ID: 920491650

View in Genome Browser
Species Human (GRCh38)
Location 1:206420303-206420325
Sequence CTTGATGACTGGAGGGAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 126}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920491644_920491650 -6 Left 920491644 1:206420286-206420308 CCCATTAATATACCAGTCTTGAT 0: 1
1: 0
2: 1
3: 16
4: 171
Right 920491650 1:206420303-206420325 CTTGATGACTGGAGGGAACCAGG 0: 1
1: 0
2: 0
3: 8
4: 126
920491645_920491650 -7 Left 920491645 1:206420287-206420309 CCATTAATATACCAGTCTTGATG 0: 1
1: 0
2: 2
3: 13
4: 144
Right 920491650 1:206420303-206420325 CTTGATGACTGGAGGGAACCAGG 0: 1
1: 0
2: 0
3: 8
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920491650 Original CRISPR CTTGATGACTGGAGGGAACC AGG Intronic
900089264 1:912573-912595 CATTCTGACTGGAGGGATCCAGG + Intergenic
901919823 1:12528069-12528091 CTGGATGACAGGAGGGAGCCAGG + Intergenic
902290558 1:15432215-15432237 CTTAATGAGAGGAGGGAACCTGG - Intergenic
904035920 1:27558440-27558462 CTTGATGACCTGAGAGAACTGGG - Exonic
904873082 1:33634003-33634025 CCTTATCACTGGAGGGATCCAGG + Intronic
906586916 1:46986020-46986042 CTTGATGAATTGAGAGAAGCAGG + Intergenic
915140810 1:153767498-153767520 CTTGATAACTCAGGGGAACCAGG - Intronic
915537808 1:156548079-156548101 CTTGATGACTGCTGGGAGCCAGG + Exonic
918383753 1:183984519-183984541 CTTGGTGGCTGGCGGGTACCAGG - Intronic
920491650 1:206420303-206420325 CTTGATGACTGGAGGGAACCAGG + Intronic
923225775 1:231937715-231937737 CTTGGGGACTGAAGGGGACCCGG + Intronic
923949253 1:238928680-238928702 GTTAATGACTGAAGGTAACCAGG - Intergenic
1064259947 10:13777383-13777405 CTTGATCACAGGAGGGAGACAGG + Intronic
1067934853 10:50601195-50601217 CTTGGTGACTGGAAGGATGCAGG + Intronic
1067947621 10:50700135-50700157 CTTGAGCAGTGGAGGGCACCTGG - Intergenic
1069649882 10:70038589-70038611 CTTGTTGCCTGGAAGGAACATGG - Intergenic
1069795095 10:71046821-71046843 CTTGGTGACTAGGAGGAACCAGG + Intergenic
1069917964 10:71798777-71798799 CTTGATGTCTGCCGGAAACCTGG + Intronic
1071772494 10:88744527-88744549 CTGGATGACTTCAGGGTACCAGG - Intronic
1075040050 10:119100930-119100952 GGTGATGTCTGGAGGAAACCAGG - Intergenic
1076399318 10:130169831-130169853 CTTCCTGAATGCAGGGAACCTGG + Intronic
1077483050 11:2825470-2825492 CTGGACGACTGGAGGGACACTGG - Intronic
1077745838 11:4904088-4904110 CTTGATGTCTGGAAGGAAAATGG + Intronic
1079739018 11:24034995-24035017 GGTGATGACAGGAGGGACCCAGG - Intergenic
1080447424 11:32350538-32350560 CTTGAAGAATGGGGGGCACCTGG - Intergenic
1081471882 11:43381715-43381737 CTTGGTAACTGGATAGAACCTGG + Intronic
1084665468 11:70573958-70573980 CTTGGTGGCTGGAGAGAAACTGG - Intronic
1085411270 11:76292108-76292130 CTTGGGGACTGGAGGGAGCAGGG - Intergenic
1088760184 11:112922265-112922287 CCTGCTTTCTGGAGGGAACCAGG - Intergenic
1090958451 11:131534855-131534877 CTTGATGACTGGCGTGGACTCGG + Intronic
1091634395 12:2186229-2186251 CTAAATGCCGGGAGGGAACCAGG - Intronic
1091657952 12:2359607-2359629 CTTGGGGACTGGAGAGAACTTGG + Intronic
1092854769 12:12662754-12662776 CCTGATGAGTGAAGGGAACAAGG - Intronic
1096661444 12:53127328-53127350 CTTGAAGACTGAAAGGAAACAGG - Intergenic
1101841322 12:108329308-108329330 CTTGATGAGTGCAGGGAGTCTGG - Intronic
1102333873 12:112060269-112060291 ATTGATGTATGGAGGGAAACAGG - Exonic
1109164593 13:59018203-59018225 CTTGATGAATGAAGGAAACCAGG + Intergenic
1119546003 14:75471894-75471916 CTAGGTCACTGGAGGGACCCTGG - Intronic
