ID: 920480613

View in Genome Browser
Species Human (GRCh38)
Location 1:206318498-206318520
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 3, 1: 0, 2: 2, 3: 18, 4: 308}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920480613_920480616 27 Left 920480613 1:206318498-206318520 CCTAGATACATGTGCATACAAAT 0: 3
1: 0
2: 2
3: 18
4: 308
Right 920480616 1:206318548-206318570 ATGCTGTAAATAAATACCTGAGG 0: 3
1: 8
2: 76
3: 613
4: 1692
920480613_920480614 -8 Left 920480613 1:206318498-206318520 CCTAGATACATGTGCATACAAAT 0: 3
1: 0
2: 2
3: 18
4: 308
Right 920480614 1:206318513-206318535 ATACAAATACACAGTGTATTAGG 0: 3
1: 0
2: 2
3: 32
4: 374

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920480613 Original CRISPR ATTTGTATGCACATGTATCT AGG (reversed) Intronic
900566768 1:3336428-3336450 GTTTGCATGCACATGTGTGTTGG + Intronic
900817000 1:4855602-4855624 ATCTGTATACACATGGATATAGG - Intergenic
901205498 1:7493158-7493180 ATTTGTGTGCGCGTGTATGTAGG - Intronic
901568185 1:10136515-10136537 ATCTGTATGCACATTTAACGAGG + Intronic
902102594 1:14004380-14004402 GTATTTATGCACATGTATTTTGG - Intergenic
905008472 1:34730193-34730215 CTGTGTATGCACATCTATTTGGG - Intronic
906006154 1:42472933-42472955 ATGTGTATGTATATATATCTTGG - Intronic
907039943 1:51250502-51250524 ATTTGTTTACACAAGTATGTTGG + Intronic
908588407 1:65600501-65600523 ATTTGTTTTCACACATATCTTGG - Intronic
909148344 1:71967649-71967671 ATTTGTGTGTACGTGTTTCTTGG - Intronic
910011058 1:82462822-82462844 ATTTGTTTTCACATTTTTCTTGG - Intergenic
910171043 1:84377504-84377526 ATGTGTGTGCACATGTTTATGGG - Intronic
910554987 1:88521649-88521671 ATTTGATTCCACATGTATGTAGG - Intergenic
910952869 1:92669892-92669914 ATTTGTATGTAGCTATATCTAGG - Intronic
912942100 1:114054128-114054150 GTGTGTATGTACATGTATGTAGG + Intergenic
913273567 1:117117323-117117345 AATTGTATGCACAAGTTACTGGG + Intronic
913693291 1:121300129-121300151 ATTTGTATGCACATGTATCTAGG - Intronic
914144264 1:144979951-144979973 ATTTGTATGCACATGTATCTAGG + Intronic
916791029 1:168125447-168125469 ATTTGTCTGCACTTATATATTGG - Intronic
917710033 1:177675492-177675514 AATTGGGTGCACATATATCTAGG + Intergenic
918833288 1:189426688-189426710 ATATATATGAACATTTATCTTGG + Intergenic
919116435 1:193285853-193285875 ATTTGGAAGCACATGCATTTTGG + Intergenic
920443561 1:205998439-205998461 ATCTGTGTGCACAGGAATCTAGG + Intronic
920460208 1:206133893-206133915 ATTTGTATACAGATGTATAGGGG - Intergenic
920480613 1:206318498-206318520 ATTTGTATGCACATGTATCTAGG - Intronic
921112532 1:212053042-212053064 ATTTGTATGCATGTGTATAATGG - Intronic
921336989 1:214098084-214098106 ATATGTGTGCACATGTCTTTAGG - Intergenic
923464493 1:234236090-234236112 ATGTATCTGGACATGTATCTGGG - Intronic
924920068 1:248619673-248619695 ATTTGTATATACATATATATGGG - Intergenic
1062873673 10:929198-929220 GCTTGTTTACACATGTATCTGGG - Intronic
1065541589 10:26774684-26774706 ATTTGTATTTAAATATATCTGGG - Intronic
1066324735 10:34346480-34346502 CTTTGTGTGCACAAATATCTAGG + Intronic
