ID: 920504746

View in Genome Browser
Species Human (GRCh38)
Location 1:206507845-206507867
Sequence GCTGCAGACCAGGCCGGAGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 1, 2: 4, 3: 21, 4: 320}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920504746_920504753 -1 Left 920504746 1:206507845-206507867 CCCGCTCCGGCCTGGTCTGCAGC 0: 1
1: 1
2: 4
3: 21
4: 320
Right 920504753 1:206507867-206507889 CAGAGACTGCGGCGGCGGCCTGG 0: 1
1: 0
2: 10
3: 21
4: 293
920504746_920504752 -6 Left 920504746 1:206507845-206507867 CCCGCTCCGGCCTGGTCTGCAGC 0: 1
1: 1
2: 4
3: 21
4: 320
Right 920504752 1:206507862-206507884 TGCAGCAGAGACTGCGGCGGCGG 0: 1
1: 0
2: 4
3: 34
4: 343
920504746_920504755 24 Left 920504746 1:206507845-206507867 CCCGCTCCGGCCTGGTCTGCAGC 0: 1
1: 1
2: 4
3: 21
4: 320
Right 920504755 1:206507892-206507914 CGCCCCGACCCCGCGACGTGCGG 0: 1
1: 0
2: 0
3: 7
4: 75
920504746_920504751 -9 Left 920504746 1:206507845-206507867 CCCGCTCCGGCCTGGTCTGCAGC 0: 1
1: 1
2: 4
3: 21
4: 320
Right 920504751 1:206507859-206507881 GTCTGCAGCAGAGACTGCGGCGG 0: 1
1: 0
2: 5
3: 22
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920504746 Original CRISPR GCTGCAGACCAGGCCGGAGC GGG (reversed) Exonic
900171968 1:1273709-1273731 GCCGTAGTCGAGGCCGGAGCAGG + Exonic
900248062 1:1648597-1648619 GCTGTAGGCCAGGTGGGAGCAGG - Intronic
900314149 1:2048766-2048788 GCTGCAGACCAGGAGGGCGAGGG + Intergenic
900481421 1:2901288-2901310 GCTGCAGACCTGGTTGGGGCTGG + Intergenic
901067659 1:6502082-6502104 GCTGCAGGCCATGCTGGGGCTGG + Intronic
901337566 1:8464416-8464438 GCTGCACACCAGGCTGGGACTGG - Intronic
901436687 1:9250947-9250969 GCTGCTGCACAGGCCGGAGGGGG + Intronic
901441663 1:9281923-9281945 GCAGCAGTCCAGCCCCGAGCTGG + Intergenic
902466980 1:16624437-16624459 GCAGCTGAGCAGGCGGGAGCAGG - Intergenic
902584861 1:17432486-17432508 ACTGCAGACCAGGCAGGCGGAGG + Intronic
902733564 1:18385460-18385482 GCTGCAGACCAGGCCAGAGCGGG + Intergenic
904038687 1:27572038-27572060 GCTGAAGGCCAGGCTGGTGCAGG - Intronic
905238238 1:36565203-36565225 GCTGCAGACCAGGGAGGGGTTGG + Intergenic
905399671 1:37692276-37692298 GCAGCCGGCCAGGGCGGAGCCGG + Intergenic
905887946 1:41501797-41501819 GCCACAGCCCAGGCCTGAGCTGG - Intergenic
907069295 1:51519309-51519331 GCCGCAGGCGAGGCCGGGGCGGG + Exonic
907251565 1:53143013-53143035 GCTGCGGGCCAGGCCTGTGCTGG + Intergenic
909110419 1:71469599-71469621 GCTGCAGACAAGGTCTCAGCTGG - Intronic
909605247 1:77501260-77501282 ACTGAAGACCAGTCCAGAGCTGG + Intronic
909712922 1:78672964-78672986 GCTGCACACCAGGCTGGTGTTGG + Intergenic
912446391 1:109740039-109740061 GGAGGAGACCACGCCGGAGCCGG - Intronic
915300078 1:154946719-154946741 GCTGCAGAGCCCCCCGGAGCTGG + Exonic
915912364 1:159923026-159923048 GCTGCTGACCAGGCCTGGCCTGG - Intronic
918497420 1:185156552-185156574 GCTGGAGCCGAGGCCGGAGTCGG + Exonic
920199871 1:204252956-204252978 GCCGCAGCACAGGCGGGAGCAGG - Intronic
920219884 1:204389226-204389248 GCTGTTGCCCAGGCTGGAGCTGG + Intergenic
920504746 1:206507845-206507867 GCTGCAGACCAGGCCGGAGCGGG - Exonic
920665377 1:207959417-207959439 CCTGCAGACCCGGCCGCGGCCGG + Intergenic
921320602 1:213934709-213934731 GCTACCAACCAGGCAGGAGCAGG + Intergenic
