3:16901321-16901343 ATCAGCACCAGCTCCCCACTGGG - Intronic
958636920 3:96756683-96756705 ATCTGCCAGCACTCCCCATGAGG - Intergenic
965719081 3:171641479-171641501 ATCATCCAGTGCACCCCATTTGG + Intronic
968604684 4:1528666-1528688 ATCAGCCCGCGCTGCAGATCAGG + Intergenic
978545765 4:109871220-109871242 ATGATCCCACGCTCTCCATTAGG - Exonic
984667843 4:182448269-182448291 CTCAGCCCGCGCTCGCCCCTGGG - Intronic
988135491 5:27165528-27165550 ATCAACCCGCCATCTCCATTAGG + Intergenic
997800628 5:136857361-136857383 ATCAACCCGTGATCCACATTAGG - Intergenic
1037877509 8:22555170-22555192 ATCAGCCTGCTCTCCCCAAGCGG - Intronic
1061973474 9:134056767-134056789 CTCAGCCCTCCCTCCCCACTGGG - Intronic
1194749647 X:97670290-97670312 ATCAGCCCGAGCTGCCCACAAGG + Intergenic