ID: 920509672

View in Genome Browser
Species Human (GRCh38)
Location 1:206541638-206541660
Sequence GGGGTCTAGGGTAGACTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 100}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920509672_920509678 6 Left 920509672 1:206541638-206541660 CCTTCAAGTCTACCCTAGACCCC 0: 1
1: 0
2: 1
3: 15
4: 100
Right 920509678 1:206541667-206541689 AGTTTAAGCCTCATTTGCTAAGG 0: 1
1: 0
2: 2
3: 14
4: 122
920509672_920509680 23 Left 920509672 1:206541638-206541660 CCTTCAAGTCTACCCTAGACCCC 0: 1
1: 0
2: 1
3: 15
4: 100
Right 920509680 1:206541684-206541706 CTAAGGAACATCATCGCTATTGG 0: 1
1: 0
2: 0
3: 3
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920509672 Original CRISPR GGGGTCTAGGGTAGACTTGA AGG (reversed) Intronic