ID: 920493023

View in Genome Browser
Species Human (GRCh38)
Location 1:206433164-206433186
Sequence CTGCAAAAAGAAATGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 675
Summary {0: 1, 1: 0, 2: 4, 3: 55, 4: 615}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920493021_920493023 -5 Left 920493021 1:206433146-206433168 CCACGTATCTTCTCATTTCTGCA 0: 1
1: 0
2: 0
3: 15
4: 245
Right 920493023 1:206433164-206433186 CTGCAAAAAGAAATGCAGGAAGG 0: 1
1: 0
2: 4
3: 55
4: 615
920493020_920493023 30 Left 920493020 1:206433111-206433133 CCTTTTATATAAGAGAGAAGAAG 0: 1
1: 0
2: 5
3: 35
4: 416
Right 920493023 1:206433164-206433186 CTGCAAAAAGAAATGCAGGAAGG 0: 1
1: 0
2: 4
3: 55
4: 615

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920493023 Original CRISPR CTGCAAAAAGAAATGCAGGA AGG Intronic
900253707 1:1685436-1685458 AAGGAAAAAGAAATACAGGAAGG + Intronic
901329881 1:8398245-8398267 GTGCAGAAAGAAAAGCAGTAGGG + Intronic
901859781 1:12066947-12066969 ATGAAAAAAGAACTTCAGGATGG - Intronic
902949720 1:19872819-19872841 CTCAAAAAAGAAAGGAAGGAAGG - Intergenic
903202962 1:21758383-21758405 GTACAAAAAGAAATACAGAAAGG + Intronic
903522829 1:23965853-23965875 CTTCAAAAGGAAATGGAGAAGGG + Intronic
903668707 1:25022915-25022937 CTGCAGAGAGAAGTGGAGGAGGG - Intergenic
903757337 1:25671839-25671861 CTCCAGAAAGGAATGCAGCATGG - Intronic
905205968 1:36343006-36343028 CTGAAAAATGAAAAGCAGGAAGG + Intronic
905501058 1:38437256-38437278 CTCAAAAAATAAAGGCAGGAAGG - Intergenic
905531198 1:38680179-38680201 CTCCAGAAAGAAATGCAGCCTGG + Intergenic
906701157 1:47859209-47859231 CAGGAAAAAGAAAGGAAGGATGG - Intronic
907338409 1:53715865-53715887 CTGCAAACAGAAGTGGAGAATGG + Intronic
907369227 1:53989016-53989038 GTGCAAAAAGAAATTGAGGCAGG - Intergenic
908269282 1:62407327-62407349 CTGGTTAAAGAAAAGCAGGAGGG - Intergenic
908701184 1:66902698-66902720 CTGCAAAAATAAATTCAGAATGG - Intronic
909661543 1:78088960-78088982 TGGCAAAAAGAAACACAGGAAGG - Intronic
910192953 1:84612863-84612885 ATACAAATAGAAATGCAGAAAGG + Intergenic
910438713 1:87230982-87231004 CTGAAAAAGGAAATGCATGGCGG - Intergenic
912948288 1:114102944-114102966 CTGCACAGAGACCTGCAGGATGG - Intronic
913219808 1:116650377-116650399 TTGTAAAAGGAAATGCAGAAGGG - Intronic
913345881 1:117810728-117810750 CTGCAGGAAGAACTCCAGGAGGG - Intergenic
913351610 1:117867390-117867412 TTGAAAAAGGAAATACAGGATGG + Exonic
913475641 1:119234692-119234714 CTGCAGGAAGAAATGAAGGAAGG - Intergenic
914905813 1:151742687-151742709 CAACAAAAAGAAATTAAGGATGG + Intergenic
915324530 1:155074078-155074100 CTTAAAAAAGAAAGGAAGGAAGG - Intergenic
915697661 1:157760764-157760786 ATGAAAAAAGAAAGGAAGGAAGG + Intronic
916679707 1:167093291-167093313 CTATTAAAAGAAATGCAGGCAGG + Intergenic
916724987 1:167515521-167515543 CTGAAAAAATATATGCAAGATGG - Intronic
916821061 1:168399308-168399330 GTGGAGAAAGAAATGAAGGATGG - Intergenic
917152601 1:171960804-171960826 CTGGAAGAAAAAAAGCAGGATGG + Intronic
917402553 1:174666739-174666761 TTGCTATAAGAAATACAGGATGG - Intronic
917604605 1:176613913-176613935 CTGCAAAAAGAGATGCTGTTTGG - Intronic
917731415 1:177878682-177878704 CAGGAAAAAGAAATGAAGGTGGG + Intergenic
918815219 1:189172428-189172450 ATGGCAAAAGAAGTGCAGGAGGG + Intergenic
919083127 1:192890458-192890480 CTTCAAAAGGAAAGGCAGGAAGG - Intergenic
919435385 1:197553074-197553096 TGGCAAAACTAAATGCAGGAAGG - Exonic
919872167 1:201829991-201830013 CTCCAAACAGAAATGCACAAAGG - Intronic
920493023 1:206433164-206433186 CTGCAAAAAGAAATGCAGGAAGG + Intronic
920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG + Intergenic
920830226 1:209457993-209458015 CTGCAAAGTGGAAGGCAGGAAGG - Intergenic
921746465 1:218745845-218745867 CTTCACAAAAAAAGGCAGGAAGG + Intergenic
922120031 1:222656591-222656613 ATGCAAAAGAAAAAGCAGGAGGG - Intronic
922243750 1:223775174-223775196 CAGGAAAAAAAAATGCAGGGAGG + Exonic
922650893 1:227337381-227337403 CTGAATAAAGACATGCAGCAAGG + Intergenic
922728241 1:227936046-227936068 CTGCATAACAAGATGCAGGAAGG - Intronic
923205238 1:231752864-231752886 ATGCAAATTGAAATGCAGTAGGG + Intronic
923335219 1:232963405-232963427 CTGCAAGAAGAAAGACATGAAGG - Intronic
923427269 1:233883631-233883653 GTTCAAACAGAAAAGCAGGAGGG - Intergenic
923599506 1:235389825-235389847 CTTTAAAAAGAAATGCAGACTGG + Intronic
924237007 1:242007523-242007545 CTGGAACAAGAAATGAATGAGGG - Intergenic
1063255140 10:4319579-4319601 CTGAAAAAGAAAATGCATGAGGG - Intergenic
1063691598 10:8292845-8292867 CTGGAGGAAGAAATGCAGCACGG - Intergenic
1063845931 10:10126759-10126781 CTTTAAAAAGAAATGCAGATTGG - Intergenic
1064676417 10:17764807-17764829 CTGAAAACAGACATGCAGGTGGG - Intronic
1064712749 10:18142948-18142970 TTGCAAAGAGAATTGAAGGATGG + Intronic
1065371779 10:24994284-24994306 CATCAAGAAGAAATGAAGGAAGG - Intronic
1065995107 10:31052188-31052210 CCCCAAAAAAACATGCAGGAAGG + Intergenic
1066309127 10:34178466-34178488 GGCAAAAAAGAAATGCAGGAGGG + Intronic
1066820319 10:39478842-39478864 ATGCAAAAATAAATTCAGGATGG - Intergenic
1067052884 10:43034205-43034227 ATGCACAAAGGAAGGCAGGAAGG - Intergenic
1067813327 10:49448806-49448828 CCCCAAAAAGCAATGAAGGACGG - Intergenic
1068193225 10:53681617-53681639 GAGCAAAAACAAATGCTGGAGGG - Intergenic
1068219083 10:54020456-54020478 CAAAATAAAGAAATGCAGGAAGG + Intronic
1068790255 10:61021952-61021974 CTGAAAAAAGAACTGCATGTAGG + Intergenic
1068885339 10:62091867-62091889 CTGAAGCAAGAAATTCAGGAGGG + Exonic
1069177915 10:65316963-65316985 CTGCACAAAGAAAATGAGGAAGG + Intergenic
1069312332 10:67053759-67053781 CTGCTAAAGGAATTGCAAGATGG + Intronic
1069976918 10:72221204-72221226 CTTCAAAAAGGATTGCAGGCTGG - Intronic
1071351633 10:84752193-84752215 CTGTAAAAAGTAATAAAGGAAGG - Intergenic
1071749501 10:88458494-88458516 ATGCAGAAAGAACTGCAGGCTGG - Intronic
1071892548 10:90027128-90027150 CTTAAAAAATAAATGCATGAAGG + Intergenic
1072288003 10:93935291-93935313 TTGCAAAAAGAATCACAGGAAGG + Intronic
1072322163 10:94261301-94261323 CTGCAAAAAGCCACGGAGGAAGG - Intronic
1072582903 10:96755516-96755538 CTGCAAAAAGAAACTCCAGATGG + Intergenic
