ID: 920503087

View in Genome Browser
Species Human (GRCh38)
Location 1:206497671-206497693
Sequence CACTCTAAAGGCCTGGGGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 220}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920503080_920503087 8 Left 920503080 1:206497640-206497662 CCTCTGTGGTGCTTCTCTGTGCA 0: 1
1: 1
2: 3
3: 25
4: 357
Right 920503087 1:206497671-206497693 CACTCTAAAGGCCTGGGGGAAGG 0: 1
1: 0
2: 2
3: 23
4: 220
920503078_920503087 23 Left 920503078 1:206497625-206497647 CCTGGAGGCTTCTGTCCTCTGTG 0: 1
1: 0
2: 3
3: 29
4: 303
Right 920503087 1:206497671-206497693 CACTCTAAAGGCCTGGGGGAAGG 0: 1
1: 0
2: 2
3: 23
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920503087 Original CRISPR CACTCTAAAGGCCTGGGGGA AGG Exonic
900832195 1:4973290-4973312 GACTCGAAAGGCCTGGGGGTGGG - Intergenic
900987488 1:6081595-6081617 CCCTGTAAAGGCTCGGGGGAGGG + Intronic
903057218 1:20644623-20644645 CACCCTGAAGGCCTGGGCCATGG + Exonic
903860695 1:26362827-26362849 CACTCCAAAGGCCTGCAGGAGGG - Intronic
904343387 1:29852534-29852556 CACTCCAGAGACCTGGAGGAGGG - Intergenic
906123169 1:43408801-43408823 CACTCTACAGGCCCATGGGAAGG - Intronic
906891979 1:49726718-49726740 AACTCTAAGGACCTTGGGGATGG + Intronic
906940567 1:50251844-50251866 CACTCGACAGGCATGGGGGTGGG - Intergenic
907871376 1:58446521-58446543 CAGTCAAAAGGGCTGGGGGTGGG + Intronic
909375254 1:74933540-74933562 ATCTCTGAAGGCCGGGGGGAAGG + Intergenic
909470297 1:76020262-76020284 CACTCAACAGGTCTGAGGGAGGG - Intergenic
910947935 1:92614186-92614208 CACTTTAAAGGCCTAGCAGAAGG + Intronic
911181494 1:94864451-94864473 CACCCTAAAGGGTTGGTGGATGG + Intronic
913302552 1:117387796-117387818 CAGTCTACAGGCCTGGAAGAGGG - Intronic
914429797 1:147611064-147611086 CACTCTCAGGGCCTTGGGGGCGG - Intronic
915590627 1:156868329-156868351 CACTGAAAAGGCCTGGGGAATGG + Intronic
916124674 1:161558737-161558759 AAATAGAAAGGCCTGGGGGAAGG + Intergenic
916134565 1:161640086-161640108 AAATAGAAAGGCCTGGGGGAAGG + Intronic
920503087 1:206497671-206497693 CACTCTAAAGGCCTGGGGGAAGG + Exonic
920869558 1:209782914-209782936 CATTCTAAACACCTGGGAGAAGG - Exonic
921496622 1:215850499-215850521 GACTCTAAGGCCCTGGGGAATGG + Intronic
922025662 1:221746306-221746328 CACTCTCCAGGCCTAGGGAAGGG + Intergenic
922773757 1:228205662-228205684 ATCTCCCAAGGCCTGGGGGATGG - Intronic
1063822042 10:9846914-9846936 CAGTATAAAGGCCTTGGGGTGGG - Intergenic
1067231924 10:44418072-44418094 CACTCTGAAGGTTGGGGGGAAGG + Intergenic
1067448506 10:46367414-46367436 CACTGCAGAGGCCTGGGGGATGG - Intergenic
