ID: 920485058

View in Genome Browser
Species Human (GRCh38)
Location 1:206362120-206362142
Sequence TCCTCCCCAGGTTAGATGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 2, 1: 1, 2: 1, 3: 7, 4: 91}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920485058 Original CRISPR TCCTCCCCAGGTTAGATGTA AGG Intronic