1072709124 10:97704236-97704258 CTCTAAAAAGAAAGGAAGGAAGG + Intergenic
1072914691 10:99530717-99530739 CTGGAAAAAGAAAAGGAGAAAGG - Intergenic
1073359659 10:102887849-102887871 CTGGAAAAAGAAGAGGAGGAAGG - Intronic
1073936995 10:108644626-108644648 GTGCAAAAACAAATGCCGGGAGG - Intergenic
1073985754 10:109206991-109207013 CTTCAAAATGAAATGAAAGATGG + Intergenic
1074025821 10:109633128-109633150 ATGCAAACAAAAATGCAGGCTGG - Intergenic
1074165195 10:110868959-110868981 ATGCAAAAAAAAATGTGGGAGGG - Intergenic
1074532207 10:114305495-114305517 CTGCAGGAGGAGATGCAGGAGGG + Intronic
1074599863 10:114902572-114902594 CTGGAGAAAAAAATCCAGGAAGG + Intergenic
1074631846 10:115265533-115265555 CTGGAAAAAGAAAAGAAGGCAGG - Intronic
1074730578 10:116369387-116369409 TTGGAAAAAGAAACACAGGAAGG - Intronic
1074845288 10:117392269-117392291 CTCAAAAAAGAAAGGAAGGAAGG - Intergenic
1075248125 10:120842563-120842585 CTGCTAACAGAAATGCAATACGG + Intergenic
1075468227 10:122668122-122668144 CTGCAAAAAGAAAAACAAAAAGG - Intergenic
1075849417 10:125574919-125574941 ATACAAAACGAAATGGAGGAGGG - Intergenic
1076246268 10:128949973-128949995 CTTCAGAAAGAAATTCAGGCTGG - Intergenic
1077728287 11:4699593-4699615 CTCCATAAAGAAATGCAGCCTGG + Intergenic
1077969476 11:7173475-7173497 TTGCAAAAAGAAACTCAAGAAGG - Intergenic
1078968682 11:16379168-16379190 TTCAAAAAAGAAATGCAGGCCGG + Intronic
1079960562 11:26918308-26918330 TTACAAAAAGAAAAGAAGGAGGG + Intergenic
1080700113 11:34637518-34637540 CTGCAAAAAGAATTTCAGATTGG + Intronic
1081390849 11:42526940-42526962 CTGAAAAAAAAAATGCAGCCAGG - Intergenic
1081405984 11:42698305-42698327 ATGAAAAAAGAAATGAAGGAAGG + Intergenic
1083096033 11:60252481-60252503 CAGCAAAAACAAATGCAGATGGG + Intergenic
1083570442 11:63758646-63758668 CTGCAAAAAAAAACCAAGGAAGG - Exonic
1083894223 11:65612097-65612119 CAGCAGTAGGAAATGCAGGAGGG - Intronic
1084623870 11:70293264-70293286 CTGGAAAAAGCAATGAAGAAGGG - Intronic
1085164970 11:74390644-74390666 ATGTAAAAAGAACTGGAGGAAGG + Intronic
1085609794 11:77936754-77936776 CTGGAGAAAGAAAGGAAGGAAGG + Intronic
1086113637 11:83224488-83224510 CTGTGTAAAGAAATGCAGGCTGG + Intronic
1086163437 11:83749232-83749254 CTTCAAAAAGAAAGGCAAAAAGG - Intronic
1086408854 11:86523393-86523415 CTCCAACAAGAAAGGCAAGAAGG - Intronic
1087961300 11:104353625-104353647 CATAAAAAAGAATTGCAGGAAGG - Intergenic
1088123741 11:106398773-106398795 CTCCTAAAAGAAAGGAAGGAAGG - Intergenic
1088238334 11:107748976-107748998 TTGCAAAAAGAAACACAGGAAGG + Intergenic
1088436064 11:109814443-109814465 TGGAAAAAAGAAATGAAGGAAGG - Intergenic
1088894591 11:114068220-114068242 CCCCAAGAAGAAATGCAAGAAGG - Intronic
1089445216 11:118546483-118546505 CTGTAAAAAAAAAGGAAGGAAGG + Intronic
1089673783 11:120075258-120075280 ATACAAAAAGAAACACAGGAAGG + Intergenic
1090187778 11:124749533-124749555 CTGCAGAAAGACAGGCAGGAGGG + Intronic
1090677337 11:129011935-129011957 TTGCAAAAAGAAATACTAGAAGG + Intronic
1091083531 11:132696019-132696041 GTGCAAAGAGATGTGCAGGAAGG - Intronic
1091398730 12:170308-170330 CTTCCAAAAGAGAGGCAGGAAGG - Intronic
1091854773 12:3730778-3730800 CTGCAAAAAGAAATCCTGGAAGG + Intronic
1092738839 12:11609620-11609642 CTACAGACAGAAATACAGGAGGG - Intergenic
1093385248 12:18545190-18545212 CTGCAGAAAGAAACCCAGGCTGG - Intronic
1094688657 12:32746880-32746902 CTACAAAAAGGAGAGCAGGAAGG + Exonic
1094868151 12:34564464-34564486 CTGCAAAAGGATATTAAGGAGGG - Intergenic
1096638048 12:52973814-52973836 CTCAAAAAAGAAAGGAAGGAAGG + Intergenic
1096704653 12:53411529-53411551 CTGAGAAGAGAAATGCAGGAAGG - Exonic
1096925590 12:55141197-55141219 CTACAAAAATAAATTCAAGATGG + Intergenic
1097097570 12:56561815-56561837 TTTGGAAAAGAAATGCAGGACGG - Intronic
1097273147 12:57791480-57791502 TTGCAAAAAGAAATACTGAAAGG - Intronic
1099843525 12:87998160-87998182 CTACAGAAAGAAATTCAGGAAGG - Exonic
1100862602 12:98822290-98822312 CTGGAAAAAGAAAGGGAAGAAGG + Intronic
1101655005 12:106712450-106712472 CTGCAAACAGAAACACAGGAAGG - Intronic
1101687385 12:107038480-107038502 CTTATAAAAGAAATGGAGGAAGG + Intronic
1102982879 12:117256254-117256276 CTGCACAAAGAAAATCAGAAGGG + Intronic
1103768382 12:123299886-123299908 CTGTGAAAAGAAAAGAAGGAGGG + Intronic
1103818178 12:123675693-123675715 TTGCATAAAGAAATTCTGGAAGG + Intronic
1104619559 12:130301198-130301220 CTGCAAAGGGAGATGCAGAAAGG - Intergenic
1106000086 13:25714109-25714131 CTGCTAAAAGAAAGAAAGGAAGG + Intronic
1106008056 13:25789957-25789979 CTGGCAAAAGAAATGGAGAAAGG + Intronic
1106231452 13:27824178-27824200 CAGGAAAAAAAAATGCAGGGTGG - Intergenic
1106559517 13:30836329-30836351 CTGCAAAGAGAACGGAAGGAGGG + Intergenic
1106593605 13:31118884-31118906 CAGCACAATGAAATGCATGACGG + Intergenic
1106692794 13:32136508-32136530 CTCCAGAAAAAAAAGCAGGAAGG - Intronic
1107153122 13:37134925-37134947 CTGCAATAAACAATGCGGGAGGG - Intergenic
1107784447 13:43940866-43940888 CTACAAAAAGACAAACAGGAAGG + Intergenic
1108007701 13:45968429-45968451 CTGCATGAAGAATAGCAGGAAGG + Intronic
1108022461 13:46142131-46142153 CTGAAAAAAAAAAAGCAGAAAGG + Intronic
1108347606 13:49561752-49561774 CTACAAAAAAAAAAGCAAGAAGG + Intronic
1108817568 13:54310792-54310814 CTGCAATAAGGAATACTGGATGG + Intergenic
1109613412 13:64796392-64796414 CTTGAAAGAGATATGCAGGAAGG + Intergenic
1110247709 13:73345454-73345476 CTAGAAATAGAAATGAAGGAAGG - Intergenic
1110310057 13:74038460-74038482 CGACAAAAAGCAGTGCAGGAGGG + Intronic
1110757978 13:79198335-79198357 TTGCAAATAGAAATTCAGTATGG - Intergenic
1110820127 13:79905510-79905532 CTGTAAAAAGACATACTGGATGG - Intergenic
1111036895 13:82686570-82686592 TTATAAAAAGAAATGCAGGAAGG + Intergenic
1112595728 13:100805258-100805280 TTGAAAATAGAAATGCATGAGGG - Intergenic
1112659185 13:101487952-101487974 CTGCAAACAGCCATGCAGGGAGG + Intronic
1113060070 13:106313580-106313602 CTGGAAGAACCAATGCAGGATGG + Intergenic
1114465744 14:22921057-22921079 CTGTAAGAAGAAAGACAGGAAGG + Intronic
1114913997 14:27239094-27239116 GTGAATAAAGAAATGCAAGAGGG + Intergenic
