ID: 920507488

View in Genome Browser
Species Human (GRCh38)
Location 1:206526690-206526712
Sequence CATTAAAGGCAGAAGTTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 472
Summary {0: 1, 1: 1, 2: 0, 3: 28, 4: 442}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920507474_920507488 10 Left 920507474 1:206526657-206526679 CCTTCCAGCCCCCCTGCCTTACT 0: 1
1: 0
2: 3
3: 52
4: 826
Right 920507488 1:206526690-206526712 CATTAAAGGCAGAAGTTGGAGGG 0: 1
1: 1
2: 0
3: 28
4: 442
920507476_920507488 2 Left 920507476 1:206526665-206526687 CCCCCCTGCCTTACTCCTCTGCA 0: 1
1: 0
2: 4
3: 58
4: 551
Right 920507488 1:206526690-206526712 CATTAAAGGCAGAAGTTGGAGGG 0: 1
1: 1
2: 0
3: 28
4: 442
920507481_920507488 -6 Left 920507481 1:206526673-206526695 CCTTACTCCTCTGCACCCATTAA 0: 1
1: 0
2: 1
3: 14
4: 213
Right 920507488 1:206526690-206526712 CATTAAAGGCAGAAGTTGGAGGG 0: 1
1: 1
2: 0
3: 28
4: 442
920507473_920507488 15 Left 920507473 1:206526652-206526674 CCTATCCTTCCAGCCCCCCTGCC 0: 1
1: 0
2: 7
3: 85
4: 954
Right 920507488 1:206526690-206526712 CATTAAAGGCAGAAGTTGGAGGG 0: 1
1: 1
2: 0
3: 28
4: 442
920507475_920507488 6 Left 920507475 1:206526661-206526683 CCAGCCCCCCTGCCTTACTCCTC 0: 1
1: 0
2: 2
3: 73
4: 860
Right 920507488 1:206526690-206526712 CATTAAAGGCAGAAGTTGGAGGG 0: 1
1: 1
2: 0
3: 28
4: 442
920507480_920507488 -2 Left 920507480 1:206526669-206526691 CCTGCCTTACTCCTCTGCACCCA 0: 1
1: 0
2: 1
3: 38
4: 417
Right 920507488 1:206526690-206526712 CATTAAAGGCAGAAGTTGGAGGG 0: 1
1: 1
2: 0
3: 28
4: 442
920507478_920507488 0 Left 920507478 1:206526667-206526689 CCCCTGCCTTACTCCTCTGCACC 0: 1
1: 0
2: 9
3: 47
4: 454
Right 920507488 1:206526690-206526712 CATTAAAGGCAGAAGTTGGAGGG 0: 1
1: 1
2: 0
3: 28
4: 442
920507479_920507488 -1 Left 920507479 1:206526668-206526690 CCCTGCCTTACTCCTCTGCACCC 0: 1
1: 0
2: 3
3: 40
4: 473
Right 920507488 1:206526690-206526712 CATTAAAGGCAGAAGTTGGAGGG 0: 1
1: 1
2: 0
3: 28
4: 442
920507472_920507488 24 Left 920507472 1:206526643-206526665 CCAACATGACCTATCCTTCCAGC 0: 1
1: 0
2: 0
3: 7
4: 133
Right 920507488 1:206526690-206526712 CATTAAAGGCAGAAGTTGGAGGG 0: 1
1: 1
2: 0
3: 28
4: 442
920507477_920507488 1 Left 920507477 1:206526666-206526688 CCCCCTGCCTTACTCCTCTGCAC 0: 1
1: 0
2: 0
3: 34
4: 445
Right 920507488 1:206526690-206526712 CATTAAAGGCAGAAGTTGGAGGG 0: 1
1: 1
2: 0
3: 28
4: 442

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920507488 Original CRISPR CATTAAAGGCAGAAGTTGGA GGG Intronic
901412603 1:9094943-9094965 CATTAAAGGAATGACTTGGATGG - Intergenic
903744809 1:25579717-25579739 CATTGAAGGCAGAGCTTCGAGGG - Intergenic
904413146 1:30337133-30337155 CATCAAAGGAAGGAGCTGGAAGG - Intergenic
904434290 1:30484255-30484277 AAGTAAAGACAGAACTTGGATGG - Intergenic
905290382 1:36917651-36917673 CAATCATGGCAGAAGTTGAAAGG - Intronic
905472521 1:38204289-38204311 CAGTTAAGGCAGGAGATGGAGGG + Intergenic
906886007 1:49649979-49650001 TATCAAAAGCAGGAGTTGGAAGG + Intronic
907346064 1:53781550-53781572 CATTAAAGGCAAAATGTGAAAGG - Intronic
908170602 1:61500915-61500937 GATCAGAAGCAGAAGTTGGAGGG - Intergenic
908860830 1:68486345-68486367 CAGTCATGGCAGAAGGTGGAGGG - Intronic
909247936 1:73312506-73312528 GATTAATGGCAGAAGGTGAAGGG - Intergenic
909529580 1:76667357-76667379 CAATAATGGCAGAAGGTGAAGGG + Intergenic
910130639 1:83901170-83901192 CTTAAAAGGCAGAAGTTGAGAGG - Intronic
911167919 1:94741547-94741569 CAGGAAAGGCAGAAGTTAGAAGG + Intergenic
911434608 1:97840695-97840717 CATGAAAGGCAGAAGCATGAGGG + Intronic
911971395 1:104442213-104442235 CATCACAGAAAGAAGTTGGAAGG + Intergenic
912013167 1:104997114-104997136 CATTGAAGGCAGAAGACAGAAGG + Intergenic
912535393 1:110364820-110364842 TTTTAAAAGCATAAGTTGGAGGG + Intronic
913223181 1:116675741-116675763 TATTAAAAGCAGGAGTTGGCCGG - Intergenic
913402362 1:118449883-118449905 CAATTAAGGCAGAAGTTGAAGGG - Intergenic
914334018 1:146698937-146698959 CATTACATGCAGATGTGGGAGGG - Intergenic
916450652 1:164917331-164917353 AATAAAAGGCAGAAGATGAATGG + Intergenic
916540495 1:165749104-165749126 CATAATTGCCAGAAGTTGGAAGG - Intronic
916893458 1:169136622-169136644 CATGAATGGCAGAAGAAGGAGGG - Intronic
917593654 1:176504766-176504788 CTTTCAAGGCAAAAGTTGCAAGG + Intronic
918261153 1:182797532-182797554 CATGAAAGGCAGAAGAGGTATGG - Intronic
919212740 1:194509605-194509627 CAATCATGGCAGAAGTTGAAGGG - Intergenic
920072179 1:203310111-203310133 CATTAAAGGTGGAAGTAGGTTGG - Intergenic