1066335631 10:34474760-34474782 ATTTGTATCCACAGGTAGCTAGG - Intronic
1068137067 10:52960713-52960735 TTTTGTATGCACTTGAATTTTGG - Intergenic
1070823568 10:79377312-79377334 ATGTGTGTGCACATGTGTGTGGG + Intergenic
1071471998 10:85990029-85990051 ATCTGTCTGCACTTGGATCTAGG + Intronic
1073146182 10:101283645-101283667 GTGTGTATGCACTTGTATCATGG - Intergenic
1073896452 10:108165761-108165783 CTTTATATGCATAAGTATCTAGG - Intergenic
1074390250 10:113051181-113051203 GTGTGTATGCACATGTATGAAGG - Intronic
1077041955 11:528756-528778 ATGTGTGTGCACGTGTATGTGGG - Intergenic
1077784620 11:5369259-5369281 ATATGTATGCCCATGTGTGTGGG + Intronic
1078762178 11:14260151-14260173 ATTAGTATGCAGATGTATACAGG + Intronic
1078972944 11:16436169-16436191 ATGTTTCTGCACATGTATCCCGG + Intronic
1079676521 11:23233900-23233922 ATTTGTATGAATATATTTCTAGG + Intergenic
1079917475 11:26387710-26387732 CTTTTTATGCACATGTATTTTGG + Intronic
1082745213 11:56953718-56953740 ATTTTTATTCACATGTTTGTGGG - Intergenic
1085137368 11:74104500-74104522 ATGTGTATGTACATGTATGGGGG + Intronic
1085470596 11:76755060-76755082 ATATATATACACATATATCTGGG + Intergenic
1087346649 11:96980138-96980160 ATTTGTATGCAAAAGTATAATGG - Intergenic
1088948861 11:114544409-114544431 ATTTGTATGCATTTGTTTATTGG - Intronic
1089727042 11:120491070-120491092 ATTTATGTTCACATGTATTTGGG - Intergenic
1089777602 11:120849183-120849205 ATTTCTATGCCCATGTGCCTTGG + Intronic
1090401333 11:126450139-126450161 ATGTGTATACACATGTATGTGGG + Intronic
1090484628 11:127102083-127102105 ATTTGTATACATCTGTTTCTAGG - Intergenic
1090708731 11:129365415-129365437 GTTTATATACACATGTATATAGG - Intergenic
1090826402 11:130389837-130389859 ATGTGCATGCACATGTGTATAGG + Intergenic
1091105477 11:132915237-132915259 ACGTGTATACACATCTATCTGGG + Intronic
1091608507 12:1980121-1980143 ATATGTATGCCTATCTATCTTGG - Intronic
1092244391 12:6855422-6855444 ATCTGTATGAACACGTTTCTGGG + Exonic
1092581976 12:9851674-9851696 ATTTGTAACTACATTTATCTAGG + Intergenic
1093907154 12:24706771-24706793 ATTTGTATAAAGATGTAGCTGGG + Intergenic
1095318451 12:40795536-40795558 ATTTATAGGCACATATATATAGG + Intronic
1095527830 12:43149079-43149101 GTATGTATACACATGTATATTGG + Intergenic
1095909541 12:47412109-47412131 TTTTGTTTGCACATTTTTCTGGG + Intergenic
1095957709 12:47816339-47816361 ATATGTATGGACATGTTTTTTGG - Intronic
1097960564 12:65528280-65528302 ATTTGTCAGCACCTTTATCTAGG + Intergenic
1098626166 12:72672210-72672232 TTTGTTTTGCACATGTATCTTGG + Intergenic
1099713406 12:86259297-86259319 ATCAGTCTGCACATGTATCTGGG + Intronic
1099837560 12:87926314-87926336 ATTTCTATCCACAGGCATCTTGG - Intergenic
1100250330 12:92814749-92814771 ATTATTATGCACATGTATGAGGG - Intronic
1100733186 12:97496689-97496711 ATGTGCATGCACATGAAGCTTGG + Intergenic
1101638121 12:106563769-106563791 AATGATATGAACATGTATCTAGG - Intronic
1104929608 12:132331263-132331285 CTGTGTATGCACATGTGTGTAGG + Intergenic
1106986399 13:35357124-35357146 ATTTCCATACACATGTATCATGG + Intronic
