ID: 920502243

View in Genome Browser
Species Human (GRCh38)
Location 1:206492780-206492802
Sequence GTTGTTGGTGCTCCACACTA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 62}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920502237_920502243 -3 Left 920502237 1:206492760-206492782 CCAGCCCCAGCCACATGCATGTT 0: 1
1: 0
2: 2
3: 38
4: 388
Right 920502243 1:206492780-206492802 GTTGTTGGTGCTCCACACTACGG 0: 1
1: 0
2: 0
3: 6
4: 62
920502234_920502243 26 Left 920502234 1:206492731-206492753 CCACGCTCACCATAGGTGGCATG 0: 1
1: 0
2: 0
3: 3
4: 51
Right 920502243 1:206492780-206492802 GTTGTTGGTGCTCCACACTACGG 0: 1
1: 0
2: 0
3: 6
4: 62
920502239_920502243 -8 Left 920502239 1:206492765-206492787 CCCAGCCACATGCATGTTGTTGG 0: 1
1: 0
2: 0
3: 11
4: 165
Right 920502243 1:206492780-206492802 GTTGTTGGTGCTCCACACTACGG 0: 1
1: 0
2: 0
3: 6
4: 62
920502236_920502243 -2 Left 920502236 1:206492759-206492781 CCCAGCCCCAGCCACATGCATGT 0: 1
1: 0
2: 10
3: 39
4: 358
Right 920502243 1:206492780-206492802 GTTGTTGGTGCTCCACACTACGG 0: 1
1: 0
2: 0
3: 6
4: 62
920502241_920502243 -9 Left 920502241 1:206492766-206492788 CCAGCCACATGCATGTTGTTGGT 0: 1
1: 0
2: 0
3: 15
4: 185
Right 920502243 1:206492780-206492802 GTTGTTGGTGCTCCACACTACGG 0: 1
1: 0
2: 0
3: 6
4: 62
920502238_920502243 -7 Left 920502238 1:206492764-206492786 CCCCAGCCACATGCATGTTGTTG 0: 1
1: 0
2: 1
3: 33
4: 313
Right 920502243 1:206492780-206492802 GTTGTTGGTGCTCCACACTACGG 0: 1
1: 0
2: 0
3: 6
4: 62
920502235_920502243 17 Left 920502235 1:206492740-206492762 CCATAGGTGGCATGCGTCACCCA 0: 1
1: 0
2: 0
3: 1
4: 42
Right 920502243 1:206492780-206492802 GTTGTTGGTGCTCCACACTACGG 0: 1
1: 0
2: 0
3: 6
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920502243 Original CRISPR GTTGTTGGTGCTCCACACTA CGG Exonic
907590026 1:55657657-55657679 GTGGTTGGTATTCCACAGTATGG + Intergenic
908248685 1:62248006-62248028 GTTCTTGGTGCTAGACACTGGGG - Intronic
912197717 1:107418920-107418942 CTTGTTTGTCCTCCACACTGTGG - Intronic
915959914 1:160257677-160257699 GTTGGTCCTACTCCACACTAAGG + Intronic
920502243 1:206492780-206492802 GTTGTTGGTGCTCCACACTACGG + Exonic
1072823942 10:98586830-98586852 GTCGTGGGTGCTCCACACTTTGG + Intronic
1081652263 11:44832353-44832375 CTTGTTGGTGCTCCACTTGATGG + Intronic
1082948654 11:58787866-58787888 GTTATTTCTGCTCCACACTCAGG + Intergenic
1090049149 11:123362141-123362163 GTTGCTGGTGATCCACAGTAGGG + Intergenic
1092057893 12:5522604-5522626 GCTGTGGTTGCTCCACACTGAGG + Intergenic
1093108978 12:15126343-15126365 AGTGTTGGTGCTCCACACCTAGG - Intronic
1094345821 12:29467760-29467782 GATGGTGGTGTTCCACACTTAGG - Intronic
1094537915 12:31338477-31338499 GTTGATGCTGATGCACACTAAGG + Intergenic
1095647852 12:44570279-44570301 GATGCTGGTGCTCCACAATTAGG + Intronic
1095658518 12:44700088-44700110 GATGTTGGTGCTGCTCACTTAGG - Intronic
1099222151 12:79927893-79927915 GTTTGTGGGGCTCCACAATAAGG - Intronic
1100699248 12:97128849-97128871 GTTTTTGGTTCTCCAGTCTAAGG - Intergenic
1108982884 13:56541272-56541294 CTTAATGGTGCCCCACACTAAGG + Intergenic
1115223504 14:31080682-31080704 GTTGTTGGTGATGAACACTCTGG - Intronic
1116956710 14:50931378-50931400 ATTGTAGGTGCTCCACAATCAGG + Intronic
1130974172 15:88760191-88760213 GTGGTTGATGCTCAACACTCAGG - Intergenic
1133639564 16:7703598-7703620 CATGTTGGTACTCCACACCAGGG - Intronic