1067588868 10:47493351-47493373 CACTGCAGAGGCCTGGGGGATGG + Intergenic
1067635994 10:48001442-48001464 CACTGCAGAGGCCTGGGGGATGG + Intergenic
1067771467 10:49129676-49129698 GAATCCAAAGGCCTTGGGGAAGG - Intergenic
1069867622 10:71513446-71513468 CACTCTAAAGGGCAGGGGCCTGG - Intronic
1070132558 10:73665450-73665472 CACTGCAGAGGCCTGGGGGATGG + Intergenic
1071609125 10:87018625-87018647 CACTGCAGAGGCCTGGGGGATGG - Intergenic
1074216022 10:111384469-111384491 CTATGTAAAGCCCTGGGGGAGGG + Intergenic
1074315444 10:112357302-112357324 CGCCCTAAAGGCCTGGGTGAGGG - Intergenic
1075948530 10:126458029-126458051 CTGTCTAAAGACCTCGGGGAAGG - Intronic
1076097459 10:127743582-127743604 CACTCAGAAGCCCTGGGGAAGGG - Intergenic
1076810564 10:132884387-132884409 CAATCCAAAGGCCTCGGGGCAGG + Intronic
1080226784 11:29970783-29970805 CACTCAAAAACCCTGTGGGAAGG + Intergenic
1080639195 11:34148929-34148951 CATTCTGCAGGCCTGGAGGAGGG + Intergenic
1084952664 11:72675214-72675236 CAGACTACAGGCATGGGGGAAGG + Intergenic
1085262895 11:75218468-75218490 CTCTCTAAAGGCCTGGGGTCTGG - Intergenic
1085386885 11:76162688-76162710 CACTCACCAGGCCTGGTGGAGGG - Intergenic
1085521984 11:77144456-77144478 CACTCTCAGGGCCTGGGTGGAGG - Intronic
1089072062 11:115708267-115708289 CACTCTATTGGCTTGGGTGATGG - Intergenic
1089283724 11:117392384-117392406 CTCTCTCCAGCCCTGGGGGATGG + Intronic
1089320400 11:117622585-117622607 CACTCCAGAGTCCTGGAGGAAGG + Intronic
1089564172 11:119362343-119362365 CCCTCTATTGGCCTGGGGGGTGG + Intronic
1089666762 11:120025604-120025626 CACTCTACAGGGATGGGGGAAGG + Intergenic
1089898879 11:121960686-121960708 CACTCTTAAGGGCTGTGGGGAGG + Intergenic
1091254134 11:134168797-134168819 CACAGTAAAGACCTGGGGCAGGG + Intronic
1091321164 11:134652975-134652997 CACTCTCAAGGGTTGTGGGAAGG - Intergenic
1092587303 12:9912394-9912416 CACTCTAAGGGTCAGGGGAAAGG - Intronic
1098599936 12:72318864-72318886 TACTCTATCGGACTGGGGGAGGG + Intronic
1100604808 12:96142912-96142934 CAATCAATAGGCCTTGGGGAAGG + Intergenic
1102256698 12:111419265-111419287 CACACTCCAGGCCTGGGTGACGG + Intronic
1103839451 12:123850699-123850721 CTCGCTGAAGGCCTTGGGGAGGG - Intronic
1104811841 12:131624106-131624128 CATTCTCATGGCCTGGGCGATGG - Intergenic
1105713073 13:23031917-23031939 CCCTCTGAAGGCTTTGGGGAAGG - Intergenic
1106192750 13:27468252-27468274 AACTATAAAAGCCTGGGGGGAGG - Intergenic
1107180188 13:37449538-37449560 AACTCTAAAGTCAAGGGGGATGG - Intergenic
1107650136 13:42536561-42536583 CACTATGAAGGGCTGGGAGAAGG + Intergenic
1112003471 13:95233549-95233571 CACACTCATGGCCTGGGGGATGG + Intronic