922076732 1:222252786-222252808 GGTGAGGACCAGGCCGCAGCAGG + Intergenic
923537347 1:234863357-234863379 CCTGCAGCCCAGGCTGGGGCTGG - Intergenic
924615307 1:245607373-245607395 TCTGTAGAGCAGGCAGGAGCAGG - Intronic
1063703872 10:8411542-8411564 GCTGCAGAGGAGGCCGTGGCAGG + Intergenic
1065880507 10:30033779-30033801 CCTGCAGCCCAGGCCCCAGCAGG - Intronic
1065965258 10:30765699-30765721 GCTGCAGCCCAGGCCCTAACTGG + Intergenic
1069904640 10:71725140-71725162 GCTGCAGGCCTTCCCGGAGCAGG + Intronic
1070326870 10:75395464-75395486 GCTGCAGAGCCCGGCGGAGCAGG - Intergenic
1070373068 10:75803899-75803921 ATGGCAGACCAGGACGGAGCGGG - Intronic
1070392609 10:75984349-75984371 TCAGCAGACCAGGCCCCAGCAGG - Intronic
1071857872 10:89644687-89644709 GCTGCAGCTCCGGCAGGAGCGGG + Exonic
1072203361 10:93180764-93180786 CCTGCAGACCGGGCAGGAGTGGG - Intergenic
1072656666 10:97334640-97334662 GCTGCGGGCGAAGCCGGAGCAGG + Exonic
1072679631 10:97497964-97497986 GCTGCAGACCAGGCAGGAGGGGG - Intronic
1072971352 10:100020423-100020445 GCTGCATTCCAGGCAGGAGGTGG + Intergenic
1075091976 10:119448900-119448922 GATGCAGACCAGGCAGAGGCTGG + Intronic
1075559121 10:123455818-123455840 GATGCAGAGCAGGCCCGGGCGGG + Intergenic
1076062030 10:127420423-127420445 GCAGCAGAGCAGGCTGGTGCCGG - Intronic
1076156114 10:128206997-128207019 GCTGCTGGCCAGGCCTGAGCAGG + Intergenic
1076164098 10:128268259-128268281 GCTGCAGAGCAGGCGGGAAGAGG + Intergenic
1076834676 10:133015023-133015045 CCTGCAGGCCAGGCCGGCTCCGG + Intergenic
1077190679 11:1254898-1254920 GCAGCAGCCCTGGCCGGGGCAGG - Intronic
1077254495 11:1574208-1574230 GCTACTGGCCAGGCTGGAGCAGG + Intergenic
1077324836 11:1959231-1959253 GCTGCAGAGGAGCGCGGAGCAGG + Intronic
1077482211 11:2821077-2821099 GCAGCAGAGCAGGCCGGACCTGG - Intronic
1078699715 11:13668889-13668911 GCTGCAGGCCTGGCCGAGGCGGG + Intronic
1079078268 11:17396869-17396891 GCTGCAGGACAGGCGTGAGCAGG - Intronic
1079328540 11:19514822-19514844 GCTGCAGCCCAGGCAGGCCCAGG + Intronic
1080610117 11:33896583-33896605 GGTGGTGACCAGGCCGGAGTTGG - Intergenic
1083660111 11:64247977-64247999 CCAGCAGACCAGGTCGGCGCAGG - Intergenic
1083927249 11:65815385-65815407 GCCGCAGCCCAGGTCTGAGCCGG + Intergenic
1084089283 11:66869722-66869744 GCTGCACACCTGGCCACAGCAGG + Intronic
1084216909 11:67652420-67652442 GAGGCAGAACAAGCCGGAGCTGG - Intergenic
1085485651 11:76860904-76860926 GCTGGCGACCAGGCCGGCTCCGG - Exonic
1086001232 11:81987956-81987978 GCTGCAGTCCAGGCCTGCTCAGG - Intergenic
1086520254 11:87661028-87661050 GCCACAGATCAGGCCTGAGCTGG - Intergenic
1086945829 11:92843199-92843221 CCTGCAGACCAGGTGGGATCTGG - Intronic
1088172880 11:107017980-107018002 CCTGGAGACCAGCCCGGAGGAGG - Exonic
1089319433 11:117614928-117614950 GCTGCAGACAAGCCCAGGGCAGG + Intronic
1090275619 11:125417349-125417371 CCTGGAGACCAGGCCCCAGCAGG + Intronic
1091238692 11:134038321-134038343 GCTGGAGACCAGGCAGGAGTGGG - Intergenic
1202807816 11_KI270721v1_random:14408-14430 GCTGCAGAGGAGCGCGGAGCAGG + Intergenic
1091566547 12:1652966-1652988 ACTGCAGACCAGTCTGGAGTGGG - Intergenic