1134451988 16:14369287-14369309 GTTGTTAGTGCTTCACTCTGAGG - Intergenic
1152665289 17:81565064-81565086 GTTGTTGCTGGTGGACACTACGG - Intronic
1157141447 18:45111169-45111191 GTTGCTGATGCTCCACAAAATGG - Intergenic
1159549935 18:69884314-69884336 GATGTTGGTGTTCCACAGAATGG + Intronic
1160303703 18:77710392-77710414 CTTCTTGGTGCTCCACACTTGGG + Intergenic
927744429 2:25604112-25604134 GTTTTTGGTGCTCCACTCTCTGG - Intronic
928552384 2:32385399-32385421 GTTGCTGGTGCTCAATATTATGG + Intronic
935132974 2:100275150-100275172 GTCCTTGGTGCTGCAGACTAGGG + Exonic
935876377 2:107512369-107512391 ATTGTCGGTGCTTCACACAAAGG - Intergenic
941325538 2:164109592-164109614 GGTTATGGGGCTCCACACTATGG - Intergenic
1170052723 20:12164422-12164444 GTTGGTGGAGCTCTATACTAAGG + Intergenic
1172793592 20:37522619-37522641 GCTGTGGGTGCTCTCCACTAAGG + Intronic
1173833481 20:46108972-46108994 CTTGTTGGTACTCCACCCTCAGG - Intergenic
1175840587 20:62024260-62024282 GTTGATGTTGGTACACACTATGG - Intronic
1176694519 21:9958689-9958711 GCTGTTGTTGCTACTCACTACGG - Intergenic
1184631896 22:45788160-45788182 GTCCCTGGGGCTCCACACTAGGG + Intronic
957957599 3:87208704-87208726 GTTGTTGGTGATTCTCACAAGGG - Intergenic
960402645 3:117221760-117221782 GTTGTTGATTTTCTACACTATGG + Intergenic
962916397 3:139907931-139907953 ATTGTTCCTGCTCCACTCTAAGG + Intergenic
963966670 3:151379534-151379556 TGTGTTGGAGCTGCACACTAGGG + Intronic
977724708 4:100282394-100282416 GAGGATGGTGTTCCACACTAAGG + Intergenic
981362977 4:143868824-143868846 GTTGTTTGTGTTAAACACTAAGG - Intergenic
981373705 4:143989644-143989666 GTTGTTTGTGTTAAACACTAAGG - Intergenic
981382807 4:144092887-144092909 GTTGTTTGTGTTAAACACTAAGG - Intergenic
986294280 5:6424231-6424253 GTGGATGGTGCTCCCCTCTAGGG - Intergenic
993489670 5:88531761-88531783 CTTTTTGGTGCTCCACCCTCTGG + Intergenic
994816473 5:104593256-104593278 GGAGTTGGTGTTCCACACTATGG - Intergenic
1007019233 6:38502962-38502984 AAAGTAGGTGCTCCACACTATGG + Intronic
1008118006 6:47575532-47575554 TTTGTAGGTGCACCACAATATGG + Intronic
1016751449 6:147634711-147634733 GTTGTAGGTGCTGCATTCTATGG - Intronic
1020431441 7:8120179-8120201 GTTGTTTCTGCCTCACACTACGG - Intronic
1022023679 7:26426088-26426110 GTGATTGGTGCTCCACGTTATGG - Intergenic
1026411211 7:70125082-70125104 GTTGTTTTTTCTCCTCACTATGG + Intronic
1039507081 8:38059944-38059966 CTTGGTAGTGCTCCACACGATGG - Exonic
1044807310 8:96021432-96021454 CTTGTTGCTGCTCCACAACAGGG + Intergenic
1046679020 8:117146948-117146970 TCTGTTGGAGTTCCACACTATGG - Exonic
1050824082 9:9922081-9922103 CTTGTGGGGGCTCCACACTGTGG - Intronic
1053112777 9:35477168-35477190 GGTGTTGCTTCTCCCCACTAAGG - Intergenic
1054312589 9:63542763-63542785 GCTGTTGTTGCTACTCACTACGG - Intergenic
1054698172 9:68383205-68383227 GGTGATGGTGCTACACTCTAAGG + Intronic
1058032544 9:100215722-100215744 GGTGTTGCTGCTCCACCATATGG - Intronic
1058190554 9:101909703-101909725 GTTGTAGGTTTTCCACACTATGG + Intergenic
1059650360 9:116310455-116310477 TTTTTTGGTGCCCCACACCATGG - Intronic
1060103766 9:120861142-120861164 GTGGTTGGTGCTCCAGGCTGAGG + Exonic
1189311762 X:40024074-40024096 GTGTTTGGAGCTCCAAACTAAGG + Intergenic
1194742995 X:97597521-97597543 CTTGGTGGTCCTACACACTAAGG - Intronic
1195911349 X:109891163-109891185 TTTTTTTGTGCTCCACACAATGG + Intergenic