1112443184 13:99440000-99440022 CACTACCAAGACCTGGGGGAGGG - Intergenic
1113576108 13:111396357-111396379 CACTCTAAAGTACTGGGGGTTGG - Intergenic
1118309801 14:64683718-64683740 CACTCAAAAGGCTTAGGAGAGGG - Intergenic
1119558581 14:75572045-75572067 CACACTTAGGGCATGGGGGAAGG + Intergenic
1122828067 14:104381735-104381757 CACTCTAATGGCCTTTGGCATGG - Intergenic
1125353341 15:38790557-38790579 CACTCTACTGGCCTGAGTGATGG + Intergenic
1128984081 15:72206686-72206708 CAGTCCGAAGCCCTGGGGGATGG + Intronic
1131405871 15:92163898-92163920 CACTCTGTGGGGCTGGGGGAAGG - Exonic
1131847812 15:96506482-96506504 AACTATAAAAACCTGGGGGATGG - Intergenic
1132981856 16:2742403-2742425 GACTCTAAAGGGCTGGGTCATGG + Intergenic
1133973285 16:10581867-10581889 GAAGCTCAAGGCCTGGGGGAGGG - Intergenic
1135012626 16:18895526-18895548 CACTCTAGGGGGCAGGGGGAAGG + Intronic
1135319544 16:21483083-21483105 CACTCTAGGGGGCGGGGGGAAGG + Intergenic
1135372381 16:21914571-21914593 CACTCTAGGGGGCGGGGGGAAGG + Intergenic
1135439405 16:22456137-22456159 CACTCTAGGGGGCGGGGGGAAGG - Intergenic
1136329776 16:29564805-29564827 CACTCTAGGGGGCGGGGGGAAGG + Intergenic
1136444403 16:30304509-30304531 CACTCTAGGGGGCGGGGGGAAGG + Intergenic
1138265982 16:55660050-55660072 TGCTCTAAAGGCCTGAGGAAGGG + Intronic
1140376516 16:74449325-74449347 CACACCACAGGCCTGGAGGATGG + Intergenic
1141111358 16:81273380-81273402 CACTCTGCAGGCCTGGCAGACGG + Intronic
1141667271 16:85472305-85472327 CCCTCTGGAGGCCTGGGGGGAGG + Intergenic
1141735807 16:85851880-85851902 CTTTCTAAAGGCCTTGGGAAAGG - Intergenic
1144718058 17:17447983-17448005 CGCTCTAAAAGCTTGGGGGGAGG - Intergenic
1144737919 17:17565168-17565190 GACTCAAAGGTCCTGGGGGAAGG - Intronic
1144790754 17:17857538-17857560 GACTCTTAAGGCCTGGGGACAGG + Intronic
1145171499 17:20661563-20661585 CAATCGAAAGGCCTGGGGCTGGG + Intergenic
1146820369 17:35979863-35979885 CACTCTGAAGGTTTGGGGGCTGG - Intronic
1146935862 17:36812430-36812452 CAGTGCAAAGGCCTGGAGGAGGG - Intergenic
1147041689 17:37724191-37724213 CATTCTATAGGCCTGGGGTGAGG - Intronic
1147266214 17:39236547-39236569 CACCCTCAAGACCTTGGGGAGGG - Intergenic
1147656831 17:42095858-42095880 CACTCACAGGGCCTGGGGCAAGG + Intergenic
1148408839 17:47446939-47446961 CATTCTAATGGATTGGGGGAAGG - Intergenic
1149415616 17:56456754-56456776 GACACTAAAGGGATGGGGGAGGG + Intronic
1151319903 17:73346789-73346811 CTCTCCAAAGACCTGGGGGAAGG + Intronic
1151592087 17:75052019-75052041 CCCTCAAAAGGACTGGGGGTGGG - Intronic
1151829860 17:76543161-76543183 CACACCCAGGGCCTGGGGGAAGG - Exonic