1092196924 12:6555399-6555421 GCTCCAGTCCCGGCCCGAGCCGG + Exonic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1093736375 12:22625153-22625175 GCCGCAGAGCATGCCGGGGCTGG - Exonic
1095038459 12:37419249-37419271 GCTGCAGCCGAGGCGGCAGCTGG + Intergenic
1101764083 12:107682558-107682580 TCCGCAGAGCAGGCAGGAGCTGG - Intergenic
1102966305 12:117130384-117130406 GCTCCAGCTCAGGCAGGAGCAGG + Intergenic
1103010514 12:117455092-117455114 GATGCAGAGCAGGCCTGAGGTGG + Exonic
1103568035 12:121826872-121826894 GCTGGACACCAGGCCTGAGATGG + Intronic
1104547223 12:129723379-129723401 GGTGCAGAGCAGGGCGGAGGAGG - Intronic
1104929163 12:132329251-132329273 GCTGAAGCCCAGGCCCGGGCGGG - Intronic
1104940642 12:132392987-132393009 GTCGTAGACCAGGCTGGAGCCGG - Intergenic
1108559937 13:51633205-51633227 GCTGGAGGCCAGGCCAGTGCTGG - Intronic
1115762031 14:36584388-36584410 TCTGCAGACGGGGCCGGGGCGGG + Intergenic
1117737415 14:58781775-58781797 TCTGCAGACAAAGCCGGAACAGG - Intergenic
1119484354 14:74978282-74978304 GGTGCAGGCCAGGCTGGAGGCGG + Intergenic
1119748263 14:77059737-77059759 GCTCCAAACCAGGCCGGTGGTGG + Intergenic
1119753517 14:77098081-77098103 CCGGAAGACCAGGCCGGCGCGGG - Exonic
1121035858 14:90703099-90703121 GCTCCAGACCTGGCCAGAGCTGG + Intronic
1123030832 14:105450331-105450353 GCGGCAGACCAGGCCGGGCTGGG - Intronic
1125664028 15:41416521-41416543 GCGACAGACCAGGCTGGAGAAGG - Intronic
1126849638 15:52789315-52789337 GATGCTGCCCAGACCGGAGCTGG + Exonic
1127871633 15:63079028-63079050 GCTGGAGTCCAGGCCGGAGCAGG - Intergenic
1128153661 15:65378229-65378251 GCTGCAGCCCGGGACGGCGCCGG - Intergenic
1128612749 15:69087218-69087240 CCTGCACCCCTGGCCGGAGCTGG + Intergenic
1128681321 15:69654067-69654089 ACTGCAGAGCAGGCAGTAGCTGG - Intergenic
1129113015 15:73349130-73349152 GCTGGAGACCAGGAAGGAGGTGG - Intronic
1129152563 15:73698120-73698142 GCTGCAGGTCAGGCCTGAGCTGG - Intronic
1129169221 15:73797734-73797756 GCTGCAGGACTGGCAGGAGCGGG + Intergenic
1129198192 15:73983416-73983438 GCTGCAGTCCAGGCCCGTGCTGG - Exonic
1131260283 15:90884340-90884362 GCTGCGGCCCAGCGCGGAGCAGG + Intronic
1132553180 16:561495-561517 GCTGCAGACCCGGCCTGGACTGG - Intronic
1132611992 16:821824-821846 CCTGCCGACCAGCCAGGAGCTGG + Intergenic
1132669797 16:1097915-1097937 GCTGCAGGCCAGGCCTGAGTGGG + Intergenic
1132894779 16:2223656-2223678 GCAGAAGCCCAGGCCGAAGCCGG + Exonic
1132915226 16:2340441-2340463 CCCGCAGGCCAGGCCGGAGCTGG + Intronic
1133104746 16:3500198-3500220 GCTGCACAACAGGCCGGAAAGGG - Intergenic
1133194558 16:4159753-4159775 GCAGCAGAACATGGCGGAGCGGG + Intergenic
1133284529 16:4684388-4684410 GCTGCAGACAGAGCAGGAGCAGG + Intronic
1133328803 16:4958453-4958475 GCTCCAGGCCAGGCGGGCGCGGG + Intronic
1133788322 16:8989886-8989908 GTTCCAGACCAGGCCGGACGCGG + Intergenic
1135417317 16:22278477-22278499 GCCACAGAGCAGGCAGGAGCAGG + Intronic
1136417635 16:30113391-30113413 GCAGCAGATGAGGCCGGCGCAGG + Exonic
1137731470 16:50693585-50693607 GCCGCAGCCCGAGCCGGAGCCGG + Intronic
1139636487 16:68261312-68261334 CCTGCTGACCAGGCAGGAGCAGG - Intergenic
1139699024 16:68695806-68695828 TCTGGAGGCCAGGCCGGAGGTGG + Exonic
1139973217 16:70789347-70789369 GCTGCAGAGCAGGAGGGAGAAGG - Intronic
1140399711 16:74661224-74661246 GTTGCGGAGCAGGCTGGAGCAGG + Exonic
