ID: 920509672

View in Genome Browser
Species Human (GRCh38)
Location 1:206541638-206541660
Sequence GGGGTCTAGGGTAGACTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 100}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920509672_920509678 6 Left 920509672 1:206541638-206541660 CCTTCAAGTCTACCCTAGACCCC 0: 1
1: 0
2: 1
3: 15
4: 100
Right 920509678 1:206541667-206541689 AGTTTAAGCCTCATTTGCTAAGG 0: 1
1: 0
2: 2
3: 14
4: 122
920509672_920509680 23 Left 920509672 1:206541638-206541660 CCTTCAAGTCTACCCTAGACCCC 0: 1
1: 0
2: 1
3: 15
4: 100
Right 920509680 1:206541684-206541706 CTAAGGAACATCATCGCTATTGG 0: 1
1: 0
2: 0
3: 3
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920509672 Original CRISPR GGGGTCTAGGGTAGACTTGA AGG (reversed) Intronic
904563693 1:31414479-31414501 GGGGTGTAGGGGAGAGCTGAGGG + Intronic
920035346 1:203061578-203061600 GGGGCCTAGGGTAGAGCTGATGG + Intronic
920509672 1:206541638-206541660 GGGGTCTAGGGTAGACTTGAAGG - Intronic
921005121 1:211085574-211085596 GGGGTCAAGGGGAGACTTGAGGG + Intronic
922093516 1:222420782-222420804 GGGGTCTTGGGGAGACAGGAAGG - Intergenic
923454825 1:234154792-234154814 GGGCTCTTGGGTAGGCCTGAAGG - Intronic
1068292076 10:55016384-55016406 GGGTTCTAGGGAAGAGTGGATGG - Intronic
1071958132 10:90781100-90781122 GGGATCTAGGGTAGAAATGGGGG - Intronic
1072475776 10:95758492-95758514 GGGGGCTAATCTAGACTTGAAGG - Intronic
1074415586 10:113264333-113264355 GGGGTCTTGTGGAGAGTTGAGGG + Intergenic
1075402198 10:122169028-122169050 GGGGTTTAGGGGAGACTGGTTGG + Intronic
1077240219 11:1506875-1506897 TGGGTTTGGGGTAGACTTGATGG - Intergenic
1079303356 11:19299300-19299322 GGGCTAAAGCGTAGACTTGAAGG - Intergenic
1079374406 11:19879321-19879343 TGGGTATAGGGTAGGCTAGAAGG - Intronic
1084937119 11:72592754-72592776 GGGGTGTAGGGTGAATTTGAGGG + Intronic
1087677371 11:101178625-101178647 GGGGTCAAGGGAAGACTTCATGG + Intergenic
1093765520 12:22957767-22957789 AGGGACTGGGGTAGACTTGAAGG - Intergenic
1095919492 12:47515280-47515302 GGGAACTAGAGAAGACTTGAAGG + Intergenic
1098509558 12:71295722-71295744 GGCTTCTAGGGCAGGCTTGAGGG - Intronic
1100029031 12:90163436-90163458 GGGGACTAGGGAAGACTGGAAGG + Intergenic
1104492474 12:129206936-129206958 GGGGTCTATGGAAGGCTGGAGGG + Intronic
1105627398 13:22126053-22126075 GGTGTCCAGGGAAGAATTGAAGG - Intergenic
1116190145 14:41654507-41654529 GGGTTCTAGGATCGAGTTGAAGG + Intronic
1117771693 14:59140032-59140054 GGGGACTAGGCTGGACTGGAGGG - Intergenic
1119495090 14:75071053-75071075 GGGGCCTTGGGTAGACATTATGG - Exonic
1127178112 15:56382993-56383015 GGGGTCCTAGGTAAACTTGAAGG - Intronic
1133241043 16:4414760-4414782 GGGGTCTGGAGAATACTTGAGGG - Intronic
1136068380 16:27773806-27773828 GGGGGCTAAGGTAGACCAGAAGG - Intronic
1141357183 16:83358224-83358246 GGGGTCTATGTTAGACTTCTAGG + Intronic
1142170041 16:88617025-88617047 GGTGTCCTGGGTAGAGTTGAGGG + Intronic
1145892479 17:28426884-28426906 GGGGTCTAGGGAAGAAGTGCTGG - Intergenic
1146122156 17:30205278-30205300 GATGTCTAGGGGAGACTTGAAGG - Intronic
1148347287 17:46911996-46912018 TTGGCCTAGTGTAGACTTGAGGG - Intergenic
1148724181 17:49776845-49776867 AGGCCCTAGGGGAGACTTGACGG + Intronic
1152299060 17:79484907-79484929 GGGGACCAGGGGAGACTTGAGGG - Intronic
1153409578 18:4778689-4778711 AGGTTCTACGGTAGACTTCAAGG + Intergenic