920507488 1:206526690-206526712 CATTAAAGGCAGAAGTTGGAGGG + Intronic
921205451 1:212844949-212844971 CATGAGGGACAGAAGTTGGAAGG - Intronic
921558610 1:216629311-216629333 TATTAAAGACAAAAGTGGGAAGG + Intronic
921668005 1:217895506-217895528 GATTAGAGGCAGATTTTGGAAGG - Intergenic
922521980 1:226261308-226261330 AATTAAAGGTAGAATTGGGAAGG + Intronic
922623504 1:227011892-227011914 CATTAGAGGCAGAGGGTGAATGG + Intronic
924069290 1:240259388-240259410 CATGAAAGGCAGTAGTTGAAGGG + Intronic
1063623872 10:7671646-7671668 CTTTAAAGTAAGAAGTTGGCGGG - Intergenic
1064928770 10:20599971-20599993 CATCCAAGGCAGAAGGTGGAAGG - Intergenic
1064934464 10:20664403-20664425 CATTCATGGCAGAAGGTGAAGGG - Intergenic
1066009108 10:31177290-31177312 CAGTGAAGGGAGAAGGTGGAGGG - Intergenic
1066083380 10:31954387-31954409 GGTAACAGGCAGAAGTTGGAGGG + Intergenic
1067580966 10:47445315-47445337 CATTCATGGCAGAAGATGAAGGG - Intergenic
1068616999 10:59129809-59129831 CAGGAAAGCCACAAGTTGGAAGG + Intergenic
1068893996 10:62179583-62179605 CACTCATGGCAGAAGTTGAAGGG - Intergenic
1069088346 10:64168962-64168984 CAGTAAATGTAGAAGTTGAAGGG + Intergenic
1070425160 10:76279955-76279977 CATTAAATGCAGAGGTTGATTGG - Intronic
1070504008 10:77097276-77097298 CAGTAAAGGAGGAAGTGGGAAGG - Intronic
1071094563 10:81958178-81958200 TAATAAAGGCAGAACTTGCACGG - Intronic
1071102295 10:82053294-82053316 TATTAAAGGCAGAAGGATGAGGG + Intronic
1071681547 10:87710925-87710947 CATAGGAGGCAGAAGTTGCAGGG + Intronic
1073244400 10:102079343-102079365 CATTCATGTCAGAATTTGGAGGG - Intergenic
1074929086 10:118105263-118105285 CATTAAATGTTGAAGATGGAAGG + Intergenic
1075493422 10:122895021-122895043 CCTGAGAGGCAGAAGTTGCAGGG - Intergenic
1077654550 11:4006269-4006291 CAATCAAGGCAGAAGGTGAAAGG - Intronic
1078397778 11:10996813-10996835 CTTTGAGGACAGAAGTTGGAAGG - Intergenic
1079853670 11:25571970-25571992 CATTTCAGGCAGAAGTGGGTGGG - Intergenic
1079863951 11:25711695-25711717 CAATCATGGCAGAAGGTGGAAGG + Intergenic
1080456276 11:32422417-32422439 AATGATAGGCAGAAGGTGGAAGG - Intronic
1080904772 11:36531874-36531896 CATTAAAGTCAGAAGGAAGAAGG - Intronic
1080911500 11:36604212-36604234 TATTAAAGGAAGTATTTGGAAGG - Intronic
1082119137 11:48358919-48358941 CAGTAATGGCAGAAGGTGAAGGG + Intergenic
1082865745 11:57898685-57898707 CAATAATGGCAGAAGGTGAAGGG - Intergenic
1083341991 11:61964276-61964298 CATTAAAGGCTGAAGTAGTCTGG - Exonic
1084457473 11:69276640-69276662 CTTGAGAGGCAGAAGCTGGAGGG - Intergenic
1084466931 11:69328798-69328820 CATTAAAGGAATAACTTGGATGG - Intronic
1085896750 11:80648923-80648945 CATTTAAGGCATCAGATGGAAGG + Intergenic
1085930661 11:81079092-81079114 GATAAATGGCAGAAGTAGGATGG - Intergenic
1085960740 11:81458593-81458615 CAATCATGGCAGAAGTTGAAGGG - Intergenic
1085987257 11:81801892-81801914 CAATCATGGCAGAAGTTGAAGGG - Intergenic
1087669122 11:101084194-101084216 CAATCAAGGCAGAAGGTGAAGGG - Intronic
1088366320 11:109043893-109043915 CAGGAAAGGCAGGAGGTGGAAGG + Intergenic
1088711233 11:112510811-112510833 CATCAAAGGCAGAAGTGGTGTGG + Intergenic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1090521508 11:127484842-127484864 TATTAAACCCAAAAGTTGGAAGG - Intergenic
1091270247 11:134305864-134305886 AATTAAATATAGAAGTTGGAAGG + Intronic
1091584591 12:1808905-1808927 CATGAAAGGGAGAAGGGGGAGGG + Intronic
1093636363 12:21474708-21474730 CCATAAAAGCAGATGTTGGAGGG - Intronic
1093807450 12:23451977-23451999 CAATAAAGGCAGCATTTAGAGGG - Intergenic
1095430539 12:42129255-42129277 CATTAAAGGAAGAAGTAGCCAGG + Intronic
1096518074 12:52169100-52169122 CAGTAAAGGCGGAAGGTGAAGGG + Exonic
1097281951 12:57850451-57850473 TATTTTAGGCAGAAGTTAGAAGG - Intergenic
1098075782 12:66729213-66729235 CATTAAAGGCCTAAATTTGATGG + Intronic
1098845794 12:75534208-75534230 CATTAAATGCAGTATTTGTAGGG - Intergenic
1099023794 12:77440316-77440338 CATTAGAGCCAGGAGTAGGAAGG - Intergenic
1099622509 12:85022321-85022343 CAGTAAAGAATGAAGTTGGAGGG + Intronic
1099713335 12:86257728-86257750 CATAAAAGTCAGAACTTGGGAGG - Intronic
1100118171 12:91335066-91335088 CAATCATGGCAGAAGGTGGAAGG + Intergenic
1100754924 12:97740817-97740839 CCTTAAAGTGAGAAGATGGATGG + Intergenic
1101988122 12:109463164-109463186 CATCAAAGGCAGAACGTGGAAGG - Intronic
1102410795 12:112716591-112716613 TGTTAAAGGCACAAGTTGGAAGG + Intronic
1104722153 12:131050545-131050567 CAGTCATGGCAGAAGGTGGAGGG + Intronic
1105709216 13:22990036-22990058 CAATCATGGCAGAAGGTGGAAGG - Intergenic