1142006539 16:87692055-87692077 GCTGGAGACCGGGCAGGACCAGG - Intronic
1142173718 16:88635472-88635494 GCTGCAGGCCAGGCCGGGTGGGG - Intergenic
1142298544 16:89242921-89242943 GTTGCTGACCAGCCCAGAGCTGG - Intergenic
1142351463 16:89582706-89582728 GCTGCTGGCCAGGCCGGCCCTGG + Intronic
1142375976 16:89707354-89707376 GCTGCACCCCAGGCCCCAGCCGG + Exonic
1142419821 16:89963341-89963363 TCTGCAAACAAGGCGGGAGCAGG - Exonic
1142526457 17:545220-545242 TCTGCAGGCCAGGCCGAAGAAGG - Intronic
1143029090 17:3957571-3957593 GAAGCAGATCAGGCCTGAGCAGG - Intronic
1144677772 17:17172862-17172884 GGTGCTGACCAGGCCACAGCTGG + Intronic
1144964909 17:19070725-19070747 GCCGCAGACCGGCCAGGAGCAGG + Intergenic
1144983058 17:19181453-19181475 GCCGCAGACCGGCCAGGAGCAGG - Intergenic
1144985166 17:19196786-19196808 GCCGCAGACCGGCCAGGAGCAGG + Intergenic
1146621577 17:34402483-34402505 GCCTCAGGCCAGGCCTGAGCAGG - Intergenic
1146691877 17:34882437-34882459 ACTGTAGACCAGGCCTGGGCTGG - Intergenic
1147677277 17:42216579-42216601 GTTCCAGACCAGCCTGGAGCTGG - Intronic
1148105951 17:45118959-45118981 GCTGCTGAAGCGGCCGGAGCTGG - Exonic
1148930078 17:51120757-51120779 GCTGGAGCCCGGGCCGGGGCTGG + Exonic
1149467151 17:56888967-56888989 GCTGTAGACAAGGCCAGGGCTGG - Exonic
1150227701 17:63532795-63532817 GCTCCAGACAAGGATGGAGCCGG - Intronic
1150280736 17:63928534-63928556 GCTGCATGCCAGGCCCTAGCTGG - Intergenic
1151358390 17:73573633-73573655 GCTGTGGTCCAGGCCAGAGCTGG - Intronic
1151359207 17:73578599-73578621 TCTGCAGACCAGGCCTGGGTTGG + Intronic
1151743589 17:76000349-76000371 GCTCCAGACAAGGCCGTCGCTGG - Exonic
1152184150 17:78843654-78843676 GCGGCAGCCCAGGCCCGGGCAGG + Intergenic
1152286015 17:79413781-79413803 GCTGCTGGCCAGGCCGCAGAAGG - Intronic
1152531177 17:80920132-80920154 GCTGCAGAGCTGGCTGGGGCAGG - Intronic
1152552150 17:81035218-81035240 GCTGCACCACAGACCGGAGCGGG - Exonic
1152589577 17:81204795-81204817 GGTGCAGGCCAGGCTGGTGCTGG - Intronic
1152633403 17:81420694-81420716 GCTGCAAACCCGGCCTGGGCCGG + Intronic
1152735674 17:81995801-81995823 GCTGCAGACCAGACTCAAGCTGG + Intronic
1154049030 18:10935796-10935818 GCTGCTGGCGAGGCAGGAGCAGG - Intronic
1157662836 18:49460555-49460577 GCTGCAGGCCGGACCGGAGCCGG - Exonic
1160740408 19:682972-682994 TCTGCAGGCCTGGCCGGGGCAGG - Exonic
1160748918 19:724650-724672 GCTGCTGCCCAGGCTGGAGTAGG + Intronic
1160842918 19:1154485-1154507 GCTGCAGCCCAGGCTGGGACCGG - Intronic
1160859589 19:1232052-1232074 TCTCCAGACCAGGGTGGAGCTGG - Intronic
1160988577 19:1851521-1851543 GCAGAAAACCAGGCAGGAGCTGG + Intergenic
1160990522 19:1858529-1858551 GCTGTATACCAGGCCTGTGCTGG - Intronic
1161330237 19:3683424-3683446 GCTGGAGCGCAGGCAGGAGCTGG + Intronic
1162158861 19:8697436-8697458 GCTACTGACCAGGGCAGAGCTGG - Exonic
1162158956 19:8697879-8697901 GGAGCAGGCCCGGCCGGAGCAGG - Exonic
1162182786 19:8882152-8882174 GCTGCATATCGGGCCTGAGCTGG + Intronic
1162433617 19:10643788-10643810 GGTTCAGTCCTGGCCGGAGCAGG - Exonic
1162506918 19:11090880-11090902 GCTGCAGACCAAGGAGGGGCGGG - Intronic
1162566034 19:11446287-11446309 GCTGCAGACTCACCCGGAGCTGG + Exonic
1163012221 19:14433380-14433402 GGAGCCGAGCAGGCCGGAGCGGG + Intronic