1151971745 17:77460903-77460925 CACTTAAAAGGAGTGGGGGATGG - Intronic
1153699722 18:7680398-7680420 CACACTAAGGCCCTTGGGGATGG - Intronic
1157154443 18:45251799-45251821 CATTCTAAGGTCCTGGGGTAAGG + Intronic
1157584917 18:48794806-48794828 CACACAAAGGGCCTGGGGGAAGG - Intronic
1158839416 18:61368047-61368069 CACTCTGAAGTACTGGGGGTTGG + Intronic
1159960864 18:74555006-74555028 CTCTCTCAAGGTCTCGGGGATGG + Intronic
1160688414 19:448331-448353 CCCTCTGAAGCCCCGGGGGAGGG + Intronic
1161684271 19:5695321-5695343 AGCTCTAATGGCATGGGGGAGGG + Intronic
1161845837 19:6711483-6711505 CACCCTAAAGGCCTGGCTCATGG - Intronic
1163686494 19:18714850-18714872 CCCTCCAAAGGGCTGAGGGAGGG - Intronic
1163846921 19:19643282-19643304 CACCCCAGACGCCTGGGGGAGGG - Intronic
1166975701 19:46603955-46603977 CACTGTAAGGGGCTGGGGGTGGG - Intronic
1168586013 19:57592669-57592691 CTCTCTTCAGGCCTGGGGAAGGG - Exonic
925181368 2:1819067-1819089 CCCTCTCAAAGCCTGAGGGATGG + Intronic
925187470 2:1859020-1859042 CACCCTGACAGCCTGGGGGAGGG + Intronic
928079170 2:28293608-28293630 GGCTCTGAAGCCCTGGGGGAAGG - Intronic
929471472 2:42198355-42198377 CACTCTAAAGCACTGGGGGAAGG + Intronic
930042858 2:47141853-47141875 CACACTGAACACCTGGGGGAGGG + Intronic
930876160 2:56219635-56219657 ATCTCTAAAAGCATGGGGGAGGG - Intronic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
934015875 2:87881261-87881283 CACTCTGGGGGCCTGGAGGATGG + Intergenic
934521002 2:95020201-95020223 CACTCTAAGGGGCGGGGGGGGGG + Intergenic
935194209 2:100802384-100802406 CTCACGAAAGCCCTGGGGGATGG - Intergenic
936856623 2:116966060-116966082 CACCCTAAAGGCAGGGTGGAAGG - Intergenic
937560444 2:123218267-123218289 CACTATCAAGGGATGGGGGAGGG - Intergenic
937862716 2:126723541-126723563 CACTCAGAAGGCCTGGGGTGTGG - Intergenic
937878751 2:126849581-126849603 GACTCTAAAGGGATGGGGGGAGG - Intergenic
937884996 2:126893590-126893612 CACTCGAAAGGCTTAGGGGCTGG + Intergenic
940237138 2:151524000-151524022 AACTCTTAAGGCCTGGGGAGAGG + Intronic
940328125 2:152446391-152446413 CACTTTAAAGGCCTGGTTGGGGG + Intronic
941461250 2:165774234-165774256 CACTCGATAGCCCTGGGGAAGGG - Intronic
943680908 2:190766707-190766729 GACTCTGAAGGCCTGGGGGATGG - Intergenic
944104016 2:196059840-196059862 AAATCTAAAGGCTTTGGGGAAGG + Intronic
944503906 2:200390269-200390291 CACTCTAGATGCCTGGGGTATGG + Intronic
945908985 2:215625044-215625066 CATTAAAAAGGGCTGGGGGAGGG + Intergenic
946354192 2:219174795-219174817 CACTCTCAATGCCTTGGAGAGGG - Exonic
948142017 2:235680501-235680523 CTCTCTATGGGCCTGGGGAAGGG + Intronic
948730878 2:239963039-239963061 CCATCTAAAGGCGGGGGGGAGGG + Intronic