1108425854 13:50299430-50299452 ATGTGTGTGTACATGTATATGGG - Intronic
1108786417 13:53908060-53908082 ATATATTCGCACATGTATCTTGG + Intergenic
1109063148 13:57646788-57646810 ATTTATATCCACATTTGTCTAGG + Intronic
1109724798 13:66326187-66326209 ATTTGTATCCACCTGTGTCCTGG - Intronic
1109931199 13:69221163-69221185 ATTTTTATGCCTATGAATCTGGG + Intergenic
1110927705 13:81176465-81176487 ATTTATATGTACATATATGTGGG + Intergenic
1111311884 13:86500335-86500357 ACGTGTATGAAAATGTATCTTGG + Intergenic
1112091486 13:96089357-96089379 ATTTGTATGCAGATGTTTTTTGG - Intergenic
1113059854 13:106310901-106310923 ATTTTAATGTACATGTGTCTGGG + Intergenic
1113354018 13:109560823-109560845 ATGTATCTGTACATGTATCTAGG + Intergenic
1113354020 13:109560850-109560872 ATGTATCTGTACATGTATCTGGG + Intergenic
1113354022 13:109560877-109560899 ATGTATCTGTACATGTATCTGGG + Intergenic
1113354024 13:109560904-109560926 ATGTATCTGTACATGTATCTGGG + Intergenic
1114300724 14:21374793-21374815 TTTTGTATGGACATTTCTCTTGG + Intronic
1114381074 14:22204321-22204343 ACATGCATACACATGTATCTCGG - Intergenic
1114936530 14:27545950-27545972 ATTTGTTCTCACATTTATCTTGG - Intergenic
1115524132 14:34262515-34262537 ATTTGTATGTATATGAATGTGGG - Intronic
1116938238 14:50764497-50764519 TTTTGTATGGGCATATATCTAGG - Intronic
1117622922 14:57606597-57606619 CTTTGTATACACTTGTATGTAGG - Intronic
1118804893 14:69227479-69227501 TTTTGTATGTACATTTTTCTAGG + Intronic
1120089048 14:80309943-80309965 ATTTGTATGCAGAGGTATTGAGG + Intronic
1122764742 14:104059203-104059225 ATTTGTGTGGACATGTTTTTGGG + Intergenic
1126124095 15:45279675-45279697 ATGTGTATGGACATCTTTCTAGG + Intergenic
1126171439 15:45698539-45698561 ATTTGTTGGCTCATGTAACTGGG + Intergenic
1126571359 15:50156307-50156329 ACTTTTATACACATTTATCTAGG + Intronic
1128998738 15:72316173-72316195 GATTGTATGCACATGTGACTGGG - Intronic
1130865214 15:87927764-87927786 ATTTGTTTGCACCTTGATCTTGG + Intronic
1131646052 15:94345988-94346010 ATTTATGTGCACATATATGTGGG - Intronic
1131759002 15:95599548-95599570 ATGTGTGTGCATATGTATATTGG + Intergenic
1132092683 15:98958615-98958637 ATGTGTATGCAAATGTTTCATGG - Exonic
1133352599 16:5111866-5111888 ATATATATGTACATGTATATAGG - Intergenic
1133579846 16:7132885-7132907 ATTTTTATGCACATATGTCAGGG - Intronic
1134377505 16:13691183-13691205 ATTTGTCTGCAAATCTGTCTAGG - Intergenic
1134793886 16:17016598-17016620 AATAGTATGCATATGTATTTTGG + Intergenic
1135845394 16:25913902-25913924 ATGTGTGTGCATATGTATGTAGG + Intronic
1135893252 16:26375894-26375916 ATTTTTATTCATATGTATGTGGG + Intergenic
1137451931 16:48584054-48584076 ATTTGTATCCACTGGTCTCTGGG - Intronic
1138831627 16:60381747-60381769 ATTTGTATGTATGTGTATCAGGG + Intergenic
1142679113 17:1535244-1535266 GTTTGTATGCACACATATATGGG + Exonic
1146913316 17:36661903-36661925 ATATGTATGCATGTGTGTCTGGG - Intergenic
1148112236 17:45151741-45151763 ACTTGTATGTACATTTTTCTGGG + Exonic
1149005343 17:51799392-51799414 CTTTGTTTGCTCATCTATCTGGG + Intronic
1155976972 18:32141511-32141533 ATTAGTCTGCACATGAATCTGGG - Intronic