1106857752 13:33871423-33871445 GATAAAAGCAAGAAGTTGGAGGG - Intronic
1107246637 13:38304789-38304811 CCTTGAAGACAGAGGTTGGATGG - Intergenic
1107522693 13:41199154-41199176 CAATCATGGCAGAAGTTGAAAGG + Intergenic
1107525918 13:41231131-41231153 TATTAAAGACAGAAAGTGGATGG + Intronic
1107719057 13:43229171-43229193 CAATCATGGCAGAAGGTGGAAGG - Intronic
1108237765 13:48426930-48426952 TATTAATGGCAGAAGTCGGAGGG + Intronic
1108804519 13:54137928-54137950 CATTCCAGGCAGAAGTTATAGGG + Intergenic
1108874395 13:55026486-55026508 CTTTAAAGGCTGAAGTGGGAAGG - Intergenic
1108971185 13:56379657-56379679 CAATCATGGCAGAAGTTGAAAGG + Intergenic
1111108674 13:83678342-83678364 CATTAAAGGCAGACCTGGGATGG + Intergenic
1111601723 13:90482618-90482640 GATAACAGGCAGAGGTTGGAGGG - Intergenic
1111954655 13:94743100-94743122 CATTATAGGCAGAATATGGAAGG + Intergenic
1111956689 13:94766694-94766716 CAATAATGGCAGAAGGTGAAGGG + Intergenic
1113293891 13:108936739-108936761 TCTTAAAGACAGTAGTTGGATGG + Intronic
1114938596 14:27576530-27576552 TCTTGAAGGCAGAAGATGGATGG - Intergenic
1114975945 14:28099734-28099756 CAATCATGGCAGAAGGTGGAGGG - Intergenic
1114998859 14:28396173-28396195 AATTAAAGGCAGAGTTTGGCAGG - Intergenic
1115134462 14:30091932-30091954 CAATAATGGCAGAAGGTGAAGGG + Intronic
1115962699 14:38853473-38853495 CAATAATGGCAGAAGGTGAAAGG - Intergenic
1116420523 14:44727034-44727056 CATTCATGGCAGAAGGTGAAGGG - Intergenic
1116739490 14:48736093-48736115 CAGTCATGGCAGAAGTTGAAGGG + Intergenic
1117964908 14:61197051-61197073 CATGAAAGTCAGAAGTGAGACGG - Intronic
1118652742 14:67915071-67915093 CATTACAGGGGGAAGTTAGAGGG + Intronic
1119078108 14:71664836-71664858 CATTACAGGCTGAAGTTATATGG + Intronic
1121384634 14:93509062-93509084 CAATAATGGCAGAAGGTGCAGGG + Intronic
1122085388 14:99297811-99297833 CCTTAAAAGCAGATGTTGGCTGG + Intergenic
1122442262 14:101740193-101740215 CAATCATGGCAGAAGGTGGAGGG + Intergenic
1123163763 14:106306295-106306317 CAGTCAAGGCAGAAGATGAAGGG + Intergenic
1125885828 15:43228800-43228822 TATAAAAGGCTGAAGTTGGCTGG + Intergenic
1126277070 15:46895873-46895895 GATTAAAGGGAGAAGTAGTAGGG + Intergenic
1127590605 15:60418744-60418766 CATTAATGGCAGTGCTTGGAAGG + Intergenic
1128947456 15:71838339-71838361 CATTAAAGAAAAAAGTTGAAAGG - Intronic
1129358031 15:75005547-75005569 CATGAAAGACAGAAATTGGCAGG - Intronic
1129780487 15:78266901-78266923 CTATAAAGGCACAAATTGGAAGG + Intronic
1129784029 15:78296162-78296184 AAATAAGGGCAGAAGCTGGAGGG + Intronic
1131350557 15:91695764-91695786 CAATCACGGCAGAAGTTGAAGGG - Intergenic
1131480131 15:92773580-92773602 CATACAAGGCAGAAGCTGGGTGG - Intronic
1131528747 15:93174093-93174115 CACTCAAGGCAGAAGGTGAAGGG + Intergenic
1131627501 15:94137501-94137523 CAATCATGGCAGAAGTTGAAGGG + Intergenic
1131866392 15:96715828-96715850 CATTAAAGGCAGTAAGTGGTAGG + Intergenic
1132160462 15:99536795-99536817 TATTCAAGGCAGAAATGGGAAGG - Intergenic
1134469004 16:14505403-14505425 AGTTAAAGGCTGAAGCTGGAGGG + Intronic
1136510141 16:30732803-30732825 CCTTAAAGGAAGAACTTGTATGG + Intronic
1136623494 16:31446090-31446112 CAATAATGGCAGAAGGTGAAGGG + Intergenic
1137356617 16:47772321-47772343 CATTTAAGGCAGAGGGTAGAGGG - Intergenic
1137574415 16:49589301-49589323 TATTAAAGACAGCAGATGGATGG - Intronic
1139166244 16:64567672-64567694 CAATCATGGCAGAAGTTGAAGGG - Intergenic
1139384411 16:66555792-66555814 GATGAAAGGCAGTAGTTGTAAGG + Intronic
1139999601 16:71012312-71012334 CATTACATGCAGATGTGGGAGGG + Intronic
1140632615 16:76872273-76872295 CATGAAAGGCAGAACATAGAGGG - Intergenic
1142798874 17:2331570-2331592 CAATCATGGCAGAAGGTGGAGGG - Intronic
1142973369 17:3628194-3628216 CATTTTAAGCAGAAGATGGACGG - Intronic
1145092993 17:20001252-20001274 TAATAAAGGCAGAAGTTAAAGGG - Intergenic
1145959468 17:28879100-28879122 CATCACAGGCAGAAGGTGGAGGG - Intergenic
1146032706 17:29379982-29380004 CATCAAAGCCAGAAGTGGCATGG + Intergenic
1146558588 17:33848682-33848704 CATTCTAGGCAGTAGCTGGATGG + Intronic
1146992723 17:37289797-37289819 CCTTAAGGGGTGAAGTTGGAAGG - Intronic
1147498996 17:40944195-40944217 CTTTAAAGGTAGGAGTGGGAGGG - Intergenic
1148114238 17:45165714-45165736 TATTCCAGGCAGAAGTTGGTAGG - Intronic
1148657880 17:49301883-49301905 CATTTAACACAGAAGTTGAAGGG - Intronic
1149158575 17:53664061-53664083 CACCAAAGGGAGAAATTGGAAGG - Intergenic
1149628667 17:58100505-58100527 CATAAAATGTACAAGTTGGAAGG - Intergenic
1150532479 17:65998848-65998870 AATTTAAGCTAGAAGTTGGACGG + Intronic