1115108864 14:29796857-29796879 CTGCAAAGGGAAATGAAGAATGG + Intronic
1117350486 14:54876786-54876808 CTGCAAAAAGAAACACTGGAAGG + Intronic
1117457797 14:55915140-55915162 CTTCAAAAAGAAAAGCAAGTAGG + Intergenic
1117644455 14:57836777-57836799 CTGCTTAAAGTAATTCAGGAAGG - Intronic
1118416861 14:65548483-65548505 CTGCAAAAAAAAAATCAAGATGG - Intronic
1118813969 14:69295941-69295963 ATGCATAAAGAAATTCTGGAAGG - Intronic
1118991908 14:70804683-70804705 TTGAAAAAATAAATGCAGGGAGG + Intronic
1119852214 14:77874347-77874369 CTGCAAATAGGGTTGCAGGAGGG + Intronic
1119921807 14:78453549-78453571 CTGGAAAAAGGAATGAAGAAAGG - Intronic
1120263121 14:82213822-82213844 TGGCAAAAAAATATGCAGGAAGG + Intergenic
1120990931 14:90376792-90376814 CTGTAAAAAGAGGAGCAGGAAGG - Intergenic
1121742581 14:96264491-96264513 CTGGAATAAGAATTCCAGGAAGG - Exonic
1122029328 14:98901163-98901185 GCTAAAAAAGAAATGCAGGAAGG - Intergenic
1122034321 14:98936406-98936428 CTGATAAAAGAGAGGCAGGAGGG + Intergenic
1122164339 14:99810294-99810316 TTGAACAAAGAAATGAAGGAAGG - Intronic
1122180636 14:99951740-99951762 CTCGAAAAAGAAATACAGGAAGG - Intergenic
1122573355 14:102724209-102724231 CTGCAAAACAAAATGAAGAATGG + Intronic
1122687460 14:103516539-103516561 CTCGAAATAGAAATGCAGAAGGG + Intergenic
1123678607 15:22739067-22739089 TTGCAAAAAGAAAATCAGTAAGG - Intergenic
1124028804 15:25990516-25990538 ACGCTAAAAGAAATGGAGGAAGG - Intergenic
1124366679 15:29076863-29076885 CTAAAAAAAGAAAAGCAGCATGG - Intronic
1124454652 15:29829864-29829886 CTGTAAAAAGAAACACTGGAAGG + Intronic
1124471088 15:29986763-29986785 CTCAAAAAAGAAAAGAAGGAAGG - Intergenic
1125027020 15:35041044-35041066 CTGTAAAAACAAATTCATGATGG - Intergenic
1125181392 15:36883909-36883931 CTGCAAAAGGAAAGGGAGGGGGG + Intergenic
1126200901 15:45984727-45984749 CTCCAGAAAGAAATGCAGTCTGG + Intergenic
1126477742 15:49083829-49083851 CTAAAAAAGGAAGTGCAGGATGG + Intergenic
1127345243 15:58089046-58089068 CTACCAAAAGAAACACAGGAAGG + Intronic
1127359716 15:58234635-58234657 CTTTAAAAAGAAATGTAGGCTGG + Intronic
1127747697 15:61997431-61997453 CTGGATATAGAAATGTAGGAAGG - Intronic
1127793199 15:62416440-62416462 CTGCTAAAGGAATTGCAGAAAGG + Intronic
1128000959 15:64191354-64191376 CCTCAAAAACAAATGCAGGCTGG - Intronic
1128019369 15:64376883-64376905 CTGAAAATAAATATGCAGGAGGG - Exonic
1128805936 15:70531365-70531387 CTCCAAAAAGAAAGGAGGGAGGG + Intergenic
1128947325 15:71836360-71836382 CTGGCAAAAGAAGTGCTGGAAGG + Intronic
1129420989 15:75426627-75426649 GTACAAAAAGAAAAGCAGAAAGG + Intronic
1129655473 15:77521816-77521838 TTGCAAAAAGAAACACAGGAAGG + Intergenic
1129982474 15:79886480-79886502 CTGCAAAGAAAAATGCATGGGGG + Intronic
1130236411 15:82138779-82138801 CTTCAAGAAGAAATGAAAGAAGG - Exonic
1130518021 15:84641132-84641154 CTGCTCAGAGAAAAGCAGGAGGG - Exonic
1131340897 15:91599654-91599676 AAGCAAAAAGAAAAGAAGGAAGG + Intergenic
1131973335 15:97914871-97914893 CAGCAAGAAGAAATGAATGACGG + Intergenic
1132163429 15:99564297-99564319 CAGCAAAAGGAACTGCAGGGAGG - Intergenic
1132165752 15:99587602-99587624 CTGCTGAAAGAAATTAAGGAAGG - Intronic
1133216031 16:4293079-4293101 CTCAAAAAAGAAAAGAAGGAAGG - Intergenic
1133247595 16:4459512-4459534 CTGCAAAAAACAAAACAGGAAGG - Intergenic
1133512756 16:6476010-6476032 CTTCAAAAAGAAAAGCATCAAGG - Intronic
1133779538 16:8927016-8927038 TTGCAAAAAGAAAGGTAGGCCGG + Intronic
1134177317 16:12018098-12018120 TTCCAATAACAAATGCAGGAAGG - Intronic
1135476328 16:22779223-22779245 ATTGAAAAAGAAATGCAGAAAGG + Intergenic
1136067513 16:27768828-27768850 CTGCAGAAAGGAAGGGAGGAAGG - Intronic
1136129286 16:28209666-28209688 CTGAAAGAATAAATGAAGGAAGG + Intronic
1136558187 16:31021417-31021439 CTGCATAAAGAAATTCTGGAAGG - Intergenic
1137236167 16:46620456-46620478 CTGCAAAAATAAATACTGCATGG - Intronic
1138165783 16:54800530-54800552 CCGAAAAAGGAATTGCAGGAAGG - Intergenic
1138177204 16:54911125-54911147 GTGGAAAAAGAAAGGAAGGAAGG - Intergenic
1138218374 16:55226103-55226125 CTGTGAAAAGGAATTCAGGAAGG + Intergenic
1138255386 16:55553781-55553803 CTGCCATAAGAAATGCTGTAAGG - Intronic
1138551289 16:57750079-57750101 TTGGAAAGAGAAATCCAGGAAGG - Intronic
1138569091 16:57856454-57856476 CTAAAAAAAGAAAGGAAGGAAGG + Intronic
1138721446 16:59086725-59086747 AAACAAAAAGAAGTGCAGGATGG - Intergenic
1138726129 16:59141207-59141229 CATCAAAAAGAAAGGAAGGAAGG - Intergenic
1138913905 16:61439401-61439423 ATGTAAAAAGAGATGGAGGATGG + Intergenic
1139013804 16:62665369-62665391 CTGGAAAAAGAAAGGCCAGAAGG - Intergenic
1139368623 16:66450411-66450433 CTGCAAAAATCTTTGCAGGATGG + Intronic
1140454097 16:75094674-75094696 CTGCAAAAAGAAACCTATGAAGG - Intronic
1140456451 16:75108434-75108456 CTGAAAAAAAAAATCCACGAGGG - Exonic
1140775550 16:78246058-78246080 CTGCAAAAAAGAATGAGGGAAGG - Intronic
1140831062 16:78751822-78751844 CTAGAAAAAGAAAGGAAGGAGGG + Intronic
1140905875 16:79408639-79408661 GTGAAAAAAGAAAAGAAGGATGG - Intergenic
1141083211 16:81071811-81071833 ATGAGAAAAAAAATGCAGGAAGG + Intronic
1141517596 16:84556424-84556446 CTGCAAAAAGAGAGGAGGGAGGG + Intergenic
1141730504 16:85819840-85819862 CTGCAAGAAGAGATGCGGGCAGG - Intergenic
1142109287 16:88322714-88322736 CTGCATCAGGAAATGCATGAAGG + Intergenic
1142558630 17:796600-796622 AAAAAAAAAGAAATGCAGGAAGG + Intergenic
1142853477 17:2716782-2716804 CTGCATAAAGATAAGGAGGAGGG + Intergenic
1143230141 17:5346904-5346926 CTGCGGAAAGAATTGCATGAAGG + Exonic
1143355780 17:6327292-6327314 CTCCAAAAAGGAGTGCAGGCAGG + Intergenic
1144406616 17:14958055-14958077 CTGGAAAAAGAATAGGAGGAAGG + Intergenic
1144579151 17:16448124-16448146 CTGCAAACAGATCTGCAGGATGG + Intronic
1145167246 17:20623937-20623959 CTCAAAAAAGAAAGGAAGGAAGG - Intergenic
1145939424 17:28734829-28734851 CTGCACGAAGAAGTGCAGGATGG - Exonic
1146311729 17:31774025-31774047 CTCAAAAAAGAAAAGCAGCATGG + Intergenic
1146422254 17:32698381-32698403 CTTAAAAAAGAAAAGAAGGAAGG - Intronic
1146833886 17:36094341-36094363 CTTTAAAAAGAAAGGAAGGAAGG + Intergenic
1147674936 17:42198635-42198657 ATGCAAAAGAACATGCAGGAAGG - Intergenic
