ID: 920495676

View in Genome Browser
Species Human (GRCh38)
Location 1:206453447-206453469
Sequence CTGGAGCCATAGGACTATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 115}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920495672_920495676 8 Left 920495672 1:206453416-206453438 CCAGCTGCTCTATGGGAGTGAGA 0: 1
1: 0
2: 1
3: 9
4: 134
Right 920495676 1:206453447-206453469 CTGGAGCCATAGGACTATGAGGG 0: 1
1: 0
2: 0
3: 8
4: 115
920495670_920495676 10 Left 920495670 1:206453414-206453436 CCCCAGCTGCTCTATGGGAGTGA 0: 1
1: 1
2: 0
3: 15
4: 179
Right 920495676 1:206453447-206453469 CTGGAGCCATAGGACTATGAGGG 0: 1
1: 0
2: 0
3: 8
4: 115
920495671_920495676 9 Left 920495671 1:206453415-206453437 CCCAGCTGCTCTATGGGAGTGAG 0: 1
1: 0
2: 0
3: 9
4: 192
Right 920495676 1:206453447-206453469 CTGGAGCCATAGGACTATGAGGG 0: 1
1: 0
2: 0
3: 8
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920495676 Original CRISPR CTGGAGCCATAGGACTATGA GGG Intronic
900422407 1:2561254-2561276 CTGGGGCCAGAGGACGAGGAGGG - Intronic
902779798 1:18697668-18697690 CTAGGGACATAGGACAATGAAGG + Intronic
904323754 1:29713552-29713574 CTAGAACCACAAGACTATGATGG - Intergenic
906547325 1:46629049-46629071 CTGGAGCCAAAGGAGTAGGTAGG + Intergenic
907250562 1:53135505-53135527 CTGGAGCCAGCGGCCTAGGAAGG - Intronic
912162304 1:107000466-107000488 CTGGAGGCATCAGACAATGAGGG + Intergenic
912794790 1:112686304-112686326 CTCGATCCATGGGACTTTGATGG + Intronic
913409311 1:118533468-118533490 CCGGAAGCATAGGACTATGCAGG - Intergenic
914913623 1:151805072-151805094 CTGGCCCCATGGGACTTTGAGGG - Intronic
918742768 1:188156170-188156192 ATGTAGCCTTATGACTATGAGGG - Intergenic
920495676 1:206453447-206453469 CTGGAGCCATAGGACTATGAGGG + Intronic
1063237774 10:4136281-4136303 CTGCAGCCACAGGCCTAAGAAGG - Intergenic
1067865421 10:49900650-49900672 TTGGAGGCATAGGATAATGAGGG - Intronic
1068484389 10:57638535-57638557 CTGGTTCCATAAGACTATAATGG + Intergenic
1068514097 10:58004679-58004701 CTGGATCCATAGGACTAGATGGG - Intergenic
1071084004 10:81846987-81847009 CTGGAGCCATACGGCTTTGATGG - Intergenic
1072157379 10:92736250-92736272 CTGGAGCACTAGAACTCTGAAGG - Intergenic
1076568354 10:131413762-131413784 CCAGAGCCATAGGACTACGGAGG + Intergenic
1078083904 11:8222470-8222492 CTGGACCCTTAGGTCTAGGATGG - Intergenic
1078934499 11:15939552-15939574 CTGGACCCAGAGGACTAGGGAGG + Intergenic
1079307218 11:19333952-19333974 CTGGAGCTATAGGACCTTGTAGG + Intergenic
1079406689 11:20153846-20153868 CTGGAGTCAAAGCACTCTGAAGG - Intergenic
1080720550 11:34844172-34844194 GTGGAGCCATTGGCTTATGATGG - Intergenic
1084303975 11:68269841-68269863 ATGAAGTCATAGGACAATGAAGG - Intronic
1084691831 11:70732081-70732103 CTGGGGCCACAGGAGTCTGATGG - Intronic
1087168629 11:95027788-95027810 CTGGACCCATAGCACTATAAGGG - Intergenic
1087171249 11:95051650-95051672 CTGGACCCATAGCACTGTAAGGG - Intergenic
1087799246 11:102486243-102486265 CTAGAGTCATAGAACTATAAGGG - Intronic
1088673709 11:112169253-112169275 CTGGTGCCTTCGGAATATGATGG + Exonic
1091083583 11:132696641-132696663 CTGGAGCAAGAAGACCATGATGG + Intronic
1092527367 12:9317398-9317420 CTGGAGCCCAAGGACTGTGCGGG + Intergenic
1093666281 12:21817195-21817217 ATGGAGTCAGAGAACTATGAAGG - Exonic