1150938119 17:69659661-69659683 CAATAATGGTAGAAGTTGAAGGG + Intergenic
1151085178 17:71372201-71372223 CATTAAAGGCACAGGCTAGAGGG + Intergenic
1152003921 17:77665312-77665334 CAATTATGGCAGAAGGTGGAAGG - Intergenic
1153944562 18:10007795-10007817 AATAAAAGGCAGCAGCTGGAGGG - Intergenic
1154039735 18:10842548-10842570 CACTCATGGCAGAAGTTGAAGGG - Intronic
1155164676 18:23222737-23222759 CATAAAAGGATGGAGTTGGATGG + Intronic
1155668325 18:28337875-28337897 CAATCATGGCAGAAGGTGGAGGG + Intergenic
1155693778 18:28659051-28659073 CATTAATGGTGGAAGATGGAAGG - Intergenic
1155740963 18:29287052-29287074 CATTAAGGTCAGAACTGGGAAGG - Intergenic
1156804824 18:41165255-41165277 CATAAAAGGAGGGAGTTGGAAGG + Intergenic
1156914240 18:42446973-42446995 CAATCATGGCAGAAGTTGAAGGG + Intergenic
1157624062 18:49034333-49034355 CATTAGATTCATAAGTTGGAAGG - Intergenic
1158239602 18:55361684-55361706 CATTACAGGCAGATGTGGGAGGG + Intronic
1159905873 18:74091790-74091812 CATTAAAGGCAGCTGGGGGAAGG - Intronic
1161740917 19:6020713-6020735 CAGGAAAGGCAGCAGCTGGACGG + Intronic
1162262601 19:9545016-9545038 CATGAGGGACAGAAGTTGGAAGG - Intergenic
1164883266 19:31754525-31754547 TACTCAAGGCAGAAGGTGGAGGG + Intergenic
1165164244 19:33840338-33840360 CAGTAAAGGCAGGAGGTGAAAGG + Intergenic
1165222933 19:34332015-34332037 CATTTCAGTCAGAGGTTGGAAGG + Intronic
1168411734 19:56144439-56144461 CATCACAGGAAGCAGTTGGAGGG + Intronic
1168580107 19:57548170-57548192 CATTAAAGGGAAAATCTGGAGGG + Intronic
925234902 2:2269537-2269559 AATGCAAGGCAGAAGTAGGATGG - Intronic
925321338 2:2971777-2971799 CATTCCAGGAAGAAATTGGAGGG - Intergenic
925669051 2:6292137-6292159 CAATAATGGCAGAAGGTGAAAGG - Intergenic
927214281 2:20658174-20658196 CAATCATGGCAGAAGTTGAAAGG + Intergenic
928220703 2:29400676-29400698 CAATAAAAGCAGATGTTGGCTGG + Intronic
928811342 2:35231064-35231086 CATTCATGGCAGAAGGTGAAGGG - Intergenic
929070943 2:38029881-38029903 CAATCACGGCAGAAGGTGGAAGG + Intronic
929295933 2:40246674-40246696 CATTAATTCCAGAAGATGGATGG + Intronic
929343108 2:40847247-40847269 AATTAAAAGCTGAAGTTGGCCGG + Intergenic
929868232 2:45736348-45736370 CATGATAGGCGGGAGTTGGAAGG + Intronic
930203600 2:48566887-48566909 CGTTACAGGCTGAAGTTGAAAGG + Intronic
930853915 2:55991959-55991981 AATTCAAGGCTGAAGTTTGAGGG - Intergenic
932252589 2:70257899-70257921 CATCGAAGGCAGAAGCTGGCCGG - Intronic
932882181 2:75513029-75513051 CAAAAAAGGCAGAAAATGGAAGG - Intronic
933031356 2:77333106-77333128 CAATAATGGCAGAAGGTGAAAGG - Intronic
933376411 2:81485048-81485070 CCTTAAAGGCAGAATTTAGTTGG + Intergenic
934601945 2:95664336-95664358 CTATAAAAGCAGAAGTCGGATGG + Intergenic
935286552 2:101568906-101568928 CATAAAAGGCAGAATTTGGGGGG - Intergenic
935481326 2:103593870-103593892 CAATAATGGCAGAAGGTGAAAGG - Intergenic
936271581 2:111053404-111053426 CATTAAAAATAGAACTTGGATGG + Intronic
936595418 2:113842587-113842609 CATTAATGGAAATAGTTGGAAGG + Intergenic
936680910 2:114770162-114770184 CCCTAAAGGCAGCAGTTGTATGG + Intronic
937511743 2:122603261-122603283 TAATAAAGGCTAAAGTTGGATGG + Intergenic
937828115 2:126389674-126389696 CAGTTATGGCAGAAGTTGAAAGG - Intergenic
938975955 2:136479369-136479391 CAGTAGTGGCAGAAGTTGGGTGG + Intergenic
939025406 2:137007444-137007466 AAATAAAGGCAGAAGCTGTATGG + Intronic
939506276 2:143051702-143051724 CAATCAGGGCAGAAGTTGAAAGG - Exonic
939614738 2:144349743-144349765 CATTAAAGGGAGAAGTCTGGGGG + Intergenic
940015032 2:149095316-149095338 AAATAAAGGCAAAAGTTGGAAGG + Intronic
940283541 2:152011283-152011305 CCTCAAAGGAAGAAGGTGGAGGG - Intronic
941963720 2:171279727-171279749 CATTAAAAGAAAAAGTTGAATGG + Intergenic
942218922 2:173750326-173750348 GATTAAAGGCAGAAAGAGGAAGG - Intergenic
942482531 2:176404570-176404592 CAATAATGGCAGAAGGTGAAAGG + Intergenic
942970198 2:181949429-181949451 CATTCATGGCAGAAGGTGAATGG + Intergenic
943107204 2:183560427-183560449 CAATAATGGCAGAAGGTGAAAGG + Intergenic
943698828 2:190967002-190967024 CATTAAAGGCAGAGACTGGGGGG + Intronic
943971844 2:194419794-194419816 CATCAAGGGCAGAAGTAGGAAGG + Intergenic
944013196 2:194999579-194999601 AATTAAAGCCAGAAGATAGAAGG - Intergenic
944158261 2:196632221-196632243 CAATCATGGCAGAAGTTGAAGGG + Intergenic
944164275 2:196701846-196701868 TATTAATGGTAGAATTTGGATGG + Intronic
944186717 2:196956874-196956896 AAGTAAAGAAAGAAGTTGGAAGG + Intergenic
945555010 2:211265844-211265866 CATGAGGGACAGAAGTTGGAAGG - Intergenic
946220333 2:218220152-218220174 CATTAAAGGGAGTAGTTTGGAGG + Intronic