949023974 2:241756368-241756390 CACTGCAAAGGCCTCGGGGCCGG - Intronic
1170303390 20:14911167-14911189 CATTCAATAGGTCTGGGGGAGGG - Intronic
1170388605 20:15848347-15848369 CACTGTACAAGCCAGGGGGAGGG + Intronic
1170472303 20:16680408-16680430 CATTCTAAAGTACTGGGGGTTGG - Intergenic
1173182226 20:40814107-40814129 CAGGCTGAAGGGCTGGGGGAAGG - Intergenic
1173705276 20:45105718-45105740 CACTCCAAGAGCCTGGGGGTGGG + Intergenic
1175923984 20:62463093-62463115 CACTCAACAGGCCTGGGGCCTGG - Intergenic
1176117994 20:63441536-63441558 CCCACAAAAGACCTGGGGGATGG + Intronic
1179193189 21:39140715-39140737 AACTCTGAAGATCTGGGGGAGGG + Intergenic
1179193703 21:39144912-39144934 AACTCTGAAGATCTGGGGGAGGG + Intergenic
1179612175 21:42559486-42559508 CACGCTCAAGGCCTGTGGGAGGG - Intronic
1180009938 21:45042908-45042930 CACTCTGTAGCCCTGGGGGGTGG - Intergenic
1181317832 22:21982438-21982460 CACCCTAAAGAGCTGTGGGAGGG + Exonic
1182127959 22:27829980-27830002 CACTGTAATTGGCTGGGGGATGG - Intergenic
1183305082 22:37078460-37078482 CACTCTGGAGGCCTGGAGCACGG + Intronic
1183471083 22:38007143-38007165 CACCCTGAAAGCCTGAGGGAAGG + Intronic
950564028 3:13754068-13754090 CCCATTAAAGGTCTGGGGGAGGG + Intergenic
950953739 3:17029012-17029034 CACACAAAATGCCTCGGGGAAGG + Intronic
952447224 3:33393078-33393100 CATCCTAAAGGGCTGGGGGGAGG + Intronic
952706136 3:36380225-36380247 CCCTGGAAAGGGCTGGGGGAAGG - Intergenic
953407592 3:42667157-42667179 CACTTTCCAGGGCTGGGGGAAGG + Intergenic
953508098 3:43506662-43506684 CACCCTAAAGGCCCAGGGGTGGG - Intronic
953972117 3:47355859-47355881 CTCCCTCAAGGCCTGGGTGAGGG + Intergenic
956051143 3:65249823-65249845 CAATGCAAAGGCCTGGGGGCAGG - Intergenic
956312111 3:67892744-67892766 CCCTCTAAAGGCTCTGGGGAAGG - Intergenic
956748713 3:72329691-72329713 CTCATTAAAAGCCTGGGGGATGG + Intergenic
961262222 3:125611286-125611308 CATTCTAAAGTACTGGGGGTGGG + Intergenic
961808201 3:129504308-129504330 CAAAGCAAAGGCCTGGGGGAAGG - Exonic
962249145 3:133824387-133824409 CACTTTAAAGGGATGGGTGAGGG + Exonic
964491185 3:157238036-157238058 CACACAGAAGCCCTGGGGGAAGG + Intergenic
965781001 3:172285840-172285862 CAGTTAAAAGGCCTTGGGGAAGG + Intronic
966769387 3:183490880-183490902 CACTTGAAAGGTCTGGGGGATGG - Exonic
967993813 3:195151789-195151811 AACCCTATATGCCTGGGGGAGGG + Intronic
968454939 4:692957-692979 CACCCCGAAGCCCTGGGGGAAGG + Intergenic
969054695 4:4394315-4394337 GTCTCTGAAGGCCTTGGGGATGG - Intronic
969934868 4:10670322-10670344 TACTCTTAAGGGATGGGGGATGG - Intronic
970797792 4:19935048-19935070 GATTACAAAGGCCTGGGGGAAGG + Intergenic