1148286001 17:46392538-46392560 CTACAAAAAGAAAGGAAGAAAGG - Intergenic
1148308168 17:46610128-46610150 CTACAAAAAGAAAGGAAGAAAGG - Intronic
1148900103 17:50868911-50868933 CTGGAAAAAGCAATGAAGGGTGG + Intergenic
1149023569 17:51998377-51998399 CTCCATGAAGAACTGCAGGAGGG - Intronic
1149181412 17:53941996-53942018 CTGCAAAAAGCACTGCACAAAGG - Intergenic
1149376858 17:56052576-56052598 CTGCAAAATTATATTCAGGAGGG + Intergenic
1149959883 17:61096975-61096997 ATGGCAAAAGAAATGCATGAAGG + Intronic
1150186151 17:63183719-63183741 TTAAAAAAAGAAATGCAGGCTGG + Intronic
1150608398 17:66713828-66713850 CTGCAAAGAATCATGCAGGAAGG + Intronic
1150638804 17:66935393-66935415 ATGCAAAAATAAATTCTGGAAGG + Intergenic
1150698423 17:67426001-67426023 CAGCAAAAGGGATTGCAGGAGGG - Intronic
1150922029 17:69494195-69494217 AGGCAAAAAGAAATGGAGGGAGG + Intronic
1151869046 17:76824187-76824209 CTGAAGAGGGAAATGCAGGATGG - Intergenic
1152294719 17:79459965-79459987 CTGCAAAAAGGAATGAGGCATGG + Intronic
1152492578 17:80647486-80647508 GTGGAAAAAGACAAGCAGGAGGG + Intronic
1152753016 17:82074678-82074700 TTGCAGAAAGAAACACAGGAAGG - Intergenic
1152935802 17:83135971-83135993 CTGCAGACAGACATGCAGGGAGG - Intergenic
1152986233 18:323950-323972 CTGGAAAAACAAATGGAGAAAGG - Intronic
1153027256 18:683131-683153 CTTCAACAGGAAATGCAAGAGGG + Intronic
1153276599 18:3373783-3373805 CTGCAAAAAGAAGCTCAAGATGG + Intergenic
1153371829 18:4325847-4325869 ATACAAAAATAAATGCAAGATGG + Intronic
1154955087 18:21245649-21245671 CTGCAAAATCAAAAACAGGAAGG - Intronic
1155500042 18:26479122-26479144 CTGCAAAGAGAAGAGCAAGAGGG + Intronic
1156566325 18:38195656-38195678 CTGTAAACAGAAATCAAGGAAGG - Intergenic
1156620689 18:38847935-38847957 ATTCAAAAAGAAAGTCAGGAAGG - Intergenic
1156693178 18:39733429-39733451 TTGCAAAATGAAATTCAGGCCGG + Intergenic
1156954071 18:42940096-42940118 CTGCATAAACAAATGCATGGGGG - Intronic
1157522337 18:48353895-48353917 CTGCAATGGAAAATGCAGGATGG - Intronic
1159578703 18:70210362-70210384 CTGCACAAATAAATGCAGTAAGG - Intergenic
1159846719 18:73469924-73469946 CTGCAAAAATTAATTCAAGATGG - Intergenic
1161920046 19:7259191-7259213 CTGTAAAAAGAAAGGAAGGAAGG - Intronic
1163286885 19:16354241-16354263 CTAAAAAAAAAAATGCAGGTAGG - Intergenic
1164479529 19:28600832-28600854 CTGCAACATAAAATGCAGCATGG + Intergenic
1164694627 19:30234047-30234069 ATGCATGAAGAGATGCAGGAAGG + Intronic
1164870350 19:31638381-31638403 GAGTAACAAGAAATGCAGGATGG - Intergenic
1165151268 19:33761830-33761852 CTCAAAAAAGAAAGGAAGGAAGG + Intronic
1165241472 19:34471906-34471928 CTGCAAAAATAAAGGCAGGCAGG - Intergenic
1167025792 19:46916945-46916967 AAAAAAAAAGAAATGCAGGAAGG - Intergenic
1168531521 19:57133614-57133636 ATGAAAAAAGAAATGTAGGCCGG + Intergenic
925106201 2:1294574-1294596 CTCCAATCAGAAATGCAGAAAGG + Intronic
925132237 2:1502202-1502224 CTGCATAACGGGATGCAGGAGGG + Intronic
925348679 2:3187345-3187367 CTGGAAGCAGAAATGCTGGAGGG + Intergenic
926845121 2:17128153-17128175 CTCCAGAAAGGAATGCAGGCAGG + Intergenic
926892043 2:17647315-17647337 CTGCACATAGAAATGCTGGCGGG + Intronic
927358390 2:22202576-22202598 CTGAAAAAAAAAAAGCAAGAAGG + Intergenic
927544055 2:23937731-23937753 CTGCTGAAAGAAATGAAAGAAGG + Intronic
927649605 2:24904111-24904133 ATGCAAAAAGGAAGGAAGGAAGG + Intronic
927659196 2:24978221-24978243 CTATAAAAAGAAACACAGGAAGG - Intergenic
928145347 2:28769602-28769624 CTGCAGAAAGAAATGAACAATGG + Intronic
928242854 2:29601673-29601695 CTGAAAAAACAAAAGCAGGCAGG + Intronic
928974851 2:37074957-37074979 CTGCTAGTAGAAATGCAGAATGG + Intronic
929173108 2:38950911-38950933 CTACAAAAATACATGCAGCAGGG - Intronic
929279423 2:40061844-40061866 CTGCAAAAAGAAAGGCATCAAGG - Intergenic
929587911 2:43127590-43127612 ATGCCAAAAGAAAGGCAGAAGGG + Intergenic
929628689 2:43435808-43435830 AAGAAAAAAGAAATGCATGAGGG + Intronic
929747336 2:44672453-44672475 CTGCAAAAGTAAATTCAAGAGGG - Intronic
932115775 2:69045571-69045593 TTGGAAAAAGAAAAGGAGGAAGG + Intronic
932854755 2:75221567-75221589 CAGCAAAATGAAAGGCAGGGAGG - Intergenic
933276606 2:80290800-80290822 CGGTAAAAAGAAAAGAAGGAAGG + Intronic
933878518 2:86644679-86644701 TTGCAAAAAGAAATAAAGTAAGG - Intronic
934165032 2:89286610-89286632 CTGCACAAAGAAGAGCAGGTGGG + Intergenic
934202241 2:89895852-89895874 CTGCACAAAGAAGAGCAGGTGGG - Intergenic
935129384 2:100249915-100249937 ATGCAGGAAGAAATTCAGGAAGG - Intergenic
935558174 2:104533517-104533539 CATCAAAAAGAAAGGAAGGAAGG - Intergenic
936368981 2:111886862-111886884 TTGCAAAAGCAAATGAAGGAGGG + Intergenic
936699584 2:114994889-114994911 ATGCAGAAATAAATGCAGTATGG - Intronic
937299986 2:120833145-120833167 CAGGGAAAGGAAATGCAGGAGGG - Intronic
937306693 2:120876043-120876065 TTACAAAAATAAATGCAGGCCGG + Intronic
937653402 2:124346471-124346493 CTTCTAAATGAAATGCAAGAGGG + Intronic
937816712 2:126258713-126258735 CAGCAAAAACGAATCCAGGAAGG - Intergenic
938762540 2:134438896-134438918 CTGCAAATAGAATTCCAGGAAGG - Intronic
939212423 2:139193810-139193832 CTGCCATAAGACATGCAGGTGGG - Intergenic
939240158 2:139547980-139548002 CTGTAAAAAAAAATTCAGAAGGG - Intergenic
939417084 2:141913745-141913767 CTTAAAAAAAAAATGTAGGAGGG - Intronic
939445349 2:142303135-142303157 CAGAAGAAAGAAATTCAGGAGGG - Intergenic
939487716 2:142836485-142836507 CAGCAAATATAAAGGCAGGAAGG - Intergenic
939943317 2:148378056-148378078 TTACAAAAGGAAATACAGGAAGG - Intronic
940291656 2:152083306-152083328 CTGCAAAAAGAAAGCAAGCAAGG + Intronic
941058779 2:160820911-160820933 TTGCAAAGAGACATGCAAGAAGG + Intergenic
941658819 2:168173326-168173348 CTGCTAAAAGAAGTGCATGCTGG - Intronic
941964447 2:171287053-171287075 ATGGAAAAAGAAAGGAAGGATGG - Intergenic
942046863 2:172104448-172104470 CCGCATAAAGCAATGCAGGTGGG - Intergenic
942922240 2:181389577-181389599 CTGAAGAAACAGATGCAGGAAGG - Intergenic
943662715 2:190576265-190576287 TTACAAAAAGTAATGCAGGCAGG - Intergenic
945109929 2:206352872-206352894 TTGCAATAAGAAATGAAGTAAGG + Intergenic
945828877 2:214758916-214758938 CTGCAAAAACATATGCAAAAAGG + Intronic