946503604 2:220275901-220275923 CAATAATGGCAGAAGGTGAACGG + Intergenic
946945290 2:224815235-224815257 CAATCAAGGCAGAAGGTGAAGGG - Intronic
947888417 2:233594666-233594688 GATAACAGGCAGAGGTTGGAAGG + Intergenic
948704752 2:239781972-239781994 AGATAAAGGCAGAAGTTAGAGGG + Intronic
948710854 2:239824689-239824711 CAATCATGGCAGAAGGTGGAAGG - Intergenic
948730744 2:239962242-239962264 TCTTAAGGGCAGAATTTGGAAGG - Intronic
1169567326 20:6869274-6869296 CCGAAAGGGCAGAAGTTGGAGGG + Intergenic
1170193435 20:13666532-13666554 CAGTGAAGGCAGTACTTGGAGGG - Intergenic
1170409531 20:16073736-16073758 CATTCAAGGCAGATGTAGAATGG + Intergenic
1171447921 20:25217746-25217768 CATTAAAGGATGAAGGAGGAGGG - Intronic
1172833214 20:37854662-37854684 CCTTGGAGGCAGAAGTTGCAGGG - Intronic
1173414791 20:42845965-42845987 TATTAAAGACAGAACTTGCAGGG + Intronic
1174713969 20:52737029-52737051 CAAGAAAGGGAGAAGCTGGAGGG + Intergenic
1175531922 20:59679698-59679720 CAATAATGGCAGAAGGTGAAAGG + Intronic
1175563522 20:59953859-59953881 CATGGCAGGCAGAAGCTGGAAGG - Intergenic
1176968162 21:15235191-15235213 CAATCATGGCAGAAGTTGAAGGG - Intergenic
1177408470 21:20699977-20699999 CAATAATGGCAGAAGGTGAAAGG - Intergenic
1178153980 21:29830444-29830466 AATTAAAGGAAGAAGTGGAATGG - Intronic
1178178440 21:30132032-30132054 CAATAATGGCAGAAGGTGAAGGG + Intergenic
1178960336 21:37059235-37059257 CATTCACGGCAGAAGGTGAAGGG + Intronic
1179266549 21:39808405-39808427 CAATAATGGCAGAAGGTGAAGGG - Intergenic
1180677355 22:17596482-17596504 CACTCATGGCAGAAGGTGGAAGG - Intronic
1181881233 22:25981998-25982020 CAATCATGGCAGAAGTTGAAGGG + Intronic
1181987894 22:26813902-26813924 CAATAATGGCAGAAGGTGAAGGG - Intergenic
1182536878 22:31010427-31010449 CAATCATGGCAGAAGGTGGAGGG - Intergenic
1183031518 22:35110027-35110049 CATTAAAGGCGGGAATGGGAAGG + Intergenic
1183056127 22:35307162-35307184 CATGAAAGACAGAAGTTTGGAGG - Intronic
1183122848 22:35743996-35744018 AATTAAAGGCAGAAATTTAAAGG + Intronic
1183999367 22:41661156-41661178 CAGTAAATGCAGGTGTTGGAAGG + Intronic
1184307563 22:43616769-43616791 CAGTAAAGGCTGAGGCTGGAGGG + Intronic
1184914069 22:47555555-47555577 CAATCATGGCAGAAGGTGGAGGG + Intergenic
949924570 3:9031163-9031185 CACAAAAGGCAGAAAGTGGAAGG - Intronic
950987015 3:17384134-17384156 CACTAAAGGCATAAGTTACATGG - Intronic
951117943 3:18887165-18887187 CAGTCAAAGCAGAAGTTGGGGGG - Intergenic
951246683 3:20349575-20349597 CAATACATGCAGAAGCTGGATGG + Intergenic
952273036 3:31851380-31851402 CATCAAAGGTAGATGATGGAGGG - Intronic
952966083 3:38622207-38622229 AATTAATGCCAGAAGTTGGCAGG + Intronic
953656188 3:44856617-44856639 CATGAGGGACAGAAGTTGGAAGG + Intronic
953853248 3:46481673-46481695 CCTGAAAGGCAGAGGTTGCAGGG + Intronic
954534681 3:51350686-51350708 CACTGGAGGCAGAAGTTGGAAGG - Intronic
955544920 3:60018132-60018154 CATTCATGGCAGAAGTGGAAGGG + Intronic
956247795 3:67203644-67203666 CAATCATGGCAGAAGTTGAAGGG - Intergenic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956490571 3:69767299-69767321 CTTTAAAGACAAAAGATGGAGGG + Intronic
956675631 3:71729403-71729425 CAATAAAGGCAGAACATGGGAGG + Intronic
957444140 3:80292866-80292888 CAATCATGGCAGAAGTTGAAGGG + Intergenic
957541265 3:81572177-81572199 CAGTCAAGGCAGAAGGTGAAGGG - Intronic
957940927 3:87002521-87002543 CTTAAAAGTCAGGAGTTGGATGG + Intergenic
958514745 3:95099927-95099949 CATAAAAGGCAGAGGTTGCAGGG - Intergenic
959576226 3:107937293-107937315 CATTAAAGATAGAATTAGGAAGG - Intergenic
960392163 3:117090722-117090744 CATTAAAGTGGGAAGGTGGAAGG + Intronic
960509050 3:118526109-118526131 CAGGAAAGGCATCAGTTGGAAGG + Intergenic
961006374 3:123408359-123408381 TTTTAAAGGCAGACGTTGGCCGG + Intronic
962070791 3:132032320-132032342 CAGGAAAGGCATAAGTTTGATGG + Intronic
963402405 3:144816591-144816613 CATTGAATGCAGAATTTAGAGGG + Intergenic
964258441 3:154805993-154806015 CAATAATGGCAGAAGATGAAAGG + Intergenic
964291170 3:155182386-155182408 CATTAAAGGCTCAAGTAAGATGG - Exonic
964413515 3:156423927-156423949 CATTAGAGACAGTGGTTGGAAGG + Intronic
964690974 3:159449330-159449352 CAATAAATGCAGAAGAGGGAAGG + Intronic
965218193 3:165892351-165892373 CATTTATGGCAGAAGGTGAATGG + Intergenic
965566756 3:170127461-170127483 TATTAAAAGCAGAACTTGGCTGG - Intronic
966057371 3:175711434-175711456 AATTAATGGAAGAAGTTTGAGGG + Intronic
966155341 3:176910265-176910287 CACTCAAGGCAGAAGTGGCAAGG - Intergenic
966729035 3:183135139-183135161 AACTCAAGGCAGAAGTTAGAGGG + Intronic