973301328 4:48588397-48588419 CACATTAAAGAACTGGGGGATGG - Intronic
976599965 4:86928977-86928999 AACACTAAAGGACTTGGGGAAGG - Intronic
976886130 4:89986699-89986721 CAGTCTAAAGACCTGGAGGCAGG - Intergenic
977104467 4:92863721-92863743 CACTCTAAAATCCTGTGGCACGG - Intronic
977518018 4:98046553-98046575 CACCCTAATCTCCTGGGGGACGG - Intronic
978734941 4:112075275-112075297 CACTCTAAACTCCTGGCTGATGG + Intergenic
982479321 4:155890156-155890178 CACTCTCAAGGCTGGGAGGATGG - Intronic
984369322 4:178841993-178842015 AACTCCAAAGGCATTGGGGAGGG + Intergenic
985189610 4:187358053-187358075 AGCTCTAATGGGCTGGGGGAGGG - Intergenic
986483737 5:8214666-8214688 CACTCTAAGGTCCTGGGGACGGG + Intergenic
987650114 5:20730442-20730464 CATTCTTAAGGCCTAGGGCAAGG + Intergenic
988745444 5:34131024-34131046 CATTCTTAAGGCCTAGGGCAAGG - Intergenic
990842166 5:60094476-60094498 CATTCTAAAGTACTGGGGGTGGG - Intronic
994679692 5:102870489-102870511 CACTTTAAAGTCCTGTGGTATGG - Intronic
995443535 5:112218038-112218060 CACTCTGTAGCACTGGGGGAAGG - Intronic
996337457 5:122400329-122400351 TAGTATAAAGGCCTGGAGGAAGG + Intronic
998044336 5:138974201-138974223 CTCTCTACAGGCCAGGGAGAGGG + Intronic
998148342 5:139743196-139743218 CTCTCCAAAGTCTTGGGGGATGG + Intergenic
999260779 5:150237548-150237570 CACTCTGAAGGCCTCGGTGGTGG - Intronic
1001961951 5:175884750-175884772 CCCTCTAAAGGCCTACAGGAAGG + Intergenic
1002469588 5:179427534-179427556 CACTCTGATGGACTGGGGAACGG - Intergenic
1004057752 6:12158251-12158273 CACACTAAAGGCCTCTAGGAAGG - Intronic
1004574545 6:16882535-16882557 AACCCAAAAGACCTGGGGGAAGG - Intergenic
1007467740 6:42066598-42066620 GACTCTTAAGACCTGGGGAAGGG - Intronic
1007740184 6:44005160-44005182 GACTCTAAAGGACAGGGGGAGGG + Exonic
1013298621 6:108781958-108781980 CTCTGTGAAGGGCTGGGGGAGGG + Intergenic
1016091248 6:139982030-139982052 CACCTTAGAGTCCTGGGGGAAGG - Intergenic
1017452518 6:154567020-154567042 TACTCTGCAGGCCTGGGGCAAGG + Intergenic
1017910519 6:158788337-158788359 CACCCAAAAGGGATGGGGGAAGG + Intronic
1020088558 7:5324498-5324520 CACCCCAGAGGCCAGGGGGAAGG + Intronic
1023861252 7:44218776-44218798 ATCTCTGAAGGCCTTGGGGACGG + Exonic
1025205751 7:56992616-56992638 CACCCCAGAGGCCAGGGGGAGGG - Intergenic
1025666189 7:63584322-63584344 CACCCCAGAGGCCAGGGGGAGGG + Intergenic
1029293215 7:99518481-99518503 GACTCAAAAGGCCTGGGGTGAGG - Intronic
1029403334 7:100358526-100358548 CACTCTTCAGGCATGGGGGAGGG - Intronic
1029405913 7:100373880-100373902 CACTCTTCAGGCATGGGGGAGGG - Intronic
1031969486 7:128053883-128053905 CACTCCACAGGCCTGGGGTCGGG - Intronic