1094394762 12:29993880-29993902 TCTGATCCATAGGACTATGACGG + Intergenic
1094524348 12:31221846-31221868 CTGGAGCCAAAGGACTGTGCGGG + Intergenic
1095903914 12:47357759-47357781 CTGGAGCAGTAGCACGATGAAGG + Intergenic
1097141130 12:56903187-56903209 CTGTATTCATAGGACTATGTTGG - Intergenic
1105255629 13:18742624-18742646 CTGGTGCCATTACACTATGAGGG + Intergenic
1106475783 13:30096900-30096922 CTGGAGCCTTGGGACTTGGAAGG - Intergenic
1106592519 13:31109968-31109990 CAGGACCCATAGGACTTTGAGGG - Intergenic
1112655790 13:101451281-101451303 CTGGAGCAAGAAGACGATGAAGG - Intergenic
1114738005 14:25062899-25062921 GTGGACCCATATGACTATTATGG - Intergenic
1115889182 14:38008070-38008092 TTGGAGGCATAGGACTGGGAAGG - Intronic
1118412482 14:65496327-65496349 GGGCAGTCATAGGACTATGATGG - Intronic
1121713419 14:96055830-96055852 CAGGAGCCAGAGGACTAAGTCGG - Intronic
1123513625 15:21017584-21017606 CTGGCGCCATAGCAGTAGGATGG + Intergenic
1124199915 15:27670406-27670428 CAGGAGCCATAGTGATATGAAGG + Intergenic
1127971609 15:63966456-63966478 TTGGAGCCAGAGGACTTGGAGGG - Intronic
1128240211 15:66096471-66096493 CTGGAGCTAGAGGCCTCTGAAGG + Intronic
1129620484 15:77139558-77139580 CTGGTCTCATAGGATTATGATGG - Intronic
1129651744 15:77496013-77496035 CAGGAGACAAAGGACTGTGAGGG + Intergenic
1134797741 16:17057069-17057091 CTAGATCCATGGGATTATGAGGG + Intergenic
1141672633 16:85500688-85500710 CTGCAGCCATGGGACACTGATGG - Intergenic
1144664051 17:17090211-17090233 CTGGAGCCACAAGGCTCTGAAGG + Intronic
1148671116 17:49410962-49410984 CTGGAGCCAAAGCACTGTCACGG + Intronic
1151317889 17:73335148-73335170 CTGGAGCCCTAGGAGGATGGTGG + Exonic
1154435395 18:14338051-14338073 CTGGTGCCATTACACTATGAGGG - Intergenic
1154949663 18:21196815-21196837 CTGGAAGCATAGGATTGTGATGG - Intergenic
1155268471 18:24116771-24116793 CTGAAGCCATACAACTAAGAAGG - Intronic
1159011744 18:63064552-63064574 CTGCAGGCATAGGACTCTGAAGG - Intergenic
1163144844 19:15373302-15373324 CTGGAGTCATAGGACTCGAACGG + Exonic
1165136924 19:33675360-33675382 CTGTAGCCATTGAACCATGAAGG + Intronic
926938264 2:18108007-18108029 CTGGAGGCATAGGTTTTTGAGGG + Intronic
932403659 2:71499762-71499784 CTGGAGCCATTGGAATGTGGGGG - Intronic
932541630 2:72661099-72661121 CTGGAGCTATAGGGCCAAGAGGG + Intronic
932760991 2:74439347-74439369 CTGCAAACATAAGACTATGATGG + Intronic
942321335 2:174739151-174739173 ATGGTGCCATGGGCCTATGAGGG - Intergenic
946104360 2:217356143-217356165 CAGGGGCCATAGCCCTATGAAGG + Intronic
948694303 2:239725494-239725516 CTGTAGCCACAGGACGAAGAGGG - Intergenic
1172217568 20:33247160-33247182 CTAGAGCCCTAGGAGTATGTTGG - Intergenic
1176068045 20:63210170-63210192 GTGGTCCCATAAGACTATGATGG - Intronic
1176841645 21:13847654-13847676 CTGGTGCCATTACACTATGAGGG + Intergenic
1179255289 21:39710714-39710736 CTGGAGACATGGGGCTATGAAGG - Intergenic
1179302077 21:40121560-40121582 CTAGAGACATAGAAATATGATGG - Intronic
1181052620 22:20244969-20244991 CTGGAGCCACAGGACAGTGGTGG - Intronic
1181149795 22:20875070-20875092 CTGGAGCCACAGGACTTCCATGG - Intronic
1182476424 22:30579042-30579064 CAGGAGCCAGAGGACTGTGGAGG - Intronic
1184053634 22:42028845-42028867 CAGGAGACATAGGACAATTAAGG + Intronic
954533544 3:51341153-51341175 CTGGTGTCAGAGGACTATGCTGG - Intronic
