ID: 920482321

View in Genome Browser
Species Human (GRCh38)
Location 1:206334507-206334529
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 2, 1: 1, 2: 1, 3: 10, 4: 107}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920482321_920482328 12 Left 920482321 1:206334507-206334529 CCCAGGGACGGGTATTTGGGAGG 0: 2
1: 1
2: 1
3: 10
4: 107
Right 920482328 1:206334542-206334564 TGGATACCCTTTCTTCTCAGTGG 0: 3
1: 0
2: 1
3: 12
4: 169
920482321_920482327 -8 Left 920482321 1:206334507-206334529 CCCAGGGACGGGTATTTGGGAGG 0: 2
1: 1
2: 1
3: 10
4: 107
Right 920482327 1:206334522-206334544 TTGGGAGGGGGAGATCTTTATGG 0: 3
1: 0
2: 2
3: 26
4: 271
920482321_920482331 27 Left 920482321 1:206334507-206334529 CCCAGGGACGGGTATTTGGGAGG 0: 2
1: 1
2: 1
3: 10
4: 107
Right 920482331 1:206334557-206334579 CTCAGTGGCTTATTGCTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920482321 Original CRISPR CCTCCCAAATACCCGTCCCT GGG (reversed) Intronic
900777749 1:4597136-4597158 TCTCCCAAATACAAGTCCCTGGG - Intergenic
901932223 1:12602963-12602985 CCTCCAAAGCACCCATCCCTGGG - Intronic
902118846 1:14144349-14144371 CATCCCAGGTACCCTTCCCTAGG - Intergenic
904541759 1:31238522-31238544 CCTCCCAAATTCCCCTGCCAGGG + Intronic
904606787 1:31702315-31702337 CCACCCCAATACCAGTGCCTGGG - Intronic
910075481 1:83272277-83272299 CCTTCCAAATAATCCTCCCTGGG - Intergenic
913694988 1:121316124-121316146 CCTCCCAAATACCCGTCCCTGGG - Intronic
914142573 1:144963934-144963956 CCTCCCAAACACCCGTCCCTGGG + Intronic
914373603 1:147052144-147052166 TTTCCCAAAGATCCGTCCCTGGG - Intergenic
917488146 1:175474104-175474126 CCTCCCAAAGACACATCTCTGGG - Intronic
920397659 1:205658859-205658881 GCTCCCAAAAACCCTTCTCTAGG + Exonic
920482321 1:206334507-206334529 CCTCCCAAATACCCGTCCCTGGG - Intronic
924810958 1:247401697-247401719 CCTCCCAAATCCCCAGCCCTAGG + Intergenic
1070053664 10:72913502-72913524 CCTCCCAAATAACCGGCTTTTGG - Intronic
1073804040 10:107076647-107076669 TCTCCCAAAAGCCCATCCCTGGG - Intronic
1074813704 10:117129129-117129151 CCTACCAAATGCCAGGCCCTGGG + Intronic
1081982371 11:47276006-47276028 GCTCCCCAGTACCCGTCTCTGGG + Exonic
1089455224 11:118621893-118621915 CCTCCCATATTCCCTTCACTCGG + Intronic
1090048439 11:123357097-123357119 CCTCCCAAATGCCCTTCCCTCGG - Intergenic
1092228420 12:6764078-6764100 GCTCCCAGACACCCCTCCCTGGG + Intronic
1095446570 12:42288223-42288245 TTTCCCAAAGATCCGTCCCTGGG - Intronic
1096490328 12:52009471-52009493 CCTGCCAGTTACCCCTCCCTGGG + Intronic
1100861334 12:98810472-98810494 CCTTCGAAGTACCCGTCTCTGGG + Intronic
1102340799 12:112120216-112120238 CCTCCCAAATCCCTGTATCTGGG + Intergenic
1104977059 12:132556857-132556879 CCCCCCAAACCCCCGTCCCGTGG + Intronic
1105648176 13:22343784-22343806 CCTCCCACAACCACGTCCCTGGG - Intergenic
1106317778 13:28610087-28610109 CCTCCCTAATCCCAGGCCCTGGG + Intergenic
1109688958 13:65860791-65860813 CCTCCCAAATTTTCATCCCTGGG - Intergenic
1114280572 14:21189419-21189441 CCTGCCAAATCCCCCTCTCTGGG + Intergenic
1114877525 14:26739878-26739900 CCTCCTAAATTCCCATCCCCAGG + Intergenic
1117279890 14:54228862-54228884 CCTCCCTATTCCCCATCCCTTGG - Intergenic