945895557 2:215477717-215477739 TTGGATAAAGAAATGCAGAAAGG - Intergenic
946166999 2:217870356-217870378 CTGGAAACAGAAAGGAAGGAAGG + Intronic
946303956 2:218845240-218845262 CTGCATAAAGAAACGCTGAAAGG + Intergenic
946456618 2:219831845-219831867 ATCCAAAAAGAAATGCAGGAGGG - Intergenic
947818575 2:233054764-233054786 CTGGAAAAGGAAAGGCAGGCTGG + Intergenic
1169411010 20:5370337-5370359 CTGGAAGAAGAAATGCTGCAAGG + Intergenic
1169609148 20:7359711-7359733 TTTCAAAAAGAAAAGAAGGACGG - Intergenic
1169918018 20:10703128-10703150 TTGCAATAAGAGATGAAGGATGG + Intergenic
1170281661 20:14655959-14655981 CTGGAAATAGAAATGAAGAAAGG + Intronic
1170944960 20:20883104-20883126 TTGCATAAAGAAATACAGGGAGG + Intergenic
1171274367 20:23843069-23843091 CTGCAAAGAGAGGTGCAGGTAGG + Intergenic
1172171822 20:32940072-32940094 CTCCAAAAAGCAAGGAAGGAAGG - Intronic
1172224486 20:33296187-33296209 CTGCTGATAGAAATGAAGGATGG + Intronic
1173317354 20:41957192-41957214 CTGCTAAGAGAAAGGCTGGATGG - Intergenic
1173446958 20:43127767-43127789 TTGCAAAAAGAAAAGTAGGAGGG + Intronic
1173484659 20:43431768-43431790 CTACAAAAAAAAAGGAAGGAAGG - Intergenic
1174958366 20:55126949-55126971 CTGCAAAAATCAACCCAGGAGGG - Intergenic
1175338079 20:58209479-58209501 CTGCAACAAGAAAAGCAAGAAGG - Intergenic
1175392487 20:58636035-58636057 AGGGAAAAAGAAATGAAGGAAGG + Intergenic
1177524958 21:22279002-22279024 CTGAAAAAAGAAAACCTGGAGGG - Intergenic
1177723566 21:24938850-24938872 ATGCAAGAACAAATGCAGAAGGG - Intergenic
1177811641 21:25931053-25931075 CTGGAAAAAGGAAGGCAGGCAGG - Intronic
1178056263 21:28802351-28802373 ATGCATAAAGAAATTCTGGAAGG + Intergenic
1178303336 21:31470680-31470702 CTGAAAAGAGAAATCCAGAAAGG + Intronic
1178325067 21:31638716-31638738 TTGAAAAAAGAAAGTCAGGATGG + Intergenic
1178368454 21:32007285-32007307 CTACAAAAAGCAACGAAGGAAGG - Intronic
1179019291 21:37623633-37623655 CTGCAAAAAGGAAAGAAGGGAGG - Exonic
1179051119 21:37889378-37889400 CTGCACCAAGGAATGCAGCATGG - Intronic
1179052614 21:37901025-37901047 TTGAACAAAGAAAGGCAGGAAGG - Intronic
1179317586 21:40258264-40258286 CAGCAGGAAGAAATGCAAGAGGG - Intronic
1180153949 21:45968594-45968616 TTGCAAAAAGAAACACAGAAAGG + Intergenic
1180692900 22:17732280-17732302 TTGCAAAAAGAAAGGGAAGATGG - Intergenic
1180821103 22:18828421-18828443 TTGTAAAAGGAAATGCAGAAGGG - Intergenic
1181191875 22:21147624-21147646 TTGTAAAAGGAAATGCAGAAGGG + Intergenic
1181207321 22:21262886-21262908 TTGTAAAAGGAAATGCAGAAGGG - Intergenic
1181685153 22:24523081-24523103 CTGCAAATAGAGATGCAGAAAGG + Intronic
1183890211 22:40921091-40921113 CACCAAAAAGAACTGCATGAGGG - Intronic
1203219597 22_KI270731v1_random:32530-32552 TTGTAAAAGGAAATGCAGAAGGG + Intergenic
1203271228 22_KI270734v1_random:54297-54319 TTGTAAAAGGAAATGCAGAAGGG - Intergenic
949339142 3:3009727-3009749 AAGCAAAAAGAAATGCTGGCCGG - Intronic
949407417 3:3729046-3729068 AAGAAAAAAGAAATTCAGGAAGG - Intronic
950276256 3:11663953-11663975 ATGTAAAAAGAAATGTAGGCTGG + Intronic
950624126 3:14231764-14231786 CTGCAAAAAGTACTGCAGGCAGG - Intergenic
952137995 3:30445464-30445486 CTGACAGAAGAAATGCTGGAGGG + Intergenic
952489229 3:33850490-33850512 TTGCAAAAAGAAAATCAGTAAGG - Intronic
952809253 3:37386824-37386846 CTGAAAAAGGAAATGCATGTGGG + Intronic
953826141 3:46252588-46252610 TTGAGAAAAGAAATGAAGGAAGG + Intronic
953880941 3:46691000-46691022 CTGCAGAGAGAGAGGCAGGAAGG + Intronic
954363736 3:50135584-50135606 CTTAAAAAAGAAGTGGAGGAAGG + Intergenic
954922848 3:54206722-54206744 CAGGAAAAGGAAATGCAGGAAGG - Intronic
955117871 3:56023761-56023783 ATGAAAAAAGGAATGAAGGAAGG + Intronic
955242235 3:57188283-57188305 TTGAAAAGAGATATGCAGGAAGG - Intergenic
955534408 3:59907824-59907846 CTCCAAAAAGGAATGCAGACTGG - Intronic
955598564 3:60618951-60618973 CCCCAAAAAGGAATGCAGTACGG + Intronic
956143201 3:66166383-66166405 GAGGAAAAAGAAATGCAGCAAGG - Intronic
956155286 3:66289582-66289604 CTGAAAAAAGCAATGGGGGAAGG - Intronic
957253875 3:77811844-77811866 AAGCAAATAGAAATGCATGAGGG - Intergenic
957682734 3:83458629-83458651 CTGCAAAAATAAATTCTGAAAGG + Intergenic
957987195 3:87587647-87587669 CTACAAAAATTAATTCAGGATGG + Intergenic
958126311 3:89360664-89360686 GTGAAAAAAGAAATGCAGTTGGG - Intronic
958752194 3:98204566-98204588 ATGCAAAGAGAGAAGCAGGAAGG - Intergenic
958847570 3:99283254-99283276 CTGGAAAAATAAATGCTTGAGGG + Intergenic
958987184 3:100795004-100795026 CTGCAAAAAGAAAAGGACCAAGG + Intronic
959451635 3:106510779-106510801 ATGAGAAAAGAAATGAAGGAAGG - Intergenic
960043168 3:113170671-113170693 CAGCAAAAAGAAAAGCAGAATGG + Intergenic
960065233 3:113365193-113365215 CAGAAAAAGGAATTGCAGGAGGG - Intronic
960421579 3:117452517-117452539 CAGCAAAAATATATGCAGAAAGG + Intergenic
962057515 3:131887523-131887545 GTGAAAAAACAAATGTAGGAGGG + Intronic
962799366 3:138876935-138876957 CTACAGAAAAAAATGTAGGATGG + Intergenic
963033914 3:141008175-141008197 CTCCAGAAAGGAATGCAGGTTGG + Intergenic
963571737 3:147006464-147006486 TTACAAAAAGGAAGGCAGGAAGG - Intergenic
963665327 3:148177811-148177833 CCACAAAAAGAAAGGAAGGAGGG + Intergenic
964008439 3:151860055-151860077 CTGGAAAAAGGAATGGAGGCAGG + Intergenic
964101785 3:152996130-152996152 CTGTCAAAAGAAAGGAAGGAAGG + Intergenic
964202349 3:154132129-154132151 AGGCACAAAGAAATGCAGGCTGG - Intronic
965044383 3:163556874-163556896 CTTCAAATAGAAATCCATGAGGG - Intergenic
965625420 3:170679604-170679626 TTACTAAAAGAAATCCAGGAAGG - Intronic
966140321 3:176749645-176749667 ATTCAAAAAGACAAGCAGGAAGG - Intergenic
966314370 3:178629161-178629183 CTGGAACTAAAAATGCAGGAAGG - Intronic
966935334 3:184704427-184704449 TTGCAAAATGAAATGCAGAGTGG - Intergenic
967044012 3:185719831-185719853 CTCAAAAAAGAAAGGAAGGAAGG + Intronic
968538312 4:1149061-1149083 CTGCAAAGAGAAATCTGGGATGG + Intergenic
969121750 4:4915990-4916012 CTTGGACAAGAAATGCAGGAAGG - Intergenic
969372476 4:6742468-6742490 AAGCAAAAAGAAACGAAGGAAGG + Intergenic
969484937 4:7466929-7466951 CTCCAAAGAGAAAGGCAGCAGGG - Intronic
969510198 4:7613265-7613287 CTGCAGAAAAAAATGCAAGGAGG + Intronic