1032054355 7:128672630-128672652 CCTTTTAAAGCCCTGGGGGAGGG + Intronic
1032711374 7:134463298-134463320 CACTCTGCTGGCCTGGGGGCAGG - Intergenic
1032985862 7:137336531-137336553 CATGCTCAAGGCCTGGGGGTTGG - Intronic
1034203834 7:149298940-149298962 CAATCCAGAGTCCTGGGGGAAGG + Intergenic
1036222116 8:6929716-6929738 CACTCTCAGGGGCTGGGAGATGG - Intergenic
1036616779 8:10393953-10393975 AACACACAAGGCCTGGGGGATGG - Intronic
1037046294 8:14308544-14308566 CAGTATAAAGGCCAGGGGCAAGG - Intronic
1039568084 8:38565213-38565235 TACTCAGAGGGCCTGGGGGAGGG + Intergenic
1046180466 8:110639520-110639542 CTCTCTAATGTCCTGGAGGATGG + Intergenic
1046289437 8:112137550-112137572 CCCTCTGAAGGCCTAGGAGAGGG - Intergenic
1046301684 8:112301814-112301836 CACTCCAAAGACCTGAGGAAAGG + Exonic
1047358299 8:124144133-124144155 CACACCAAAGGCCTATGGGAGGG - Intergenic
1048031851 8:130640700-130640722 CACTCCAGAGGCCTGGGGCCTGG - Intergenic
1049053305 8:140215862-140215884 CACGCTAAAGCCGTGGAGGAGGG + Intronic
1049200781 8:141339612-141339634 CAGGCTCAAGGCCTGGGGGAAGG - Intergenic
1049231076 8:141481885-141481907 GACAGTAAAGGTCTGGGGGAGGG - Intergenic
1049491226 8:142904155-142904177 CAGTCTGGAGGCCTGGGGGTTGG - Intronic
1049664843 8:143838367-143838389 CACTCTAAAGCCTTGGGCAAAGG + Intronic
1050318072 9:4423448-4423470 TTTTCTAAAGGTCTGGGGGAGGG - Intergenic
1057851287 9:98568651-98568673 CACTGCAAAGGCCAGAGGGATGG - Intronic
1060081994 9:120657236-120657258 TAATCTAAAGGCCTAGGGCAGGG - Intronic
1060281523 9:122218844-122218866 CAGTGCAAAGGCCTGGGGGTGGG - Intronic
1061257552 9:129461161-129461183 CTCTCTGAAGGCCTTGGAGAAGG - Intergenic
1061943898 9:133897846-133897868 CATTCTGGAGGCCTGGGGGCGGG - Intronic
1062382835 9:136295835-136295857 CAAACCAAAGACCTGGGGGAGGG + Intronic
1187064611 X:15821184-15821206 CACTTTAAAGGCTCGGGGGATGG + Intronic
1189317219 X:40064588-40064610 CACTATACTCGCCTGGGGGAGGG + Exonic
1192358616 X:70424965-70424987 CATGGTGAAGGCCTGGGGGAAGG - Exonic
1195001630 X:100648449-100648471 CCCTCTTCAGCCCTGGGGGAAGG - Intronic
1195209566 X:102640219-102640241 CCCTCTGAAGGCATGCGGGAAGG - Intergenic
1195675939 X:107507154-107507176 CACTCCAAAGACCAGGTGGAGGG - Intergenic
1196370535 X:114974463-114974485 GACTCCAAAGGCCTAGGAGATGG + Intergenic
1198772931 X:140150047-140150069 CACTCTCAGGGGCTGGGAGATGG + Intergenic
1198939043 X:141932320-141932342 CACTGTCAAGGTATGGGGGAGGG + Intergenic
1199128617 X:144157285-144157307 CACTCTGGGGGCCTGGAGGATGG - Intergenic
1200123017 X:153800184-153800206 CCCTCCCAAGGCCTGGGGGTGGG - Intergenic