1156822074 18:41384893-41384915 ATTTGTATGCACATTAAAGTTGG + Intergenic
1157158227 18:45288344-45288366 ATTTGTTTGCTCATGAGTCTAGG - Intronic
1157670644 18:49525588-49525610 ATTTGTATGATTATGTAACTAGG + Intergenic
1159519578 18:69500899-69500921 ATTTATAAACACATGTATTTTGG + Intronic
1160179992 18:76625645-76625667 ATTTGGATGCACAAGTTTCAAGG + Intergenic
1161868319 19:6851099-6851121 ATATGTATACATATGTATGTAGG + Intronic
1163872574 19:19834686-19834708 ATTTTTTTACACATGTATTTTGG + Intergenic
1164601017 19:29563209-29563231 ATTTCTGTCCTCATGTATCTGGG + Intronic
1166126651 19:40718772-40718794 ATTTGTATGTACATTTTTCTAGG + Intronic
1168495574 19:56845623-56845645 ATTCGTATACACATGCAGCTGGG + Intergenic
927061883 2:19431062-19431084 ATTTGTATGCAGGTGTTTTTTGG + Intergenic
927644551 2:24869247-24869269 ATTTGAATGGACATGTTTCTGGG + Intronic
928248082 2:29649457-29649479 ATTTCTATGCACATGAATGAGGG + Intronic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
930540434 2:52699199-52699221 ATGTGTGTGCACATGTGTCCTGG + Intergenic
931603184 2:64024557-64024579 ATGTGTGTACACCTGTATCTAGG + Intergenic
933386115 2:81612548-81612570 ATATGTATGAATGTGTATCTAGG + Intergenic
933859501 2:86450809-86450831 GTTTGTATGCACACTTCTCTGGG - Intronic
933875225 2:86613836-86613858 TTATGTATGCACGTGTGTCTCGG - Intronic
935365177 2:102281708-102281730 TTTTTTATGCACATATATTTGGG + Intergenic
935434749 2:103017743-103017765 ATTTACATGTACATATATCTTGG + Intergenic
935785871 2:106548403-106548425 ATTTGCATGCATATGTCTTTAGG + Intergenic
936074740 2:109394653-109394675 ATGTGTGTGCACATCTATGTAGG + Intronic
937441102 2:121916957-121916979 ATTAGTATGCACGTGGATTTAGG + Intergenic
937919063 2:127117712-127117734 ATATGTATGCCCATGTCTTTAGG - Intergenic
939196731 2:138982329-138982351 ACTCGTATTCACATGTTTCTTGG + Intergenic
939974454 2:148700549-148700571 ATTTGTATGGATCTGTATCTGGG + Intronic
940119437 2:150247063-150247085 ATATGTATGCATATATATATTGG - Intergenic
943856757 2:192804656-192804678 ACTTGTATGCAAATGTTTATAGG + Intergenic
944209337 2:197190175-197190197 ATAGGTATGCATATGTACCTAGG - Intronic
944535833 2:200708675-200708697 GGTTGTATCCAGATGTATCTGGG - Intergenic
945902458 2:215554222-215554244 ATTTGTAGGCAAATATAACTAGG + Intergenic
946554669 2:220842291-220842313 ATATGTATACACATATATGTGGG + Intergenic
946834439 2:223758915-223758937 ATTTGTATACACATCCATATGGG + Intronic
947160162 2:227206710-227206732 ATTTGTATGCACGTGGAGGTTGG + Intronic
1170548813 20:17457907-17457929 ATTTGTGTGCCTATGGATCTAGG - Intronic
1170601914 20:17847808-17847830 GTATGTATGCACATGCATCATGG - Intergenic
1171358621 20:24569688-24569710 ATTTGTTTGCACTTTTTTCTGGG - Intronic
1173572423 20:44086039-44086061 ACATGAATGCACATGTGTCTAGG + Intergenic
1173707896 20:45126016-45126038 ATTTGCATGCTGATGTATTTAGG - Intergenic
1174146800 20:48458034-48458056 GTTTGCATGCACATGTGTCCAGG + Intergenic
1176914185 21:14605026-14605048 ATTTTTATGCACATTGATGTTGG - Intronic
1177021663 21:15867860-15867882 ATATGTATGCCCATTTATTTAGG - Intronic