1163127224 19:15250894-15250916 TCTGCAGACCTGGGTGGAGCAGG - Intronic
1163321275 19:16576452-16576474 GCAGCAGTCCAGGACAGAGCTGG - Exonic
1163371390 19:16903235-16903257 GCCCCAGACCAGGCTGGGGCAGG - Intronic
1163517937 19:17776066-17776088 GCTGGAGCCCGGGCCGGGGCAGG - Exonic
1163783407 19:19261932-19261954 GCAGCAAACCGGGCCGGGGCGGG + Intronic
1164548079 19:29185656-29185678 GCTGGAGACCCGGCAGGGGCCGG + Intergenic
1164578615 19:29420699-29420721 GGTGGAGACGAGGCCGGAGGAGG - Intergenic
1165385723 19:35509802-35509824 CCTGCAGACAAGGCAGGAGGGGG + Intronic
1165476397 19:36033119-36033141 CCTGCAAACCAGGCCGGTGAGGG + Intronic
1166301153 19:41912908-41912930 GCTACAGTCCATGGCGGAGCCGG + Intronic
925069659 2:956338-956360 TCTGCAGCTCAGTCCGGAGCAGG + Intronic
925609850 2:5693429-5693451 GCTGCAGATCAAACAGGAGCCGG + Exonic
926268028 2:11344216-11344238 GGTGGAGTCCCGGCCGGAGCTGG - Exonic
926633570 2:15158641-15158663 GCTGCAGACCCAGCCAGAGTCGG + Intergenic
927432863 2:23041733-23041755 GCTGCAGGCTAGGCAGGGGCAGG - Intergenic
927904881 2:26848866-26848888 GCGGCTGCCCAGCCCGGAGCGGG + Intronic
927971303 2:27307589-27307611 GCTGCGGACCCTGCTGGAGCTGG - Exonic
928983183 2:37156820-37156842 GCTGCAGGCCCAGCCGGGGCGGG - Intronic
932430878 2:71672901-71672923 GCAGCAGTCCAGGCCGTGGCTGG + Intronic
932599360 2:73113064-73113086 GCCGCAGACCAGCCCGGAGCGGG + Intronic
932759594 2:74430620-74430642 GATGCAGACCCGGCCGCGGCAGG + Exonic
933812156 2:86039609-86039631 GTTGCACACGAGGCCAGAGCTGG - Intronic
934676827 2:96255131-96255153 CCTGCAGACCACCCAGGAGCAGG - Intronic
935223485 2:101034538-101034560 GCTACAGCCCAGGCCTCAGCGGG + Intronic
935558632 2:104538156-104538178 GCTGCAGCGCAGGCAGGAGGAGG + Intergenic
937224004 2:120357800-120357822 GCTGCAGTGCAGCCCAGAGCAGG - Intergenic
938083241 2:128381297-128381319 TCTGGAGACCAGGCCTGAGGAGG + Intergenic
942267413 2:174242370-174242392 GCTGCTGACCTGACCGGAGGTGG + Intronic
943669724 2:190648656-190648678 GCTGGAGAGCAGGCCGGAGGCGG + Intronic
945157050 2:206849955-206849977 GCTGCTGACCTGGCAGGAGGTGG + Intergenic
946843247 2:223837791-223837813 GCTGCAGCCGAGGCGGGGGCGGG - Intronic
947624984 2:231613664-231613686 GCTGTAAACCTGGCTGGAGCCGG - Intergenic
948718848 2:239883496-239883518 GCTGCTGACCAGGGAGGAACTGG - Intergenic
948911938 2:241009278-241009300 GCAGCAGCCCAGGCTGGAGATGG + Intronic
948983871 2:241508464-241508486 GCTGCAGAGCGGGCCGGGGGAGG - Exonic
1169358066 20:4924493-4924515 GCAGGAGGCCAGGCAGGAGCTGG - Intronic
1169899140 20:10535143-10535165 GCAGAAGGCCAGGCTGGAGCAGG + Intronic
1172036965 20:32017996-32018018 GCTGAAGACCACGGCGGAGCAGG + Exonic
1172116573 20:32576738-32576760 GCTGCAGGCCTGGCCTGGGCGGG - Intronic
1172389803 20:34559024-34559046 GCCCCCGCCCAGGCCGGAGCTGG - Intronic
1172444359 20:34985298-34985320 GCTGGAGACCAGGCAGAGGCTGG - Intronic
1172457938 20:35092562-35092584 GGGGCGGACCAGGCGGGAGCTGG - Intronic
1172482610 20:35279821-35279843 GCTGCAGGTCAGGGAGGAGCAGG - Intronic
1173027637 20:39324411-39324433 GCTGCAACCCAGGGCGGAGAGGG - Intergenic
1173058309 20:39637293-39637315 GCAGGACTCCAGGCCGGAGCAGG - Intergenic