1135175792 16:20227629-20227651 CTGGCTGAATGCAGGGAACCTGG + Intergenic
1135889585 16:26345176-26345198 CCTGGAGACTGGAGGGAACATGG + Intergenic
1136668160 16:31832420-31832442 TTTTATGGCTGGAGGGAGCCAGG - Intergenic
1137400948 16:48154080-48154102 CATGATGGCTGCAGGGACCCTGG - Intronic
1137495433 16:48965672-48965694 AATGAAGGCTGGAGGGAACCAGG + Intergenic
1137552824 16:49452369-49452391 CCTGATGTCTGGGGGGAAACGGG - Intergenic
1137808295 16:51328803-51328825 ACTGAGAACTGGAGGGAACCTGG + Intergenic
1141177960 16:81733079-81733101 CTGGAGGACAGGAGTGAACCCGG + Intergenic
1141887760 16:86904370-86904392 TATGTTGACTGGAGGGAACAGGG + Intergenic
1151194387 17:72421282-72421304 CTAGATGCCTGGAGGCAACTTGG - Intergenic
1152301322 17:79496615-79496637 CTTGAGGACAGGAGGCAAACAGG + Intronic
1152626627 17:81390645-81390667 CCTGGTGCCTGGAGGGAACAGGG - Intergenic
1155147558 18:23096768-23096790 CTCAGTGAGTGGAGGGAACCAGG + Intergenic
1156020873 18:32597959-32597981 CTTGCTGGCTGGATGGAAGCTGG + Intergenic
1158623399 18:59051443-59051465 TGAGATGACTGGAGGGACCCCGG + Intergenic
1161563500 19:4986608-4986630 CGTGAGGACTGGAGAGAGCCTGG + Intronic
1165453113 19:35896570-35896592 TTTTCTGACGGGAGGGAACCAGG - Intronic
1165975387 19:39671833-39671855 TCCGATGACTGGAGGGAACCAGG - Intergenic
1166384730 19:42374523-42374545 CTTGGTGCCTGGAGTGACCCTGG + Intronic
1167342599 19:48924715-48924737 CAGGATGACTTCAGGGAACCAGG + Intergenic
925900021 2:8502608-8502630 CTTGAGGACTGGAGGGCCCACGG - Intergenic
928690057 2:33789979-33790001 CATAATAACTGCAGGGAACCAGG + Intergenic
929878419 2:45816137-45816159 CTTGATGACTGTAGGGATTTTGG - Intronic
930058053 2:47267031-47267053 CATGATGCTTGGAAGGAACCTGG - Intergenic
932837614 2:75051829-75051851 CTTCATGACTGGAGGAACACAGG + Intronic
940936934 2:159506296-159506318 CAGGATGACAGGAGGGAAACTGG + Intronic
941379849 2:164779351-164779373 CTTGATAACTTGAAGGAATCTGG + Intronic
1169992848 20:11522852-11522874 CTTGTTGACTGGAGGCAGGCGGG + Intergenic
1170182615 20:13549208-13549230 CTTGAGGAGTGGAGGGAATAGGG - Intronic
1171056232 20:21909532-21909554 GGTGATGACTGGTGGGAGCCAGG - Intergenic
1175018769 20:55821998-55822020 ATTGATGACTGAAGAAAACCAGG - Intergenic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1175888797 20:62306985-62307007 CTGGAGGACTGGAGGGAGCTGGG + Intronic
1179403757 21:41108668-41108690 CCTCATGGCTGGAGGGAAGCTGG + Intergenic
1180075247 21:45458636-45458658 CGTACTGACTGGAGGGACCCGGG + Intronic
1182892423 22:33830066-33830088 CTTGTTGACTGGTGGGCACATGG - Intronic
1183346060 22:37309026-37309048 CAGGCTGAATGGAGGGAACCAGG + Intronic
1184336929 22:43859371-43859393 CTTCAGGACTGGCCGGAACCAGG + Intronic
1185095345 22:48803360-48803382 TTGGATGCCTGGAGGGAGCCGGG - Intronic
949985598 3:9538186-9538208 CTTGATGGGAGGAGGGAGCCCGG - Intronic
950152583 3:10699040-10699062 CTGGAAGGCCGGAGGGAACCAGG - Intronic
953932039 3:47010246-47010268 CTTGCTGAGCGGAGGGAGCCGGG + Intergenic
954201522 3:49026038-49026060 CTTTATGTCTGGAGGGATCTTGG + Intronic
958773563 3:98455001-98455023 CTTTATTTCTGGAGGGAACATGG - Intergenic
962835839 3:139187715-139187737 CTTCATGAATGGATGGATCCAGG + Intronic
966747974 3:183296416-183296438 CTTCAGGGCTGGAGGGAGCCTGG - Intronic
968555335 4:1244066-1244088 CTTGATGCCTCCAGAGAACCTGG - Intronic
971175216 4:24276182-24276204 CTTGTTTACTGGAGGGATTCAGG - Intergenic