967484105 3:190010017-190010039 CATTAAAGCTGGAAGTTGGAAGG - Intronic
967695863 3:192529691-192529713 CAATCAAGGCAGAAGGTGAAAGG + Intronic
968022922 3:195410890-195410912 CCTCAATGGCAGAAGGTGGAAGG - Intronic
969905757 4:10394241-10394263 CCTTGAAGACAGAAGTTGGATGG + Intergenic
970141002 4:12981942-12981964 CACTGATGGCAGAAGTTGAAGGG - Intergenic
970816893 4:20167382-20167404 AATAAAAGACAGAAGATGGATGG + Intergenic
971632924 4:29018183-29018205 CAATAATGGCAGAAGGTGAAGGG - Intergenic
972227972 4:37036239-37036261 CAATAATGGCAGAAGGTGAAAGG + Intergenic
974121966 4:57649663-57649685 CATTCATGGCAGGAGGTGGAAGG + Intergenic
974883607 4:67788866-67788888 TTTGAAAGGCTGAAGTTGGAGGG - Intergenic
975078543 4:70245349-70245371 TATTAAAGGCAGAAGTATCAAGG - Intronic
975351323 4:73350614-73350636 CATTCATGGCAGAAGGTGAAGGG + Intergenic
977327793 4:95598271-95598293 CATGAAAGGCAGAAATTGTCAGG - Intergenic
977514445 4:98003232-98003254 TTTTACAGGCAGAAGCTGGAAGG + Intronic
977772642 4:100878123-100878145 CATTCATGGCAGAAGGTGAAGGG + Intronic
978408496 4:108404784-108404806 CAATAATGGCAGAAGGTGAAGGG + Intergenic
978417120 4:108488340-108488362 CAATCATGGCAGAAGGTGGAAGG + Intergenic
978623113 4:110654442-110654464 CATAAGATGCTGAAGTTGGAAGG + Intergenic
978688451 4:111478479-111478501 CAATCATGGCAGAAGTTGAAGGG + Intergenic
978702232 4:111661540-111661562 CATTGAAGAGAGAAGTTGAAGGG + Intergenic
978774216 4:112489863-112489885 CAATCATGGCAGAAGTTGAAAGG + Intergenic
979962645 4:127038744-127038766 TATTAAAGACAGCAGTTGAATGG - Intergenic
980872904 4:138630516-138630538 CTTAAAAGGCAGGAGTGGGAAGG + Intergenic
980960301 4:139468148-139468170 CAATCAAGGCAGAAGGTGAAAGG + Intronic
982417931 4:155158357-155158379 CAGTGATGGCAGAAGTTGAAAGG - Intergenic
984042862 4:174758070-174758092 CACTCATGGCAGAAGTAGGAAGG - Intronic
985191052 4:187373351-187373373 CAATCATGGCAGAAGTTGAAAGG + Intergenic
985869917 5:2546037-2546059 CAATCATGGCAGAAGTTGAAGGG + Intergenic
986074603 5:4322577-4322599 TCTTAGAGGAAGAAGTTGGAAGG - Intergenic
986557573 5:9026722-9026744 AGTAAAAGGCAGAGGTTGGAAGG + Intergenic
986884296 5:12215067-12215089 CAATCAAGCCAGAAGTTGGGTGG - Intergenic
987764166 5:22203664-22203686 CATTATAGGCAAGAGTAGGAAGG - Intronic
988042057 5:25902180-25902202 AATTAGAGGCAGATGTTGAAGGG + Intergenic
988107262 5:26768149-26768171 CAATTATGGCAGAAGTTGAAGGG - Intergenic
988519371 5:31931936-31931958 CATTAATGGCAGAAGTTGGAAGG + Intronic
989375098 5:40752977-40752999 CCGTAATGGCAGAATTTGGAGGG + Intronic
989763517 5:45050068-45050090 CAATCATGGCAGAAGCTGGAGGG + Intergenic
990041231 5:51381061-51381083 CATTAAAAGGAGACGTTTGAGGG - Intergenic
990327719 5:54694609-54694631 CATTCCAGGCAGAAGGAGGAGGG + Intergenic
991075974 5:62538576-62538598 CAATCAAGGCAGAAGGTGAAAGG - Intronic
991312543 5:65260064-65260086 CATTAAAGTAAGAAGGTGAAAGG + Intronic
991605994 5:68401723-68401745 CAATCAAGGCAGAAGGTGAAGGG + Intergenic
991684409 5:69168116-69168138 CATCAAAGGCCACAGTTGGAAGG - Intronic
991898897 5:71436748-71436770 CATTATAGGCAAGAGTAGGAAGG - Intergenic
992279288 5:75157186-75157208 CATTAAAGGCATTATTTGCAAGG + Intronic
992902986 5:81317587-81317609 CAATCATGGCAGAAGTTGAATGG + Intergenic
993594548 5:89836068-89836090 CAATCAAGGCAGAAGGTGAAGGG - Intergenic
993945795 5:94115872-94115894 CAATCATGGCAGAAGTTGAAAGG - Intergenic
994285040 5:97954845-97954867 CAATTATGGCAGAAGTTGAAGGG - Intergenic
995015111 5:107301195-107301217 CAAAAAAGACAGAAGTTGGAGGG + Intergenic
995153922 5:108886850-108886872 CATTAAATGCAGACATTGGTAGG + Intronic
996833357 5:127764372-127764394 AATTAAATGTAGAAGTTGAAGGG + Intergenic
998487552 5:142516331-142516353 CATTCATGGCAGAAGGTGAAGGG - Intergenic
998537559 5:142948669-142948691 CATTAAAAACAGAGGTTAGAAGG + Intronic
999274207 5:150318229-150318251 CAATAATGGCAGAAGATGAAGGG + Intronic
999300719 5:150488563-150488585 CATTGAATGGAGGAGTTGGAAGG + Intronic
999822073 5:155238396-155238418 CATTCAAAGCAGAAGTAGGGAGG - Intergenic
1000633596 5:163618167-163618189 CAATAAGGGCAGCAGGTGGAGGG + Intergenic
1001312431 5:170620936-170620958 CAGTAAAGGGAGGAGATGGAAGG - Intronic
1001705514 5:173738499-173738521 CAGTAAAGGGAGGTGTTGGAGGG - Intergenic
1002207525 5:177573841-177573863 CCTTGGAGGCAGAAGTTGCAGGG + Intergenic
1002548173 5:179966487-179966509 ATTTAAAGGGAGATGTTGGAAGG - Intronic
1002677832 5:180933631-180933653 CATTAAAGGCAAAAATGAGAGGG + Intronic
1003953566 6:11141613-11141635 CATTCATGGCAGAAGGTGAAGGG - Intergenic