1173510722 20:43625982-43626004 TCTGTTGACCAGGCTGGAGCGGG - Intronic
1173798311 20:45878259-45878281 GCTGCACACCAGCCAGCAGCCGG + Exonic
1173906279 20:46632002-46632024 GCTGCAGCCCAGCAGGGAGCTGG - Intronic
1175523348 20:59617122-59617144 TCTACAGACCAGGATGGAGCTGG - Intronic
1175524889 20:59626844-59626866 GCTGAAGACCAAGGCAGAGCTGG - Intronic
1175767742 20:61602965-61602987 CCTGCAGATCACGCAGGAGCTGG - Intronic
1175863903 20:62164358-62164380 CCTGTAGCCCAGGCCTGAGCTGG - Intronic
1176031710 20:63016047-63016069 GCTGCAGGCCTGGGCGGGGCGGG - Intergenic
1176145421 20:63563292-63563314 GCTGCAGCGCTGGCCGGAGGCGG - Exonic
1179048282 21:37866524-37866546 GGAACAGACCTGGCCGGAGCTGG + Intronic
1179779348 21:43689511-43689533 GCTGCAGTCCAGGGAGGAGATGG - Intronic
1179819367 21:43927842-43927864 TCTGCAGGCCAGGCCTGACCTGG - Intronic
1180087185 21:45513028-45513050 GTTGGAGGACAGGCCGGAGCTGG - Exonic
1180224774 21:46385894-46385916 GCTGCAGCAGAGGCGGGAGCGGG + Exonic
1180898437 22:19353897-19353919 GGTGGAGACCAGGCCTGGGCAGG + Intronic
1181013545 22:20055811-20055833 GCTCCTGACCTGGCCGCAGCGGG + Intronic
1181408443 22:22701647-22701669 GCTGTACCCCAGGCTGGAGCTGG - Intergenic
1181514406 22:23402780-23402802 GCTGCAGGCCAGGCAGCAGGAGG + Intergenic
1181556054 22:23672239-23672261 ACTGCTGAGCAGGCCGGGGCAGG - Intergenic
1181698325 22:24606414-24606436 ACTGCTGAGCAGGCCGGGGCAGG + Intronic
1182442746 22:30373716-30373738 GCTGCAGAGCGAGCGGGAGCAGG + Exonic
1183430464 22:37762661-37762683 GCTGAAGACCAGGCAGGTGGAGG + Intronic
1184240007 22:43207025-43207047 GCTGCTGCCCAGGGCTGAGCTGG + Intronic
1184455398 22:44607184-44607206 GCTGCAGAACAGTCAGGTGCAGG + Intergenic
1184804012 22:46780735-46780757 GCTCCACACCAGGCCCGGGCTGG - Intronic
1185330176 22:50248890-50248912 ACTACAGGCCAGGCCGGAGTGGG + Exonic
950362888 3:12462343-12462365 GCTGGAGGCAAGGCCTGAGCAGG + Intergenic
950534426 3:13571010-13571032 GGTGCAGTCCAGGCAGGCGCAGG + Exonic
950638400 3:14332468-14332490 GCTGCAGAACAGGTCTGAGTGGG - Intergenic
951443186 3:22746501-22746523 GGTTCAGACCATGCCAGAGCAGG - Intergenic
954036890 3:47855622-47855644 GCTGCAGGCCAGGCTTGGGCAGG + Intronic
954109108 3:48424422-48424444 GCTGCAGCCCAGGGCTCAGCTGG + Exonic
954219577 3:49144813-49144835 GCTGCAGAACAGGCAGGCACAGG + Intergenic
954372532 3:50176340-50176362 GCTGCAGACCTGGCCAGGGCAGG - Intronic
955246255 3:57227773-57227795 GCTGCAGCCCTTGCCGGAGAGGG + Exonic
955322731 3:57985873-57985895 GGTGGAGACCAGGATGGAGCAGG + Intergenic
960896717 3:122514245-122514267 GTTACAGACCGGGTCGGAGCCGG - Intronic
961458063 3:127033966-127033988 GCTGCGGAGCAAGCTGGAGCAGG + Exonic
961551583 3:127672926-127672948 GCTGCAGAGCGGGGCGGGGCGGG + Exonic
961604097 3:128081133-128081155 GCTGCAGACCACGCCTGAGTGGG + Exonic
962202474 3:133413097-133413119 GCTGGAGACAGGGCAGGAGCAGG + Intronic
967122979 3:186400126-186400148 GCTGCACACCAGGTGGGAACAGG - Intergenic
967248251 3:187510622-187510644 TCTGTAGCCCAGGCTGGAGCTGG - Intergenic
967859795 3:194141868-194141890 GCGGCAGGCCACGCCGGGGCAGG + Intergenic
968084905 3:195869897-195869919 GCTGCAGACCCAGCCCGAGGAGG + Intronic
968262931 3:197339768-197339790 GCTGCTGCCCAGGCAGGAGACGG - Intergenic