1118435516 14:65767557-65767579 CCTCCCAAATAGCCTTCCCAGGG - Intergenic
1119102293 14:71891232-71891254 CTTCCCAAATTCCTGGCCCTGGG - Intergenic
1121523881 14:94604964-94604986 CCTCAAAAACACCCCTCCCTGGG - Intronic
1122546255 14:102524378-102524400 GCTCCCCAACACCCTTCCCTTGG + Intergenic
1129737011 15:77972197-77972219 CCTCCCAAACGCCCCTCCATTGG - Intergenic
1129849070 15:78781438-78781460 CCTCCCAAACACCCCTCCATTGG + Intronic
1131050909 15:89347244-89347266 CCACCCTAAGACCAGTCCCTGGG + Intergenic
1132556141 16:573465-573487 CCTCCCACAAGCCCCTCCCTGGG - Intronic
1137792197 16:51184773-51184795 CCTCCCAAGTACGTGTCCCTAGG - Intergenic
1138295970 16:55885440-55885462 CCTCCCCAATTCCCATCCATAGG - Intronic
1138309583 16:56011881-56011903 CCTGCCCAATACCCGACTCTTGG + Intergenic
1143129118 17:4665015-4665037 TCTCCCAAAGCCCCGTCTCTAGG + Intergenic
1147515795 17:41116325-41116347 CCTCCCAAACACCCCACCCCAGG - Intergenic
1149125043 17:53219048-53219070 CCTCCCAAATACCCCAGCCCTGG + Intergenic
1155124550 18:22859234-22859256 ACTCCCAAGTACCCATCACTGGG - Intronic
1159922420 18:74237872-74237894 CATCCCACATACCCTTCCCAAGG + Intergenic
1160672141 19:370690-370712 CCACCCAAATACCCTTCAGTGGG + Intronic
1162373768 19:10293436-10293458 CCGCCCAAATACCACGCCCTAGG - Intronic
1164579025 19:29422944-29422966 CTTCCCACAGACCCATCCCTGGG + Intergenic
1165933788 19:39376890-39376912 CCTCCAAAATTCCCAGCCCTAGG + Intronic
1168494481 19:56838286-56838308 CCTCCCTCATGCCCGCCCCTGGG + Intronic
926231170 2:11005322-11005344 CCTCCCAGAGACCCCTCCCCAGG - Intergenic
928386494 2:30872884-30872906 CCTCCCAAGACCCGGTCCCTTGG + Intergenic
929859733 2:45666552-45666574 TCTCCCATATCCCCATCCCTGGG + Intronic
930003788 2:46880292-46880314 CCACCAAAATACCTGTCCCCTGG - Intergenic
938932029 2:136095014-136095036 CATCCCAAATAGCTGTGCCTTGG + Intergenic
943613253 2:190060196-190060218 TCTGCCAAATACCAGTGCCTGGG + Exonic
944177409 2:196848464-196848486 CCCCCCAAATTCCCATCCTTTGG + Intronic
944648503 2:201804703-201804725 CCTCCCAAATAGCTGGCACTGGG - Intronic
1169249307 20:4047964-4047986 ACTTCCAAATACCAGTACCTGGG - Intergenic
1169444484 20:5659968-5659990 CCTCCCACACACCCATCCCCTGG - Intergenic
1173053625 20:39589561-39589583 CCTCCCAGAGGCCCATCCCTGGG - Intergenic
1174697677 20:52576805-52576827 CATCCCAAATGCCTGTCCATAGG - Intergenic
1175988551 20:62776444-62776466 CATCCCACACACCTGTCCCTGGG + Intergenic
1176249127 20:64111930-64111952 CCTCCCAAATACCCGAACTTAGG + Intergenic
1183482074 22:38070694-38070716 GCTGCCAAATCCCCCTCCCTGGG + Intronic
954447344 3:50553816-50553838 CCTCCCACCTCCCCGTGCCTGGG + Intergenic
954681908 3:52350416-52350438 CCTCTCTAGTACCCGTCTCTGGG + Intronic
959526840 3:107386974-107386996 TTTCCCAAATCCCCCTCCCTAGG + Intergenic
962194834 3:133352695-133352717 CCTCCCATATACCTTGCCCTAGG - Intronic
967036139 3:185649511-185649533 TTTCCCAAAGATCCGTCCCTGGG + Exonic
967529077 3:190528966-190528988 TCTCCCAAATATCCTGCCCTAGG - Intronic
968641692 4:1717964-1717986 CCTCCCGCATAGCCCTCCCTCGG - Intronic
968964631 4:3763729-3763751 CCCTCCAAATTCCCGTGCCTGGG + Intergenic
969822628 4:9731973-9731995 CCTGCCAAATCCCCCTCCCCGGG - Intergenic