956262847 3:67364039-67364061 CTGTAGCCAAAGGACCAGGAAGG + Intronic
958816488 3:98922072-98922094 TTTGACCCATAGGACTATGCTGG + Intergenic
963005732 3:140724765-140724787 CTGGAACCACAGGCCTCTGAGGG + Intergenic
965506679 3:169523226-169523248 CTGGAGGCAAAGGACAATAAAGG + Intronic
965832450 3:172808140-172808162 CAGGGGCTATAAGACTATGAGGG - Intronic
968877856 4:3283618-3283640 CTGGAGCCATAGGACAGACAGGG + Intergenic
978574818 4:110179130-110179152 CTGGAGGCCTAGAATTATGAAGG - Intronic
982486763 4:155975727-155975749 ATGGAGCTTTAGGACTAAGAAGG - Intergenic
983591142 4:169412841-169412863 CAGGAGCCATAGGTCTCTGCTGG + Intronic
989564590 5:42889493-42889515 GTGGAGCCATAGGACCAGGTGGG - Intergenic
991255424 5:64608212-64608234 CCAGAGGCAAAGGACTATGAGGG - Intronic
992440652 5:76795030-76795052 GTGGAGCCATGGGCCCATGAAGG - Intergenic
993187853 5:84643143-84643165 CAGAACCCATAGGACTCTGATGG + Intergenic
999983379 5:156979172-156979194 CAGGAGCCATAGGATAAAGATGG - Intergenic
1002091254 5:176807799-176807821 CTGGAGTCATAGACCCATGATGG + Intergenic
1003719678 6:8686752-8686774 CTGGAGCCAAATACCTATGAAGG - Intergenic
1004871319 6:19907225-19907247 GTGGTCCCATAAGACTATGATGG - Intergenic
1006407021 6:33851409-33851431 CTGGAGCCAGGTGACTATGCTGG - Intergenic
1011018920 6:82789093-82789115 ATGGGGCCTTAGGACTTTGATGG - Intergenic
1012588087 6:100947307-100947329 CAGGAGCCATAGGAGTATATTGG + Intergenic
1015898089 6:138036243-138036265 CTGGAGGCCTAGGAGTATGACGG - Intergenic
1017602457 6:156098465-156098487 CTGGTGCAATAGGATTATGATGG - Intergenic
1018521140 6:164653352-164653374 CTGAAGACATAGGACTGTAAGGG + Intergenic
1019099083 6:169612797-169612819 CTGGTGGCATAAGATTATGATGG - Intronic
1021517968 7:21507672-21507694 CTTAGGCCATAGGACTATGCTGG + Intronic
1021655557 7:22870334-22870356 CTCCAGCCATAGGAACATGAGGG + Intergenic
1022205835 7:28162789-28162811 CTGAAGCCATAGGAATGTAAAGG - Intronic
1024067088 7:45747784-45747806 CAGGAGCCACAGAACTGTGAAGG - Intergenic
1024410239 7:49032037-49032059 CCCTAGCCATATGACTATGAAGG + Intergenic
1027555452 7:79659279-79659301 CTGCTGCCACAGGAGTATGATGG + Intergenic
1031297307 7:120017405-120017427 CTGGAGCCTCAGGATAATGAAGG + Intergenic
1033230371 7:139592958-139592980 CTGGAGCCATGGCACTGAGAAGG - Intronic
1034282748 7:149865192-149865214 CTGCAGCCAGAGGTCTTTGAGGG - Exonic
1040725000 8:50371418-50371440 CAGGAGCCATATGAATATGCTGG - Intronic
1042323087 8:67498681-67498703 ATGGTGCCATGGGACTTTGAGGG - Intronic
1049912869 9:286479-286501 GTGGAGCCAGTGGACTTTGAAGG + Exonic
1052881484 9:33603326-33603348 CTGGTGCCATTACACTATGAGGG - Intergenic
1053037571 9:34838432-34838454 ATGGAGCCATAGGTGTATAAGGG + Intergenic
1053494834 9:38542513-38542535 CTGGTGCCATTACACTATGAGGG + Exonic
1059834528 9:118136274-118136296 CAGGATCCATAGGACTGTGCAGG - Intergenic
1059902854 9:118947558-118947580 GTGGTCCCATAGGACTATAATGG + Intergenic
1185602266 X:1348405-1348427 AGAGAGACATAGGACTATGATGG - Intronic
1188721603 X:33529140-33529162 CCAGAGCCAGAGGACTAGGAGGG - Intergenic
1192174024 X:68874700-68874722 CTGGAGCCATGGGCCAGTGACGG + Intergenic
1194558688 X:95394140-95394162 CTGGAGCCCTAGGGTTTTGATGG + Intergenic
1196327635 X:114426309-114426331 CTGGAGCCATTTTAATATGAGGG - Intergenic