1177951005 21:27537259-27537281 AATTACATGCACATGTATTTAGG - Intergenic
1177956021 21:27600437-27600459 CACTGTCTGCACATGTATCTTGG - Intergenic
1178101995 21:29279889-29279911 ATTTATATGCACATTTGTTTTGG - Intronic
1178173702 21:30072804-30072826 ATTATCATGCACATGTAACTTGG + Intergenic
1178263638 21:31122423-31122445 ATTTGCATGCTGAAGTATCTAGG + Intronic
1178440753 21:32596374-32596396 ATTTATATGCACATGTATTTTGG + Intronic
1178630009 21:34251495-34251517 ATGTGTGTGCACATGGGTCTGGG + Intergenic
1178900766 21:36596706-36596728 ATCTGTATGCACATTTATAAGGG - Intergenic
1179013740 21:37576306-37576328 CTTTGTATGCAGGTGTATTTAGG + Intergenic
1179191534 21:39126466-39126488 TTTTATATGCACATATATGTTGG - Intergenic
1180172839 21:46068990-46069012 GTGTGTATGCACATGTGCCTGGG + Intergenic
1181914788 22:26271077-26271099 CTTTGGGTGCACATGTGTCTGGG + Intronic
1182052208 22:27322031-27322053 ATTTGCTGGCACTTGTATCTTGG - Intergenic
1182963325 22:34497347-34497369 TTTTGTATGCACCTTGATCTTGG + Intergenic
950457392 3:13100841-13100863 CTTTGTATGCACTTGTTTATGGG - Intergenic
952209167 3:31212015-31212037 ATATGAATGCAAATGTATATAGG - Intergenic
952544240 3:34401358-34401380 ATATGTATGCATGTGTCTCTAGG - Intergenic
952613080 3:35234637-35234659 ATTTCTAGGCACATGTCTCAAGG + Intergenic
953663134 3:44905572-44905594 ATCTGCATGCTCATGTCTCTAGG - Intronic
956002044 3:64739871-64739893 AATTGTATGTTAATGTATCTAGG + Intergenic
956378160 3:68637538-68637560 GATTGTATGCACATTTATTTTGG + Intergenic
956879592 3:73497733-73497755 ATTTGTCTCCATATATATCTAGG + Intronic
957700559 3:83705709-83705731 ATTTATATGTACATGTGTGTAGG - Intergenic
958764857 3:98354610-98354632 ATTTGTCTTCTCATGTATATTGG + Exonic
958813192 3:98886685-98886707 CTTTGGCTGCACATTTATCTAGG + Intronic
959763771 3:110000076-110000098 TTTTGGATGCATATGTATTTAGG + Intergenic
961666237 3:128494642-128494664 GTGTGTATGTGCATGTATCTAGG + Intergenic
961725848 3:128929463-128929485 ATTTGTATGCAAATGTTTATAGG + Intronic
962078387 3:132110122-132110144 ATATGTATGGACTTGTTTCTAGG + Intronic
962841204 3:139234577-139234599 ACATGTATGCACATGGATATGGG - Intronic
962874410 3:139524830-139524852 ATCTGTTGGCACATGTCTCTGGG - Intronic
964220995 3:154344629-154344651 ATTTGGACGCAGATGTACCTGGG + Intronic
964993091 3:162839498-162839520 ACTTGTATGCTCATGTGTCTGGG + Intergenic
965559570 3:170048567-170048589 ATTTGAATGCACATAAACCTTGG + Intronic
965770885 3:172180080-172180102 TTTTGATTGCACATGTACCTTGG + Intronic
965925545 3:173975047-173975069 AATTGTGTTCACATGTTTCTAGG + Intronic
968156245 3:196383264-196383286 ATTTGGATGCATATATATTTAGG - Intronic
968608754 4:1547539-1547561 ATTTGCAGGCACATGTGTCTGGG - Intergenic
969909593 4:10431461-10431483 ATTTGTCTGCACATGTTTTGAGG - Intergenic
970076315 4:12225202-12225224 TTCTGTATGCATATGTATATGGG + Intergenic
970457276 4:16237681-16237703 ATTTGTAAGCATTTGCATCTGGG + Intergenic
970692659 4:18637633-18637655 ATGTGTGTGTACATGTATCTTGG + Intergenic
970820724 4:20209009-20209031 CTTTGCCTGCACATTTATCTTGG + Intergenic