968570610 4:1338523-1338545 CTTGCAGACCAGGCGGGAGTTGG - Exonic
969417043 4:7067796-7067818 GCAGCAGAGCAGGCCCCAGCGGG + Intronic
969595963 4:8149431-8149453 GCTGCAGAGCAGGCAGGAGCAGG + Intronic
971424451 4:26502401-26502423 ACTGAAGACCAGACCGGAGTGGG - Intergenic
972651768 4:41024774-41024796 GCTGCAGCCCAGGCCTGCTCAGG - Intronic
977771936 4:100870232-100870254 GCTGCAATCCAGGCTGGTGCTGG + Intronic
982667658 4:158285690-158285712 GCTGCAGAAGAGGCATGAGCAGG + Intergenic
984679771 4:182593898-182593920 GCTGTAAACCAGGGAGGAGCTGG + Intronic
984935303 4:184884372-184884394 GCTGCAGTGCAGGCCGGATATGG + Intergenic
985506138 5:281600-281622 GCTGGAGACCAGGGAGGAACTGG + Intronic
985628416 5:1002182-1002204 GCTGCAGCTCAGGCAGAAGCAGG + Intergenic
986575449 5:9208323-9208345 GCTACAGACGAGCCTGGAGCCGG + Intronic
988536333 5:32072438-32072460 GCTGGAGACCAGGCCGGGCGCGG + Intronic
989567498 5:42915792-42915814 GCTGCAGCCCAGGCCGCCTCCGG + Intergenic
995092869 5:108200106-108200128 GCTGCAGATCAGTCCAGGGCTGG + Intronic
998157746 5:139796015-139796037 GCTGGCGGCCAGGCCGGGGCGGG + Intronic
998406682 5:141878272-141878294 GCCGCAGCCCAGGCCGGGGCCGG - Exonic
999277067 5:150338584-150338606 GCTGCAGCCCAAGCGGGCGCAGG - Intronic
1003033584 6:2623619-2623641 GGTGCCGACAAGGCCGGACCCGG + Exonic
1003116404 6:3286633-3286655 GGTGCAGCCCGGGCCGGGGCAGG + Intronic
1005818532 6:29577440-29577462 ACAGCAGAGCAGGGCGGAGCTGG + Intronic
1006333870 6:33410711-33410733 GCGGGGGACCAGGCCGGAGGCGG + Intronic
1006994639 6:38247434-38247456 GCTGAAGACCAGGCAGCAGATGG + Intronic
1007275595 6:40671269-40671291 GCTGCAGACCCTGACAGAGCTGG - Intergenic
1007327650 6:41073799-41073821 GCCGGAGACCCGGGCGGAGCGGG - Intronic
1011504970 6:88031435-88031457 GCTGCAGCCCAGGCCTGCTCAGG - Intergenic
1016142610 6:140631014-140631036 TCTGCCGTCCAGGCTGGAGCTGG + Intergenic
1017081357 6:150672054-150672076 GCTGCAGGCCAGTCAAGAGCTGG + Intronic
1018070617 6:160161428-160161450 GCTGCAGATCAGGAAAGAGCAGG + Intergenic
1018952735 6:168389562-168389584 GCTGCATACACGGACGGAGCTGG - Intergenic
1019159908 6:170062851-170062873 GCTGCAGGCCAGGCTGGTGACGG - Intergenic
1019293002 7:259341-259363 GCGGCAGACCACGCCGAAGCAGG + Intronic
1019395062 7:813669-813691 ACTGCAGAGCAGGACGGAGCAGG - Intergenic
1019487597 7:1296468-1296490 GCTGTGGGCCAGGCCTGAGCTGG + Intergenic
1023058897 7:36311086-36311108 GCTGCTAGCCAGGCCGGAGTGGG + Intergenic
1024082639 7:45867717-45867739 GCTGCAAGCCAGTCCTGAGCAGG - Intergenic
1025156153 7:56607329-56607351 GCTGCAGACCAGGAAAAAGCAGG - Intergenic
1026479057 7:70763171-70763193 GCTGCGGGGCAGGCTGGAGCTGG - Exonic
1029484270 7:100829566-100829588 CAGGCAGACCAGGCTGGAGCTGG + Intronic
1031599202 7:123684957-123684979 GCAGCAGACCAGGATGGAGCAGG - Intronic
1032128795 7:129212697-129212719 GCTGCCAACCAGGCTGCAGCTGG - Exonic
1032738133 7:134711527-134711549 GCTGGAGACCAGGGAAGAGCTGG - Intergenic
1032801116 7:135317893-135317915 CCTGCAGGACAGGCTGGAGCGGG - Intergenic
1033036726 7:137882485-137882507 GCTGGAGTCCAGGCCGGATGTGG - Exonic
1034270838 7:149802838-149802860 GCTGCTGCCCAGGCCGGGGGAGG + Intergenic
1034964866 7:155384644-155384666 GCTGCAGCCCTGGCTGGACCTGG - Intronic