1004691651 6:17997455-17997477 CATTAAAGTCAGAACTTGTTGGG + Intergenic
1004703631 6:18102510-18102532 CTCAAAAGGCAGAAGTTGCAGGG - Intergenic
1005167720 6:22944250-22944272 CAATCATGGCAGAAGTTGAAGGG + Intergenic
1005256126 6:24005205-24005227 CATTCATGGCAGAAGGTGAAGGG + Intergenic
1007793803 6:44330869-44330891 CAATCATGGCAGAAGGTGGAAGG - Intronic
1007847752 6:44774490-44774512 CAATCAAGGCAGAAGGTGAAGGG - Intergenic
1008029642 6:46680038-46680060 CCTTAAAAGCTGAAGTGGGACGG + Intergenic
1009042566 6:58196981-58197003 CATTAAAGGCAGATTTAAGAGGG + Intergenic
1009052431 6:58292514-58292536 CAGTCATGGCAGAAGGTGGAGGG + Intergenic
1009218404 6:60951209-60951231 CATTAAAGGCAGATTTAAGAGGG + Intergenic
1009238679 6:61158100-61158122 CAGTCATGGCAGAAGGTGGAGGG - Intergenic
1009519483 6:64663657-64663679 CACTAAGGGGAGAAGTTGGCTGG - Intronic
1009581245 6:65536552-65536574 CATTAAAACCAGAAGTTTGAAGG - Intronic
1009971357 6:70628279-70628301 CAATCATGGCAGAAGTTGAAAGG - Intergenic
1010949241 6:82015403-82015425 CATTAAGGGCAGAATTGAGAGGG - Intergenic
1011318425 6:86062945-86062967 CATTTAAGGCAGTATTTAGAGGG - Intergenic
1011334927 6:86249971-86249993 CAGTTATGGCAGAAGGTGGAGGG - Intergenic
1012944458 6:105450827-105450849 AAGTAAAGGCAGAAGTTGCTGGG - Intergenic
1012961276 6:105624638-105624660 CATTATGGGCAAATGTTGGAGGG + Intergenic
1013715952 6:112961804-112961826 CAATCAAGGCAGAAGGTGAAGGG - Intergenic
1014672425 6:124321951-124321973 TATTAAAGTCAGAATTTAGAAGG - Intronic
1014749525 6:125239402-125239424 CAATTATGGCAGAAGGTGGAAGG + Intronic
1014861114 6:126469351-126469373 CAATCATGGCAGAAGATGGAGGG - Intergenic
1015241521 6:131029237-131029259 CACTAAAGGAGGAAGTTGTAAGG - Intronic
1015680265 6:135799657-135799679 CATTAATGGCAGAAGGTGAAGGG - Intergenic
1017219555 6:151950123-151950145 CAATCATGGCAGAAGGTGGAAGG - Intronic
1017571003 6:155744304-155744326 CTTCAAAGGCAGAAGTGTGATGG - Intergenic
1020047590 7:5054026-5054048 CACTCAAGGCAGAAGTTGATTGG + Intronic
1020524023 7:9235334-9235356 CATGAAAGGCAGAAATTCAATGG + Intergenic
1021456765 7:20837931-20837953 AATTAAAAGCAGATGCTGGACGG + Intergenic
1023021331 7:36014382-36014404 CACAAAAGGAAGAAGTTGAATGG - Intergenic
1024323795 7:48093168-48093190 GATTTAAGGCAGCAATTGGAGGG + Intronic
1024325626 7:48107238-48107260 CATTATAGGCAGGACCTGGATGG + Intronic
1024509230 7:50190112-50190134 CAATCATGGCAGAAGGTGGAAGG + Intergenic
1024789671 7:52950046-52950068 CAGTGAAGGCAGAACTTAGAGGG + Intergenic
1025919259 7:65895220-65895242 CATTATAAGCACAAGTTAGATGG + Intronic
1027120972 7:75519712-75519734 CACTCAAGGCAGAAGTTGATTGG - Intergenic
1028195941 7:87908133-87908155 CAGTAAATGTAGAAGTTGAAGGG - Exonic
1028960146 7:96739568-96739590 CATTAATGATAGAAATTGGAGGG + Intergenic
1029202736 7:98849816-98849838 CATCAAAGGTAGAAGTAGGTTGG + Intronic
1029973191 7:104809435-104809457 CCTCAAAGGCAGAACGTGGATGG - Intronic
1030796282 7:113791865-113791887 CATTTAATGGAGAAGTTGGGAGG - Intergenic
1031540537 7:122989667-122989689 CATTTAGGCCAGAAGTAGGAAGG + Intergenic
1031730019 7:125288605-125288627 CAATCAAGGCAGAAGGTGAAGGG - Intergenic
1032528443 7:132598904-132598926 GATTAAAGGCCTAAGTAGGAAGG - Intronic
1032914420 7:136473268-136473290 CAATAATGGCAGAAGGTGAAAGG - Intergenic
1033841289 7:145377480-145377502 CAATGATGGCAGAAGGTGGAGGG + Intergenic
1034212285 7:149374381-149374403 CAATCATGGCAGAAGTTGAAGGG + Intergenic
1034783154 7:153900474-153900496 CACTCATGGCAGAAGGTGGAGGG + Intronic
1037465776 8:19158765-19158787 CCTTAAAGGAAGAAGTGGGCCGG + Intergenic
1037545500 8:19916131-19916153 CAAAAAAAGCAGCAGTTGGAGGG - Intronic
1038622031 8:29153478-29153500 CACTAAGGGAAGAATTTGGAAGG + Intronic
1038922927 8:32105353-32105375 CAATCATGGCAGAAGGTGGAAGG + Intronic
1040055205 8:43051721-43051743 CAGTAATGGCAGAAGCTGAAGGG - Intronic
1040758171 8:50805811-50805833 CATTAAAGGTAAAAGTTGCTAGG + Intergenic
1041984959 8:63910427-63910449 CAATCATGGCAGAAGTTGAAAGG + Intergenic
1042647247 8:71000878-71000900 CACTAAAGGCAGAAATGAGAGGG + Intergenic
1043775260 8:84259310-84259332 CATGGAATACAGAAGTTGGAGGG - Intronic
1044325404 8:90852586-90852608 CTTTACAGGCAGAGGATGGAGGG - Intronic
1044350925 8:91165725-91165747 CATTAATGGAAGAAGTATGATGG + Intronic
1044688660 8:94854642-94854664 GGTTAAAGGCAGCATTTGGAAGG + Intronic
1045439028 8:102191684-102191706 GATAAGAGGCAGAAGTTGGAAGG - Intergenic
1045744997 8:105408016-105408038 CTTTACAGGCAGAAGTTATAGGG - Intronic