971529503 4:27667557-27667579 ATTTGTGTACAAATGTATGTGGG - Intergenic
971869995 4:32222439-32222461 TTTTGTTTGTACATGTTTCTCGG - Intergenic
972008103 4:34137760-34137782 ATTTATATGCATATATATTTAGG + Intergenic
973102097 4:46285138-46285160 ATGTGTATGCATGTGTATATTGG - Intronic
974881093 4:67757994-67758016 ATGTGTATGAAAATGTATTTGGG + Intergenic
978558266 4:110004195-110004217 GTATGTATGCCCATGTATGTTGG - Intronic
979991869 4:127384333-127384355 ATGTGTATGTATATGTATATAGG - Intergenic
980474497 4:133294838-133294860 AAGTGTATGCATATGCATCTCGG - Intergenic
980903330 4:138925852-138925874 ATTGGAATGCACTTGTATCCAGG + Intergenic
982867824 4:160540371-160540393 ATTTGTATCCACATATAGCCTGG + Intergenic
983305165 4:165975437-165975459 AATTGTTTGTAAATGTATCTAGG - Intronic
983643307 4:169964179-169964201 ATTTTTGCCCACATGTATCTGGG + Intergenic
983686766 4:170419546-170419568 ATTTGTATGAATCTGTTTCTGGG - Intergenic
985628564 5:1003159-1003181 TTTTGTATGCACTTGTTTTTTGG - Intergenic
986232566 5:5880027-5880049 CGTTGTATGCACATGAAGCTGGG + Intergenic
987712201 5:21514987-21515009 ATTTATATGAATATGTATATAGG + Intergenic
988160486 5:27514140-27514162 ATATATATGTACATATATCTGGG + Intergenic
988163792 5:27556387-27556409 ATGTGTATGTGTATGTATCTGGG + Intergenic
988184518 5:27843050-27843072 ATTTATATACACATATATATAGG - Intergenic
988302208 5:29445800-29445822 ATTTATATGAATATGTATATAGG - Intergenic
989207082 5:38821620-38821642 ATGTGTATATACATGTATATAGG - Intergenic
989217732 5:38922555-38922577 AGTTGTATGCACATGGATACAGG + Intronic
990004121 5:50924304-50924326 ATTCGCAGGCACATGTGTCTGGG + Intergenic
990465684 5:56068965-56068987 ATTTGTATCCACTTGAACCTGGG + Intergenic
991762562 5:69934123-69934145 ATTTATATGAATATGTATATAGG + Intergenic
991784763 5:70183983-70184005 ATTTATATGAATATGTATATAGG - Intergenic
991841790 5:70809173-70809195 ATTTATATGAATATGTATATAGG + Intergenic
991877211 5:71184376-71184398 ATTTATATGAATATGTATATAGG - Intergenic
992975099 5:82108371-82108393 ATATATATGCACATATATATAGG - Intronic
994159767 5:96543869-96543891 ATTTGTATGAATCTGTTTCTGGG + Intronic
995315208 5:110762375-110762397 TTATGTATACACATGTAACTTGG + Exonic
995366931 5:111372614-111372636 ATTTATTGGCACATGTAACTGGG - Intronic
996291900 5:121861047-121861069 GCTTGTATACACATGTATATTGG + Intergenic
997136828 5:131335655-131335677 TATTGGATGCACATGTATTTAGG + Intronic
997230806 5:132241264-132241286 ATATGTTTGCACATGTCTTTTGG + Intronic
997482842 5:134201521-134201543 TTTTGTGTGCACATCTACCTAGG + Intronic
997594944 5:135100951-135100973 AGCTCTATGCACATGTATATAGG - Intronic
999430991 5:151525305-151525327 TATTGTATGCACATGTGTGTAGG - Intronic
999924994 5:156365589-156365611 ACATGTATGCATATGTATGTGGG - Intronic
1000420184 5:161029694-161029716 ATCTGTATGCATATGTGCCTAGG - Intergenic
1000711721 5:164587788-164587810 ATTTGTATCTACATATATATGGG - Intergenic
1001660758 5:173390977-173390999 AATTGTCTGCACCTGTCTCTTGG - Intergenic
1002904426 6:1437439-1437461 AGTTGTATGAAGATGTTTCTAGG + Intergenic