970293327 4:14600915-14600937 CTGCAATAAAAAATTCAGGAAGG - Intergenic
970589908 4:17550498-17550520 CTGGAATAAGGAAAGCAGGATGG + Intergenic
971017352 4:22502102-22502124 CTGCCAAAATAGATACAGGAAGG - Intronic
972245470 4:37242779-37242801 GAGAAAAAAGAAAGGCAGGAAGG + Intergenic
972353052 4:38254991-38255013 CAGAAAGAAGAAATGGAGGAAGG + Intergenic
972558592 4:40205264-40205286 CAAGAAAAAGAAATGCAGGCAGG + Intronic
972690980 4:41397424-41397446 CTGAAAAAAAAACTTCAGGAAGG - Intronic
972716921 4:41655828-41655850 AGGCAAAAAGAGCTGCAGGAAGG - Intronic
974386593 4:61207955-61207977 CTGTAAAAAGATAGGCAGGTTGG + Intronic
975066141 4:70066116-70066138 ATACAATAAGAAATGCAGGATGG - Intergenic
975180151 4:71334745-71334767 CTGCAAAATGGAATGGAAGAAGG - Intronic
975301991 4:72801043-72801065 CAAAAACAAGAAATGCAGGAAGG + Intergenic
975642624 4:76515383-76515405 CTGAAAAAAAAAAGGAAGGAAGG + Intronic
976022976 4:80653086-80653108 CTGAGAAAAGAGATGTAGGATGG - Intronic
976309271 4:83594021-83594043 CTACAAAAAGAAATACAGAAAGG - Intronic
976487060 4:85619726-85619748 CGGAAAAAAGAAATCAAGGAAGG - Intronic
977847810 4:101786830-101786852 ATGCAAACAGCCATGCAGGAAGG + Intronic
977915143 4:102584002-102584024 ATGCATAAAGAAATTCTGGAAGG + Intronic
978072228 4:104488294-104488316 CTGGAAGAGGAATTGCAGGAAGG - Intronic
978107234 4:104917780-104917802 CTGCAATGAGAAATACAGGAGGG - Intergenic
978146690 4:105382700-105382722 TTACAAAAAGAAATGTAGGCTGG + Intronic
978941579 4:114442683-114442705 CTGTGAAAAGAAATGAAGAAGGG + Intergenic
979152891 4:117342131-117342153 GAGAAAAAAGAAATGCAGGGTGG - Intergenic
981157298 4:141453990-141454012 ATGAAAAGAGAAATGAAGGAAGG - Intergenic
981507319 4:145517013-145517035 TTGCAAGATGAAATGCTGGAAGG - Intronic
981668629 4:147259490-147259512 CTTCAAAAAGTAATTCAAGATGG + Intergenic
981834387 4:149038686-149038708 CTGAAAAAAGCAATCCAGAATGG - Intergenic
981911574 4:149987520-149987542 CAGCAACAGGAAATGCAGAAAGG - Intergenic
981923208 4:150109630-150109652 CTACAAAAGGAAATGCAGCCAGG - Intronic
981971762 4:150671230-150671252 GTACAAAAAGAGATACAGGAAGG - Intronic
982212429 4:153049563-153049585 ATGCAAAAAGTAATTCAAGATGG - Intergenic
982744727 4:159094763-159094785 CTAGAAAAAAAAATGCAGGCCGG - Intergenic
982744750 4:159094895-159094917 CTAGAAAAAAAAATGCAGGCCGG - Intergenic
983165230 4:164468139-164468161 TTGAAAAAAGAGATGAAGGATGG + Intergenic
984052327 4:174879998-174880020 CTGCAAACGGGAATGTAGGAGGG + Intronic
984186669 4:176552609-176552631 CTGCTAAAAGAAATTGAAGAAGG + Intergenic
984530331 4:180908476-180908498 CTGAAAAAAAAAATCCAGGCCGG - Intergenic
984610697 4:181833653-181833675 GAGCAGAATGAAATGCAGGAAGG - Intergenic
984984466 4:185314561-185314583 ATTCAAAAAGAAATGGAGGCTGG + Intronic
985761197 5:1749799-1749821 CTGTAAAAAGAAACGCTGGGAGG + Intergenic
985764967 5:1772554-1772576 CTGAAAAAGGAAATGAAGAAGGG + Intergenic
985916491 5:2922805-2922827 CTGCAATAAGCAGTGCTGGAGGG - Intergenic
987170431 5:15251570-15251592 ATGCAAAAATCAATGCAAGATGG - Intergenic
987706690 5:21468346-21468368 CTGGAGGAAGAAATGCAGCACGG + Intergenic
987968985 5:24917493-24917515 CTGCAAAAAAAACTGCAAAATGG - Intergenic
988659100 5:33245171-33245193 TTGCAAAAGGAAATGAAGCATGG - Intergenic
988799341 5:34681796-34681818 ATGAAAAAAGAAATGCAGCAGGG - Intronic
989710416 5:44389853-44389875 CTGCCAAAAGAAATGGGGGTGGG - Intergenic
990330754 5:54723195-54723217 ATGCAAAAGGAAAGGAAGGAAGG + Intergenic
990966145 5:61450167-61450189 GGGCAGAAAGAAAGGCAGGATGG - Intronic
991390781 5:66141459-66141481 CTCAAAAAAGAAAGGAAGGAAGG - Intronic
991726917 5:69545011-69545033 CTGCAAAGGGAAGAGCAGGAAGG + Exonic
991868040 5:71082863-71082885 CTGCAAAGGGAAGAGCAGGAAGG - Intergenic
992093925 5:73342886-73342908 CTCCAAAAAAAAAAACAGGAAGG + Intergenic
992367917 5:76112323-76112345 CACCAAAAGGAAGTGCAGGAGGG + Intronic
993361389 5:86981060-86981082 TTGCAAAAAGCCATGCAAGATGG - Intergenic
993729304 5:91403719-91403741 CACCAAAATGAAAAGCAGGAGGG + Intergenic
994105270 5:95940960-95940982 CTGCAAAAAGAAGGGGGGGAGGG + Intronic
994267269 5:97732948-97732970 TTTCAGAAAGAAATGCAGGATGG + Intergenic
995702204 5:114948837-114948859 CAGCAGAAAGAAACTCAGGAAGG - Intergenic
997327040 5:133030205-133030227 ATAAAAAAAGAAATGCAGGCTGG - Intergenic
997392981 5:133532096-133532118 CTTCTAAAAGAGAGGCAGGAGGG + Intronic
998901484 5:146860138-146860160 CTATAAAAGGAAAAGCAGGATGG - Intronic
999630953 5:153570983-153571005 ATGAGGAAAGAAATGCAGGATGG + Intronic
999676441 5:154008184-154008206 TTACAAAAAGAAACTCAGGAAGG + Intronic
1000202039 5:159020535-159020557 CTGGACACAGAACTGCAGGAAGG - Intronic
1000733863 5:164873743-164873765 CCACAAAAAGACATGGAGGAAGG + Intergenic
1001848772 5:174944541-174944563 CAGTAAAAAGACATGGAGGATGG + Intergenic
1001914534 5:175548660-175548682 AAGAAAAAAGAAATGAAGGAAGG + Intergenic
1002469396 5:179426514-179426536 TTGCATAAAGAAGTGCAGGAAGG + Intergenic
1002816198 6:682906-682928 ACACAAAAAGAAATACAGGATGG + Intronic
1002945460 6:1756981-1757003 CTGCAAAAGGACACGCAGGATGG + Intronic
1003481958 6:6542823-6542845 CTGCAAGAAGAACTGCAGGCGGG - Intergenic
1003665926 6:8111348-8111370 CTGCACAGCCAAATGCAGGAAGG - Intergenic
1004740931 6:18460164-18460186 CTCCAGAAAGAAATGCAGCCCGG - Intronic
1004867289 6:19866594-19866616 CAGCAAAAAGAAATGATGGGTGG + Intergenic
1005843271 6:29758483-29758505 CTGCAAACAGATGTACAGGAGGG + Intergenic
1006093122 6:31639863-31639885 CTTCAAAACGAAAGGCAGAAGGG + Intronic
1006906147 6:37535193-37535215 AGGCAAAAAGAAAAGCTGGAGGG + Intergenic
1007981627 6:46165340-46165362 TAGCAAAAAGTAATGCAGAATGG + Intronic
1008675029 6:53810126-53810148 CTGCAAGAAGGAAGGCAGGAAGG + Intronic
1010766213 6:79779242-79779264 AAGCAAAATGAAATGCTGGAGGG + Intergenic
1011005233 6:82637030-82637052 CTACAAAAATTAATTCAGGATGG + Intergenic
1011228322 6:85132190-85132212 CTGCAAAAAAAAATACACAATGG - Intergenic
1011582425 6:88884463-88884485 GTACAAAAAGAAATGCAAGAAGG + Intronic
1011837216 6:91447661-91447683 ATGTAAAAAGAAATTCAGAAGGG + Intergenic
1012412812 6:98978767-98978789 CTGCAAGGAAAAATTCAGGAAGG + Intergenic