972446740 4:39151652-39151674 TTTCATGACTGAAGGGAACAGGG + Intergenic
973265304 4:48204451-48204473 CGTGAAGTCTGGAGGAAACCAGG - Intronic
975664894 4:76725953-76725975 CTAGAAGACTGAAGGGATCCAGG - Intronic
977405660 4:96595002-96595024 CTTGAAGACTGGAGTGATGCAGG - Intergenic
979372727 4:119908313-119908335 CTTGATGCCTTGATGGAGCCTGG + Intergenic
981236043 4:142416724-142416746 ATTGATGACTGAAGCGAAACTGG - Intronic
982223765 4:153147038-153147060 CTTGATTGCAGGAGGGAAACAGG + Intergenic
983096710 4:163571051-163571073 GTTGTTGACTGTAGGGAACCAGG - Intronic
984489444 4:180414396-180414418 CTTAATGACTGGAGGCAGGCAGG + Intergenic
985525524 5:399524-399546 CCTGATCACTGGAGGGTGCCTGG + Intronic
986505396 5:8444753-8444775 CATGCTTACTGCAGGGAACCTGG + Intergenic
986851547 5:11818906-11818928 GGTGATGAGTGGAGGGAAGCAGG + Intronic
992979028 5:82147783-82147805 CTTTCTGACTGGAGGAAACTGGG - Intronic
993054206 5:82962849-82962871 CTTTAAGACTGGAGGAAAACGGG - Intergenic
994719984 5:103369426-103369448 CTAGTTTACAGGAGGGAACCAGG - Intergenic
995337569 5:111018254-111018276 CTTGATAAATGGAGGCAACAAGG - Intergenic
996831269 5:127743160-127743182 CTTGGTGGTTGGAGGGAAGCGGG - Intergenic
997174512 5:131760847-131760869 TTTGATGACAGGAGGGAAAGAGG + Intronic
999853004 5:155563297-155563319 CTTGATGAGAGGTGGGAAACAGG - Intergenic
1001803955 5:174567447-174567469 CTTGATGCCTGGATGGCATCAGG - Intergenic
1005813303 6:29531985-29532007 CCTGAGGACTGCAGGGACCCAGG + Intergenic
1006420561 6:33931281-33931303 CTTGAGGGCTGGAGGGTAGCGGG + Intergenic
1007636469 6:43302640-43302662 CTTCATATCTGGAGGGAAGCGGG - Exonic
1013443957 6:110202105-110202127 CTTGATCACTGAAGGGTATCAGG + Intronic
1014361892 6:120487945-120487967 CTTGATGACTACAGAGAACTGGG - Intergenic
1017186255 6:151603779-151603801 CCTGATGACTAGAGTGAAGCTGG - Intronic
1023870347 7:44260045-44260067 CTTGAGGACTGGAGGGAATAAGG - Intronic
1024231546 7:47367496-47367518 CTTGAGGCCTGGGAGGAACCAGG - Intronic
1027425080 7:78054036-78054058 CTTTATAAGTGGAGGAAACCAGG + Intronic
1028917364 7:96274149-96274171 CTTGATGACTGGGAGGGAGCAGG - Intronic
1033511595 7:142065214-142065236 CTGCGTGACTGGAGGGAACATGG - Intronic
1037957649 8:23071396-23071418 GTAGATGACTGGGGGGATCCAGG + Intergenic
1044817913 8:96131766-96131788 CTTGTTGACTGGACATAACCAGG + Intergenic
1046984957 8:120377055-120377077 CTTGATGACTGATGGGATCTAGG + Intergenic
1050119616 9:2295072-2295094 CTTCATGACTGGAAGGCCCCAGG - Intergenic
1053313624 9:37034955-37034977 CTAGAAGACTGGATGGGACCTGG - Intergenic
1054967031 9:71040965-71040987 CGTGACGACTGGAGGCAACATGG + Intronic
1055634700 9:78264994-78265016 CTTGAGGACTGGAGGAAAGGTGG + Intronic
1056329680 9:85511104-85511126 CCTCATGACTGGAAGGACCCAGG - Intergenic
1057183328 9:93041313-93041335 CTTGATGGCAGGAGGGAGCCTGG + Intergenic
1057987273 9:99729949-99729971 CATGATTTCTGGAGGGAACAGGG - Intergenic
1060896845 9:127224274-127224296 CTTGATGGGTGGCGGGATCCCGG + Intronic
1060908976 9:127333738-127333760 GTTTATGGCTGGAGGGAACGAGG + Intronic
1061814942 9:133188936-133188958 CTTACAGACTGGAGGGGACCAGG - Intergenic
1189773774 X:44451826-44451848 CCTGATGACTGGGGGGAGCTTGG - Intergenic
1192538086 X:71945694-71945716 CCTGAAGACAGGAGGGAAGCAGG + Intergenic
1195592951 X:106653330-106653352 CATGATGACTGGAGGGGATATGG + Intronic
1195671888 X:107477023-107477045 CTAGGTGACTTGAGAGAACCTGG + Intergenic
1201752751 Y:17451234-17451256 CTTGTTGACTGATGGGCACCTGG - Intergenic