1002949075 6:1790704-1790726 ATTTATATCCACATGTACCGAGG + Intronic
1003754230 6:9098487-9098509 ATTTGGATACACATGTATGGTGG - Intergenic
1009005506 6:57781708-57781730 ATTTATATGAATATGTATATAGG - Intergenic
1010158927 6:72829029-72829051 ATATCTATGCAGATGTATTTAGG - Intronic
1010263500 6:73842737-73842759 ATTTGTAATCACATGTCTTTTGG + Intergenic
1010335025 6:74670778-74670800 ACATGTATACAAATGTATCTTGG + Intergenic
1011764383 6:90604443-90604465 ATTTATATGCATATATATTTTGG + Intergenic
1011790851 6:90896633-90896655 ATTGGTATGCAGATGTTTCTTGG + Intergenic
1012688382 6:102281993-102282015 ATTTTTATTGACATGCATCTGGG + Intergenic
1012815094 6:104013799-104013821 ATTTTTCTGCTCCTGTATCTGGG - Intergenic
1013359371 6:109380230-109380252 AATTGTATGCACTTGAATATGGG - Intronic
1013501220 6:110753757-110753779 ATTTGTATGCAACCATATCTTGG + Intronic
1014677221 6:124382020-124382042 ATTTGTATTTAGAGGTATCTGGG + Intronic
1014794489 6:125708401-125708423 ATATGTATTCACATGTATCTTGG - Intergenic
1015293505 6:131564126-131564148 ATACGTCTGCACATGCATCTTGG - Intergenic
1016366898 6:143328828-143328850 ATATGTATGCACACATATCATGG + Intronic
1017109848 6:150922042-150922064 ATTTTTATTCACGTGTAACTAGG - Intronic
1017243018 6:152192417-152192439 TTATGTATGCTCATGTATCCAGG - Intronic
1017569152 6:155724549-155724571 TCTTGTATGCACATATATATGGG - Intergenic
1017967999 6:159283631-159283653 AGCTGTATGCATATGTATATAGG - Intergenic
1018638525 6:165885825-165885847 ATGTGTATGCATATGTGTGTTGG + Intronic
1018854360 6:167664912-167664934 ATGTGTGTGCACATGCATGTGGG + Intergenic
1019214131 6:170431879-170431901 ATTTTTATAAACATTTATCTAGG + Intergenic
1020393039 7:7680941-7680963 AGTTGCATACACATGTATCATGG + Intronic
1020983605 7:15103934-15103956 ATTTATATACATATATATCTAGG + Intergenic
1021059855 7:16098313-16098335 AAATGTATGCATATGTATTTAGG + Intronic
1021597677 7:22334603-22334625 ATATGTATACATATGTATGTTGG - Intronic
1021909663 7:25371952-25371974 AATTCTATACACATGTATCTTGG - Intergenic
1022801304 7:33779934-33779956 TTTTGTATGGAAATGTATTTAGG + Intergenic
1023649377 7:42352417-42352439 ATTTGAATGAACATCTACCTTGG + Intergenic
1025219782 7:57097327-57097349 ATTTTTATGTATTTGTATCTAGG - Intergenic
1026231824 7:68490507-68490529 ATTAGTATGCATATGTGTGTGGG - Intergenic
1026567071 7:71497997-71498019 ATGTGTATGCACATGCGTGTGGG + Intronic
1026918431 7:74137369-74137391 AATTGCATTCACACGTATCTGGG + Intergenic
1027837516 7:83264120-83264142 ATTAGTATCCAGATTTATCTTGG + Intergenic
1028040138 7:86041519-86041541 ATTTGTTTGGGTATGTATCTGGG - Intergenic
1029877068 7:103765296-103765318 ATTTTTCTGCAAATGTGTCTTGG + Intronic
1030302124 7:107984886-107984908 ATTTATTTGCAAATGTAACTGGG + Intronic
1030531850 7:110720862-110720884 ATTTTCATTCACAGGTATCTAGG + Intronic
1030664750 7:112263839-112263861 ATTTATATGCACATTTCTCAGGG - Intronic
1031075617 7:117209340-117209362 TTTTCTATACACATGTATCAAGG - Intronic
1031187997 7:118507522-118507544 TTCTGCATGCACATGTATCCCGG + Intergenic