1035741326 8:1930378-1930400 GCTGCCATCCAGGCGGGAGCTGG - Intronic
1036184753 8:6613538-6613560 GCTGCAGACAAGGTGGGAGGTGG + Intronic
1037149248 8:15616036-15616058 GCTGCAGTCCAGGCTGGTGTAGG + Intronic
1037807406 8:22066411-22066433 GCCGCAGGCCGGGCCGGGGCGGG + Intronic
1041051566 8:53939645-53939667 GCCCCAGGCCAGCCCGGAGCGGG + Exonic
1043075639 8:75695453-75695475 TCTGCAGCCCAGGCAGGAGGGGG - Intergenic
1045547362 8:103140762-103140784 GCTGCAGCGCGGGCGGGAGCGGG + Exonic
1046445407 8:114311741-114311763 GCTGCCTACCAGTCCGGCGCCGG - Intergenic
1047212962 8:122854466-122854488 GCTGCAGATCTGGCCAGAGTGGG - Intronic
1047556682 8:125939517-125939539 TCTGCAGACCAGGCTGCAGTTGG + Intergenic
1048566237 8:135600758-135600780 GCTGCAGACCAAGGCTGTGCAGG - Intronic
1048981266 8:139704254-139704276 GCTGGGGACCAGGCGGGAGGTGG - Intergenic
1049488686 8:142879636-142879658 GCTGCAGATCTGGAGGGAGCAGG - Exonic
1049493585 8:142917663-142917685 GCTGCAGATCTGGAGGGAGCAGG - Exonic
1049657114 8:143803808-143803830 GCTCCAGGCAGGGCCGGAGCAGG + Exonic
1049687415 8:143944484-143944506 ACTGCAGACCAGGGCTGAGGGGG + Intronic
1049719831 8:144110682-144110704 GGTGCAGTCCAGGCTGGAGCAGG - Exonic
1049761192 8:144332707-144332729 GCAGCAGGCCGGGGCGGAGCAGG - Exonic
1049762216 8:144336724-144336746 GGTGCTGCCCAGGCCGGCGCTGG - Intergenic
1051404948 9:16727135-16727157 GCGGGAGAGCGGGCCGGAGCCGG + Intronic
1052192668 9:25677667-25677689 GCTGTAGCCGAGGCCGCAGCCGG - Exonic
1057203224 9:93154736-93154758 GCTGCAGACTAGCCCGGGCCAGG + Intergenic
1057718970 9:97517467-97517489 GCTGCAAACCAGGCCAGGGGAGG + Intronic
1059335959 9:113568638-113568660 GCTGCAGCCCAAGCCGAAGCTGG + Intronic
1059767999 9:117402176-117402198 GCTACAGAGGAGGCCGGGGCAGG - Intronic
1060798145 9:126526526-126526548 GATGGAGAGCAGGCCAGAGCCGG + Intergenic
1061374858 9:130217803-130217825 GCAGCAGACCGGGCCAGAGAGGG - Intronic
1061504965 9:131026583-131026605 GCTGCAGGTCAGGGAGGAGCGGG + Exonic
1062341381 9:136095203-136095225 GCAGCTGCCCAGGCCGGACCGGG - Exonic
1062376147 9:136262747-136262769 CCTGCAGCCCAGCCTGGAGCAGG + Intergenic
1062423778 9:136496872-136496894 GCTGGAGCCCAGGACGGTGCTGG + Exonic
1062454197 9:136628014-136628036 GCCGCAGCCCTGGCCCGAGCTGG - Intergenic
1062486358 9:136778440-136778462 GCTGGAGACCTGGGAGGAGCTGG - Intergenic
1062526746 9:136980989-136981011 GCTGCAGTCCAGGGCCGGGCGGG + Intronic
1062594826 9:137294952-137294974 GCAGCAGAGGAGGCCGGCGCTGG - Intergenic
1203771990 EBV:54172-54194 GCTGCTGACAAGGCGAGAGCGGG - Intergenic
1189182798 X:39019323-39019345 GCTGCACACCAGGCCCCAGCTGG - Intergenic
1190258896 X:48785984-48786006 GCCCCAGGGCAGGCCGGAGCTGG + Intergenic
1190258915 X:48786052-48786074 CCTGCAGGCCAGGCCAGTGCTGG - Intergenic
1192362863 X:70450160-70450182 GCTGAAACCCAGGCCTGAGCGGG - Exonic
1192915669 X:75648897-75648919 GCTGAACACCAGGAAGGAGCTGG - Intergenic
1194971659 X:100350894-100350916 GCTGCAGACCAGGGCGGCCTTGG + Intronic
1200267705 X:154654590-154654612 GCTGCTCACCAGGCCGGCTCAGG + Intergenic
1201059711 Y:10035410-10035432 GCTGCAGGCCAGGCAAGGGCCGG - Intergenic
1201260343 Y:12153131-12153153 GCTGAACACCAGGCAGGAACTGG - Intergenic