1012788530 6:103661567-103661589 CAGCAGAAAGAAAAGGAGGAAGG - Intergenic
1012999679 6:106009716-106009738 CTCAAAAAAAAAATTCAGGAGGG - Intergenic
1013385121 6:109620605-109620627 CTACCAAAAGAAAAGCAGAATGG - Intronic
1013420105 6:109959728-109959750 CTGGATAAAGGAGTGCAGGATGG - Intergenic
1013475808 6:110506311-110506333 CTGGAAACAGAGATGGAGGAAGG - Intergenic
1014041295 6:116829488-116829510 CAGGAAAAATAAAAGCAGGATGG - Intergenic
1014280243 6:119434613-119434635 TAGCAAAAAGAAAAGCAAGAAGG + Intergenic
1014369131 6:120583330-120583352 CTGAAATAAGACATGCAGGCAGG - Intergenic
1015017518 6:128431963-128431985 ATGCAAAAAGGAAGGAAGGAAGG + Intronic
1015104089 6:129516167-129516189 CTGAAAAAGGCAATGCAAGAGGG - Intronic
1015193638 6:130500844-130500866 ATGCAAAATGAAACACAGGAGGG + Intergenic
1015816860 6:137219607-137219629 CTGGAAGAAGAATTGCAGAATGG - Intergenic
1016102717 6:140122442-140122464 CTCCATAAAGAAATGGAGGCTGG - Intergenic
1016736410 6:147484903-147484925 CTGGACAAAGAAATGCAGCCAGG + Intergenic
1017149193 6:151262863-151262885 TTGAAAAAAGAACAGCAGGAGGG - Intronic
1017815623 6:158014608-158014630 CTGCCTAGAGAAATGGAGGAAGG + Intronic
1018233706 6:161702256-161702278 CTTCAAAAATAAATGCAAGGTGG + Intronic
1019061070 6:169258734-169258756 CTGGAAAGAGGAAGGCAGGAAGG + Intergenic
1020663640 7:11012176-11012198 CTGCAATAAGAAGTTCAGGCAGG - Intronic
1020753673 7:12173478-12173500 AAGAAAAAAGAAATGAAGGAAGG - Intergenic
1021226961 7:18039188-18039210 CTGCAAAATCGAAAGCAGGACGG + Intergenic
1021265929 7:18522565-18522587 CTGAAAAAAAAAAAGCAGGGTGG + Intronic
1021412446 7:20343575-20343597 TTACAAAAAAAAATTCAGGATGG + Intronic
1021721474 7:23508792-23508814 CTACAAAAATAAATGCATGCAGG - Intronic
1022514647 7:30967713-30967735 CTGCATAAAAAAAGGAAGGAGGG - Intronic
1023106566 7:36768642-36768664 ATGCAAAAAGGAATACAGAAGGG - Intergenic
1023167161 7:37354360-37354382 CTGCTTGAAGAAATGCCGGAAGG - Intronic
1023201504 7:37702380-37702402 ATTAAAAAAGAAATGAAGGAAGG - Intronic
1023418907 7:39958218-39958240 ATGCAAACAGAAAAGCAGGGAGG - Intronic
1023915255 7:44583605-44583627 CTTCAAAAAAAAATGCAGAAAGG - Intergenic
1024343049 7:48286503-48286525 CTGAAAAAAGGAAGGAAGGAAGG - Intronic
1024394631 7:48851340-48851362 CTGCATAAAGAAATACTGTATGG + Intergenic
1024400629 7:48921301-48921323 CTGCATAAAGAAATACTGTATGG - Intergenic
1024470774 7:49767194-49767216 CAGCAGAAAGCAGTGCAGGAAGG - Intergenic
1025031258 7:55558969-55558991 CTTCAGAAGGAAATGCAGGATGG - Intronic
1025075921 7:55943094-55943116 CAGCAAAAAGGAATGTAGGAGGG + Intergenic
1025843308 7:65172227-65172249 CTGGAGAAAGAAAGGAAGGAAGG - Intergenic
1025879735 7:65523740-65523762 CTGGAGAAAGAAAGGAAGGAAGG + Intergenic
1025893702 7:65678850-65678872 CTGGAGAAAGAAAGGAAGGAAGG - Intergenic
1026789772 7:73324142-73324164 CTGCAAATAAAAAAACAGGAAGG + Intronic
1027157148 7:75776507-75776529 CTCCAAAAAGGAAGGAAGGAAGG + Intronic
1027355104 7:77346953-77346975 CTGCAATCAGAAAGGCAGGGGGG - Intronic
1028246461 7:88484876-88484898 GAGCAAAAAGAAATGTAGAAAGG - Intergenic
1028987504 7:97019674-97019696 CTGAAAAAAGGAAGGCGGGAAGG + Intergenic
1029368457 7:100131870-100131892 CTAAAAAAAGAAAGGAAGGAAGG - Intergenic
1030018279 7:105246040-105246062 CTGCAAAAAGAAAAGCTGGAAGG + Intronic
1030068071 7:105675812-105675834 GTGCCAATACAAATGCAGGAAGG + Intronic
1030535624 7:110762870-110762892 TTTCAAAAACAAATGCAGGGTGG - Intronic
1032025804 7:128441354-128441376 CTCAAAAAGGCAATGCAGGAAGG + Intergenic
1032381617 7:131489680-131489702 CTGTAAAAATAAATGGTGGAGGG - Exonic
1032604442 7:133334309-133334331 TTGCAAAAAGAATTACAGGAAGG - Intronic
1032616267 7:133474720-133474742 CTGCAAAAAGAGATATAGAAAGG - Intronic
1033184850 7:139218106-139218128 CAGAAAAAAACAATGCAGGATGG - Intergenic
1035417485 7:158702524-158702546 CTGGAAAAACACAGGCAGGATGG - Intronic
1036264025 8:7260731-7260753 CAGCACAAAGGAATGCAGTAGGG + Intergenic
1036265321 8:7268353-7268375 CAGCACAAAGGAATGCAGTAGGG + Intergenic
1036266622 8:7275975-7275997 CAGCACAAAGGAATGCAGTAGGG + Intergenic
1036267928 8:7283597-7283619 CAGCACAAAGGAATGCAGTAGGG + Intergenic
1036269232 8:7291219-7291241 CAGCACAAAGGAATGCAGTAGGG + Intergenic
1036298665 8:7555861-7555883 CAGCACAAAGGAATGCAGTAGGG - Intergenic
1036299970 8:7563511-7563533 CAGCACAAAGGAATGCAGTAGGG - Intergenic
1036301275 8:7571156-7571178 CAGCACAAAGGAATGCAGTAGGG - Intergenic
1036302574 8:7578805-7578827 CAGCACAAAGGAATGCAGTAGGG - Intergenic
1036316065 8:7719270-7719292 CAGCACAAAGGAATGCAGTAGGG + Intergenic
1036317373 8:7726918-7726940 CAGCACAAAGGAATGCAGTAGGG + Intergenic
1036318681 8:7734566-7734588 CAGCACAAAGGAATGCAGTAGGG + Intergenic
1036319988 8:7742213-7742235 CAGCACAAAGGAATGCAGTAGGG + Intergenic
1036321297 8:7749861-7749883 CAGCACAAAGGAATGCAGTAGGG + Intergenic
1036322606 8:7757509-7757531 CAGCACAAAGGAATGCAGTAGGG + Intergenic
1036323912 8:7765157-7765179 CAGCACAAAGGAATGCAGTAGGG + Intergenic
1036352129 8:8019149-8019171 CAGCACAAAGGAATGCAGTAGGG - Intergenic
1036353427 8:8026797-8026819 CAGCACAAAGGAATGCAGTAGGG - Intergenic
1036591136 8:10169271-10169293 CTTCATGAAGAAATGCAGGTTGG - Intronic
1037480577 8:19301900-19301922 CAACAGAAAGAAAAGCAGGAAGG + Intergenic
1038042844 8:23740565-23740587 CTTTAAAAAGAAATGCAGCTGGG + Intergenic
1038144875 8:24886158-24886180 GTGAAAAAAGAAATGTAGGAGGG - Intergenic
1039223788 8:35365244-35365266 GTGCAAAATGAAACACAGGAGGG - Intronic
1040110914 8:43566868-43566890 CCGGAAAAAAAAATGCAGCAAGG - Intergenic
1040531995 8:48273820-48273842 CTGAAAAAAAAAATGCAGTTGGG + Intergenic
1041524933 8:58794821-58794843 CTGGAGAAAGAGAAGCAGGAAGG + Intergenic
1041820820 8:62030658-62030680 AAACAAAAAGAAATACAGGATGG + Intergenic
1041930902 8:63285209-63285231 CTACAAAAACAAAGGAAGGAGGG - Intergenic
1042135124 8:65625624-65625646 TTTCAATAAGAAATGCAAGAAGG - Intronic
1043283538 8:78500762-78500784 GTGCAAAAAGAAATGTAGAAAGG + Intergenic
1043850028 8:85205581-85205603 TTGGGAAAAGAAATGCAGGGTGG - Intronic
1044350529 8:91160047-91160069 CTGCTAAAAGAAATTAAAGAGGG - Intronic