1046300019 8:112275615-112275637 CAATCATGGCAGAAGGTGGAAGG + Intronic
1046457528 8:114486291-114486313 CATTAAAGGCTGAAGTAAAAGGG - Intergenic
1046735302 8:117769708-117769730 CAATCATGGCAGAAGTTGAAGGG - Intergenic
1048526698 8:135209275-135209297 CAGCAAAGTGAGAAGTTGGAGGG + Intergenic
1049653319 8:143786782-143786804 CATACAAGGGAGAACTTGGAGGG + Intergenic
1050585277 9:7104341-7104363 CAGTAAAGGAAGAGGTAGGATGG + Intergenic
1051362358 9:16292452-16292474 AATTCAAGGCAGATTTTGGAGGG + Intergenic
1051425228 9:16925632-16925654 CTTGAAAGGCTGAAGTGGGAGGG + Intergenic
1051556198 9:18385100-18385122 CATTACAAGCAAAATTTGGATGG + Intergenic
1052103779 9:24485572-24485594 CCATAAAGGTAGAAGTTGAAAGG - Intergenic
1055720584 9:79168828-79168850 CATTAAAGGGAAAAGGTGTATGG - Intergenic
1055795256 9:79968705-79968727 CATTAAAGTCTGAGGTTTGAGGG - Intergenic
1055842399 9:80520415-80520437 CAATGAAAGCAGAAATTGGAGGG + Intergenic
1055976406 9:81959440-81959462 CATGAAAGGGTGCAGTTGGAGGG + Intergenic
1056802974 9:89706952-89706974 CATGAAAGGCAGAGCTGGGAGGG + Intergenic
1057357859 9:94346536-94346558 AAGTAAAGTCAGAAGTAGGACGG + Intergenic
1057649890 9:96911073-96911095 AAGTAAAGTCAGAAGTAGGACGG - Intronic
1057747434 9:97763183-97763205 CCTTAGAGGCAGAATGTGGAGGG + Intergenic
1059081830 9:111258082-111258104 CAGTTAAGGCAGGAGGTGGAAGG + Intergenic
1059208880 9:112492509-112492531 CATGAAAGGCAGTAGGTAGAGGG - Intronic
1059882234 9:118704365-118704387 CATTGAAGGCAAATGTTGGAAGG - Intergenic
1060327640 9:122632940-122632962 CAATCATGGCAGAAGTTGAAAGG + Intergenic
1060380296 9:123163969-123163991 CATGGGAGGCAGGAGTTGGAAGG + Intronic
1060542848 9:124442567-124442589 CATTCAAGGCAGAAGGAAGAGGG + Intergenic
1061618547 9:131795864-131795886 CAATCAAGGCAGAAGGTGAAGGG + Intergenic
1186262362 X:7792790-7792812 CATTAAAGGGAGAATTGGCACGG + Intergenic
1186541167 X:10402012-10402034 CAATAATGGCAGAAGGTGAAGGG + Intergenic
1186634404 X:11386939-11386961 AAATAAAGGCAGCAGTTGAAAGG + Intronic
1186719777 X:12290987-12291009 CATTAAAGTCACAAGATGAAGGG - Intronic
1187263676 X:17710782-17710804 CAGTAAAGGCAGAATGTGCATGG + Intronic
1187633156 X:21197275-21197297 CAATCAGGGCAGAAGTTGAAAGG + Intergenic
1188089189 X:25941295-25941317 GATGAAATGCAGAAGGTGGATGG + Intergenic
1188332699 X:28893939-28893961 CATGAGGGACAGAAGTTGGAAGG + Intronic
1188435467 X:30153494-30153516 CATTGGAGACAGAAGTTGGTGGG + Intergenic
1188520502 X:31033050-31033072 CAATAATGGCAGAAGGTGAAAGG + Intergenic
1188825105 X:34821914-34821936 CATTGACAGCAGAAGTTAGAAGG + Intergenic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1191980218 X:66917122-66917144 GATGAAAGGAAGGAGTTGGAGGG - Intergenic
1192056759 X:67781264-67781286 AATTAAAGGCAGAGGTAGGAGGG + Intergenic
1192229446 X:69255064-69255086 GATTAAAGGCAGAGGATGGGTGG + Intergenic
1192409650 X:70922047-70922069 CATTTCAGGCAGTAGCTGGAGGG - Intergenic
1193307611 X:79968051-79968073 CAATAATGGCAGAAGGTGAAGGG + Intergenic
1193470064 X:81889824-81889846 CATTCATGACAGAAGTTGAAGGG - Intergenic
1193667422 X:84338930-84338952 CAATAATGGCAGAAGGTGAAAGG - Intronic
1193886466 X:86988049-86988071 CAGTCATGGCAGAAGGTGGAGGG + Intergenic
1194132164 X:90094790-90094812 CAATAATGGCAGAAGTTAAAGGG - Intergenic
1194172947 X:90611236-90611258 CATTCATGGCAGAAGGTGAAGGG + Intergenic
1194300383 X:92180115-92180137 CAATCATGGCAGAAGTTGAAGGG + Intronic
1194335440 X:92640738-92640760 CAATCATGGCAGAAGTTGAAAGG - Intergenic
1195347634 X:103966348-103966370 CATCCAAGACTGAAGTTGGATGG + Intronic
1195359808 X:104072493-104072515 CATCCAAGACTGAAGTTGGATGG - Intergenic
1195767520 X:108312114-108312136 CATTAAACAAAAAAGTTGGATGG - Intronic
1196168780 X:112564785-112564807 CAATCAAGGCAGAAGGTGAAGGG + Intergenic
1197643037 X:128987098-128987120 CAATCAAGGCAGAAGGTGAAAGG - Intergenic
1197673430 X:129303661-129303683 CAATAATGGCAGAAGGTGAAGGG - Intergenic
1197834437 X:130679383-130679405 CTTTAAAGGAAGAAGTTGAATGG + Intronic
1199067579 X:143438259-143438281 CATTAAAAGCATTTGTTGGATGG - Intergenic
1199137546 X:144270889-144270911 CAGTCATGGCAGAAGGTGGAGGG + Intergenic
1199203076 X:145116189-145116211 CAATCATGGCAGAAGGTGGAAGG + Intergenic
1199363438 X:146949242-146949264 TTTTAAATGCAGAATTTGGAGGG - Intergenic
1200643912 Y:5757772-5757794 CAATCATGGCAGAAGTTGAAAGG - Intergenic
1201218736 Y:11746381-11746403 CATTAAAGGAATAAAATGGAAGG + Intergenic
1201592759 Y:15633703-15633725 AATTCCAGGCAGAAGGTGGAAGG + Intergenic