1031216805 7:118903314-118903336 ATTTGTCTGAAGATTTATCTAGG + Intergenic
1033722101 7:144071586-144071608 GTTTGTAGGCACATGTAACCTGG - Intergenic
1035281044 7:157778555-157778577 ACCTGAATGCACATGTATGTGGG - Intronic
1035907031 8:3523542-3523564 ATCTGTGTGCACATGTGTCTGGG - Intronic
1035907043 8:3524040-3524062 ATGTGTGTGCACGTGTCTCTGGG - Intronic
1036196958 8:6726950-6726972 TTTTATATGCACATTTTTCTAGG - Intronic
1036484701 8:9169071-9169093 ATTTCCATGCACGTGTCTCTTGG + Intergenic
1037333712 8:17770773-17770795 ACTTGTACGCAGATGTTTCTTGG + Intronic
1037382656 8:18303850-18303872 ATTTGTTTTCACATGTTTCTTGG - Intergenic
1038516570 8:28192528-28192550 ATTTGTAAACACGTGTCTCTCGG + Intergenic
1039754062 8:40504109-40504131 GTTTGTATGCACTTATCTCTTGG + Intergenic
1041191245 8:55357261-55357283 GTTTATATGCACATATATTTTGG + Intronic
1041204839 8:55488368-55488390 ATTTGTGTGCACATTTTTGTAGG - Intronic
1042592125 8:70405796-70405818 ATTTGTTTGCAGAGGTATCATGG - Intergenic
1042963944 8:74330855-74330877 GATTGTCTTCACATGTATCTGGG - Intronic
1043068509 8:75607786-75607808 TGGTGTATGAACATGTATCTGGG - Intergenic
1043389263 8:79776369-79776391 GTGTGTATGCACATGTGTGTGGG - Intergenic
1043669626 8:82865821-82865843 ATGTGTTTGCAAATATATCTTGG + Intergenic
1046213304 8:111108249-111108271 ATATGTATATATATGTATCTAGG - Intergenic
1048450407 8:134528530-134528552 ATATGTATGCATGTGTACCTTGG - Intronic
1051649641 9:19308839-19308861 ATTTGTATAAATATGTATCTGGG + Intronic
1051821301 9:21172565-21172587 ATTTGAATTCACATCTATCAAGG + Intergenic
1052326032 9:27217540-27217562 ATTTGAAAACACATGTAGCTGGG + Intronic
1053485525 9:38452105-38452127 GTGTGTGTGCACATGTACCTGGG - Intergenic
1056186479 9:84140230-84140252 ATGTGTATACACATGTGTATAGG + Intergenic
1058169222 9:101659281-101659303 ATTTATATACATATATATCTTGG - Intronic
1058328168 9:103724812-103724834 ATCTATATGAATATGTATCTGGG - Intergenic
1059182892 9:112236071-112236093 ATTTATAGGCACAAGTATGTAGG + Intronic
1060436130 9:123594795-123594817 ATATATATGCACATGCATTTGGG - Intronic
1185652589 X:1659681-1659703 ATATGTATGCACGTGTATGCTGG + Intergenic
1185772476 X:2775156-2775178 ATTTGTGTACACATTTTTCTTGG - Intronic
1186719753 X:12290806-12290828 ATATGTATGCACATGTGTAGGGG - Intronic
1188378380 X:29461528-29461550 GTTTGTATAAACATGTTTCTTGG - Intronic
1190526943 X:51337821-51337843 ATTTGTATGAACTGGTATGTAGG - Intergenic
1191658461 X:63627058-63627080 ATATGTATGTACATATATATAGG + Intergenic
1192365175 X:70466220-70466242 ATTTGTGTGCAAGTGTTTCTTGG + Intronic
1194676425 X:96799477-96799499 ATTTGTATTCATTTTTATCTTGG + Intronic
1196066558 X:111470922-111470944 ACCTGTATCAACATGTATCTTGG - Intergenic
1196961140 X:121003289-121003311 ATTTATATGTATATGTATTTAGG - Intergenic
1197938810 X:131767130-131767152 ATTGGCATGCACAAGTGTCTTGG - Intergenic
1198546727 X:137700276-137700298 ATATGTATACACATGTGGCTGGG - Intergenic
1198818835 X:140623310-140623332 ACATGTATGCATATGTATATAGG + Intergenic
1198834452 X:140787532-140787554 ATTTGTGTGCAGATGTGTTTGGG + Intergenic