1044436508 8:92170598-92170620 CTGTAACAAGAAATGCGTGAGGG - Intergenic
1044571985 8:93730232-93730254 CTGCAAAAACAGAGGCAGCAAGG + Exonic
1045018520 8:98020444-98020466 TTGCAGAAAGAAAAGCATGAGGG - Intronic
1045400292 8:101809311-101809333 CTGCAAAAAGGCAGGCAGGCAGG - Intronic
1046057733 8:109098455-109098477 CTGGAAGAAGAACTGGAGGAGGG - Intronic
1046204171 8:110968496-110968518 CTACAAAAGGTAATGCGGGAGGG - Intergenic
1046457278 8:114483557-114483579 CTGCAAAAAGAAATGTATTAGGG + Intergenic
1047418054 8:124682073-124682095 CTGCAAAAAAGAGTGCAGGCTGG + Intronic
1048709758 8:137195962-137195984 CAGCAAATAAAAATGTAGGATGG - Intergenic
1048877268 8:138846701-138846723 GGCCAAAAAGAAATGCAGAATGG - Intronic
1049103933 8:140599465-140599487 CTGAAAGAAGAAAAGCAGGAGGG + Intronic
1049422202 8:142521987-142522009 CAGGAAGAAGAAGTGCAGGAAGG - Exonic
1050063789 9:1737730-1737752 CTGTGAAAGGGAATGCAGGAAGG + Intergenic
1050113755 9:2242276-2242298 ATGCAAAAAGAAAGGGTGGAAGG + Intergenic
1050426571 9:5517622-5517644 CTGCAGAATCAACTGCAGGAAGG + Intronic
1050747374 9:8892036-8892058 CAGAGAAAAGAAAAGCAGGAAGG - Intronic
1050809808 9:9730268-9730290 CTGTTAAAAAAAATTCAGGACGG + Intronic
1051251757 9:15166453-15166475 CTGCAGAAAGAAATGATGCAAGG - Exonic
1051638108 9:19199524-19199546 TTGCTAGAAGAAATGTAGGATGG + Intergenic
1052559170 9:30061717-30061739 CCACAAAAGGAAATTCAGGAAGG - Intergenic
1052570340 9:30213602-30213624 TTGCAAATAGAAATGCAGGATGG + Intergenic
1053946086 9:43311497-43311519 CTGCAAAAAGCCATGGCGGAGGG - Intergenic
1054804094 9:69381422-69381444 CTGCAAAAGGAAATGGATAATGG - Intronic
1055189971 9:73506820-73506842 ATGCAAAAAGAAATTCTTGATGG + Intergenic
1055656974 9:78460564-78460586 ATGCAAAAAGTAATTCAAGATGG + Intergenic
1055856325 9:80692186-80692208 CTGCACTTTGAAATGCAGGAAGG + Intergenic
1056940370 9:90950387-90950409 CTGCAAACTGAAGTGCAGAAAGG + Intergenic
1057113535 9:92498219-92498241 TTGCAAAAATAAATACTGGAAGG + Intronic
1057203839 9:93158895-93158917 CTACAAAAAGACATTCTGGAAGG - Intergenic
1057743234 9:97730604-97730626 CAGTAAAAAGAAAGGAAGGATGG - Intergenic
1057984282 9:99694615-99694637 TTCCAAAAAGACATGCAGAAAGG + Intergenic
1058148969 9:101443295-101443317 GTGTAAAAAGGAATGAAGGAGGG + Intergenic
1058643464 9:107109025-107109047 CTGGAAGAAGAGATGCTGGAAGG - Intergenic
1058713097 9:107698165-107698187 CTGAAAAAAGAAATGGAGAGAGG + Intergenic
1058747847 9:108009158-108009180 CTGCAAGATGAAGTGCAGGAAGG + Intergenic
1059103067 9:111488065-111488087 CTCAAAAAAGAAAGGAAGGAAGG + Intergenic
1059598551 9:115749941-115749963 GTTCAAAAAGAAATACAGGAAGG + Intergenic
1060123445 9:121018568-121018590 CACCAAAAAGAAAGGAAGGAAGG + Intronic
1060763127 9:126273143-126273165 AGGAAAAAAGAAAGGCAGGAAGG - Intergenic
1061103676 9:128512463-128512485 TTGCAAAAATACATACAGGAAGG - Intronic
1061302994 9:129716812-129716834 TTGCAAAAAGCAATGCTGGAGGG + Intronic
1061585064 9:131560902-131560924 ATGCAAAAATAAATTCAAGATGG + Intergenic
1061696129 9:132374936-132374958 CTGTAAAAAGGAAGGAAGGAAGG - Intergenic
1062140085 9:134951256-134951278 CTGCTGAAGGAAATGCAGCAGGG - Intergenic
1186345293 X:8685696-8685718 AAGGAAAAAGAAAGGCAGGAGGG + Intronic
1186469238 X:9808227-9808249 AAGAAAAAAGAAGTGCAGGAAGG - Intronic
1186562887 X:10631656-10631678 CTGGAGAAAGCAATGCACGATGG - Intronic
1186588540 X:10903103-10903125 CTGTAAAAAGCAATGCAATATGG + Intergenic
1186743849 X:12545731-12545753 CTGCAAGAAGACAGGCAGGGAGG + Intronic
1186769987 X:12808258-12808280 ATGTAAAAACACATGCAGGAAGG - Intronic
1186996635 X:15130879-15130901 CTCCAAATAGAAATGTAGTATGG - Intergenic
1187071099 X:15889223-15889245 CTGTAAGAACAAATGGAGGAGGG + Intergenic
1187477508 X:19625324-19625346 GGGCAAAAAAAAATGCAGGCGGG - Intronic
1189669588 X:43394128-43394150 TTGCAAAAACAAATGAAGCATGG + Intergenic
1189816604 X:44830431-44830453 CTGAAATAAGAAATGTACGAGGG - Intergenic
1190303391 X:49068914-49068936 CTGTAAACATAAATGGAGGAAGG - Intronic
1190480104 X:50868904-50868926 CTACAAAAAAAAATGCTTGAAGG - Intergenic
1190765447 X:53472532-53472554 TTGCAAAAAGAAACACAGGAAGG + Intergenic
1190865620 X:54382235-54382257 CTGTAAAAAGAACTCCAGGCTGG + Intergenic
1191672687 X:63763253-63763275 CTGCATAAAGAAACTCTGGAAGG + Intronic
1191803215 X:65104254-65104276 ATGCAAAAATTAATGCAAGATGG + Intergenic
1191887728 X:65906213-65906235 ATGAAGAAAGAAATACAGGAGGG + Intergenic
1193282609 X:79671580-79671602 CTGATAAAAGAAATTGAGGAGGG - Intergenic
1193513884 X:82439164-82439186 ATACAAAAATAAATGCAAGATGG + Intergenic
1193637121 X:83964964-83964986 ATACAAAAATAAATTCAGGATGG + Intergenic
1194817074 X:98455429-98455451 TTGCAAGAAGAAATACAGGAAGG - Intergenic
1195514398 X:105756681-105756703 CTGCAGAAAGAAAAGAATGAAGG - Intronic
1195695563 X:107664363-107664385 CATCAAAAGGAAATGCAGGCGGG - Intergenic
1195879767 X:109580407-109580429 ATGGAAACAGAAATGCAGGAAGG - Intergenic
1196193334 X:112815983-112816005 CTGCAAAATGAAGAGCAGGCAGG + Intronic
1196196329 X:112841308-112841330 CTGCTTAAAATAATGCAGGAAGG + Intergenic
1196246014 X:113401445-113401467 CAGCAAAAAGAAAGCAAGGAGGG + Intergenic
1196253557 X:113489466-113489488 CTGGAAATACAAATGAAGGAAGG + Intergenic
1196264623 X:113627653-113627675 ATGCAAAGAAAAATGCAGGTAGG - Intergenic
1196273335 X:113737477-113737499 CTTCAGGAAGAAATGCACGAAGG - Intergenic
1197557553 X:127975086-127975108 CTGCCAAAACATCTGCAGGATGG - Intergenic
1198504741 X:137290336-137290358 CTGTAAAAGGAAATGGAGGAGGG + Intergenic
1198551400 X:137749238-137749260 ATGCAAAAAAAAATGTATGAAGG - Intergenic
1199221972 X:145327330-145327352 CAGCAAGAAGAAATATAGGATGG - Intergenic
1199292225 X:146117975-146117997 ATGCAAAAATAAATTCAAGATGG + Intergenic
1199464031 X:148116063-148116085 CTGAAGAAAGAAAGGAAGGAAGG + Intergenic
1199963734 X:152800883-152800905 CTGCAAAAGGTTATGAAGGAAGG - Intergenic
1200774210 Y:7155260-7155282 ATGCAAAAATCAATGCAAGATGG - Intergenic
1200860706 Y:7988794-7988816 CAGCAAATGGAAATGCAGTATGG + Intergenic
1201331017 Y:12821505-12821527 CTCCAAAAAGAAATGAAACATGG - Intronic