974160469 4:58131921-58131943 GCTCCCAAATGCCCCTTCCTCGG - Intergenic
977160696 4:93631358-93631380 CCTCCCCACTCCCCGACCCTAGG + Intronic
977929865 4:102738521-102738543 TCTCAGAAATCCCCGTCCCTAGG + Intronic
983296167 4:165872271-165872293 GCTCCCAATCACCAGTCCCTTGG + Intergenic
986015156 5:3751189-3751211 CCCGCCAAATACCAGTCCCAAGG - Intergenic
986499606 5:8385139-8385161 CCTCCCAAATCCCAGTCTCTGGG - Intergenic
987301830 5:16604264-16604286 TCTGCCAAATACCCTTACCTTGG + Intronic
989162423 5:38404266-38404288 CCTCCCAAAGGCCCCTCCTTGGG - Intronic
991728366 5:69559554-69559576 CCTCCCAAATCACCATGCCTGGG + Intergenic
991804795 5:70414701-70414723 CCTCCCAAATCACCATGCCTGGG + Intergenic
991866589 5:71068321-71068343 CCTCCCAAATCACCATGCCTGGG - Intergenic
992382817 5:76255614-76255636 CCTACCAAATCCCAGTCCGTGGG + Intronic
993449868 5:88060293-88060315 CCTCCCACCTACCCCTCTCTTGG - Intergenic
994822544 5:104672184-104672206 TCTCCCAAATACCCAGCCCATGG - Intergenic
995368868 5:111395859-111395881 CCTGATAAATACCCCTCCCTGGG - Intronic
998512460 5:142724854-142724876 CTGCCCGAATGCCCGTCCCTGGG - Intergenic
1001155568 5:169269712-169269734 CCTCCCTAATTCCTGCCCCTTGG - Intronic
1006863243 6:37187571-37187593 CCTCCCAGATACCCCTGCCCAGG + Intergenic
1007077774 6:39078809-39078831 CCACCCAAAAACCAGTCCCATGG - Intronic
1007925574 6:45646971-45646993 CCTTCCTAAAACCCTTCCCTCGG - Intronic
1008723528 6:54388557-54388579 CCTCCCATTTACCCTACCCTGGG - Intronic
1008919375 6:56825452-56825474 CCTGCCAAATCCCCCTCTCTGGG + Intronic
1014627900 6:123752003-123752025 CCTCCCAAATGCCATTACCTTGG - Intergenic
1017906278 6:158759285-158759307 CCGCCCACAGACCCGCCCCTGGG + Intronic
1018099096 6:160420638-160420660 ACTCCCAACTCCCCGGCCCTGGG - Intronic
1019542761 7:1558991-1559013 CCTCCCGACTGCCCCTCCCTGGG - Intronic
1019710102 7:2514224-2514246 TCTCCCAAATGCCCAGCCCTGGG - Intronic
1020194353 7:6025887-6025909 CCTCCCAAAATCCCATGCCTGGG + Intronic
1025239212 7:57257216-57257238 CCAGCCAAATACCGGTCCTTCGG - Intergenic
1027293201 7:76737154-76737176 CCTTCCAAATAATCCTCCCTGGG - Intergenic
1030267507 7:107635425-107635447 CCTCCCACATACCCTTTTCTTGG + Intergenic
1031632549 7:124062197-124062219 CCTCCCACACACCCTTCCTTAGG - Intergenic
1031969284 7:128052425-128052447 TCTTCCAAATACCCTTTCCTGGG - Intronic
1039916143 8:41861741-41861763 CCTCCCAGATACCTGTCCATGGG - Intronic
1043408922 8:79971519-79971541 CCTCCCATCTTCCCATCCCTAGG + Intronic
1049194605 8:141308400-141308422 CCCCCCGAATCCCCGTCCCGCGG - Intergenic
1050286880 9:4112560-4112582 CATCCGAAGTACCCGTACCTGGG - Intronic
1051179131 9:14392024-14392046 CCTCCCAAAAACCCATCACCCGG + Intronic
1051511925 9:17887917-17887939 CCTCCCAAATTCCTGTCCCCTGG + Intergenic
1053456076 9:38233998-38234020 CCTCCCTAATGCCCTTCCCTGGG - Intergenic
1055945196 9:81687458-81687480 CCGCCCGCATTCCCGTCCCTCGG - Intronic
1060628032 9:125131039-125131061 CCTCCCAAATACCTGGGACTGGG + Intronic
1190454540 X:50614644-50614666 CCTTCCAAATTGCCCTCCCTAGG - Intronic
1198802378 X:140460801-140460823 CCTCCAATAGACCCGACCCTTGG + Intergenic
1200019646 X:153191256-153191278 ACACCCAAATACCCTTCCATGGG - Intergenic