1153429381 18:4999343-4999365 GGGGTCCTAGGTAAACTTGAAGG + Intergenic
1159221742 18:65473466-65473488 AGGGTGAAGGGTAAACTTGATGG - Intergenic
1159887556 18:73923431-73923453 GAGATTCAGGGTAGACTTGAAGG + Intergenic
1161696424 19:5771151-5771173 GGGATCTAGGGGAGCCTGGAGGG - Intronic
1167006188 19:46777788-46777810 GGGGTCTAGGTTAGATGTGGGGG - Intronic
1167525854 19:49983370-49983392 GGGGTCTGGGGAAGACTTCTTGG - Intronic
928084229 2:28335712-28335734 GGGGACCAGGGGAGACTTGATGG + Intronic
930719793 2:54627971-54627993 GGGGTCCATGGCAGACTAGAGGG + Intronic
932209046 2:69912316-69912338 GGAGTCTAAGCTAGACTTGTTGG + Intronic
937701590 2:124868549-124868571 GGGGTGTAGGGTTGACGTCAAGG - Intronic
939569645 2:143825464-143825486 CTGATCTAGGGTAGACTTGATGG - Intergenic
944345921 2:198665746-198665768 GGGGTTGAGGGTAGATGTGATGG + Intergenic
945992181 2:216405438-216405460 GGAGTCTAGGGAAGAGATGATGG - Intergenic
946744369 2:222831005-222831027 GTGGTCTAGGGAAAACTTAAGGG - Intergenic
948147295 2:235717096-235717118 TGAGTCTAGGGTAGACTTGGGGG - Intronic
1168948537 20:1780981-1781003 GGGGTCTAGTGAAGTGTTGATGG - Intergenic
1172299556 20:33839368-33839390 ATGGTTTAGGGTAGACGTGAGGG + Intronic
1175293570 20:57894180-57894202 GGGGCCTAGGGGAGATGTGAGGG + Intergenic
1178343476 21:31805652-31805674 GGGGTATAGAGAAGACTTCATGG + Intergenic
1180169572 21:46050821-46050843 GGGGTCTGGTGTGGACTAGAGGG + Intergenic
1181042310 22:20197933-20197955 CGGGTCCAGGGTAGAGCTGAGGG + Intergenic
963934919 3:151042671-151042693 TGGGTGTAGGGAAGACCTGAGGG - Intergenic
967863448 3:194170650-194170672 GGGGTCTAAGGTAGCCCTGCTGG - Intergenic
982311429 4:153989042-153989064 GGGGTCAAGGGTGGCATTGAAGG + Intergenic
989078058 5:37586060-37586082 GGGTTGTAAGGTAGATTTGAAGG - Intronic
991651054 5:68854042-68854064 GGGGCCTACTGTAGAGTTGATGG - Intergenic
997998497 5:138605593-138605615 GGTGTGTAGGGTGGACTGGAGGG - Intergenic
1000109309 5:158092822-158092844 GGGGTCTAGGGAACAAGTGAAGG - Intergenic
1000435009 5:161197352-161197374 GGGGTTTAGCTTAGACTTGGCGG - Intergenic
1001721862 5:173863443-173863465 TGGGTTTAACGTAGACTTGAAGG + Intergenic
1003630043 6:7778603-7778625 GAGGCACAGGGTAGACTTGAAGG + Intronic
1004094264 6:12537557-12537579 GGGGGTTAGGGCAGACTCGAGGG - Intergenic
1006139819 6:31921483-31921505 AGGGGCTGGGGTAGACTTCAGGG + Intronic
1006596132 6:35193684-35193706 GGGGTCTAGTGAGCACTTGAAGG - Intergenic
1007978972 6:46130499-46130521 TGGGTCTGGGGTAAAATTGAGGG + Intronic
1009886653 6:69631433-69631455 TGGGCCTAGGGCAGGCTTGAGGG + Intergenic
1010077615 6:71818714-71818736 GGAGTTTAGGGAAGAGTTGAGGG - Intergenic
1011620602 6:89238991-89239013 GTGGTCAAGGGGAGAGTTGATGG - Intergenic
1011620648 6:89239348-89239370 GGGATCAAGGGTGGACTTGGTGG - Intergenic
1012240613 6:96867605-96867627 GGGGACTCAGGTAGACTTTACGG + Intergenic
1017751435 6:157493178-157493200 GTGGTCTAGGGAAGAGCTGATGG + Intronic
1019353294 7:565200-565222 GGGGTCTGGGGCAGCCTTTAGGG + Intronic
1019415859 7:926261-926283 GGGGTCTCGGGTGGATCTGAGGG - Intronic
1020085703 7:5309073-5309095 GCGGTGTAGGGCAGACCTGAGGG - Intronic
1022529189 7:31056634-31056656 CGGATCTAGGGTAGAGGTGATGG - Intronic
1025208609 7:57008091-57008113 GTGGTGTAGGGCAGACCTGAGGG + Intergenic
1025663338 7:63568787-63568809 GCGGTGTAGGGCAGACCTGAGGG - Intergenic
1026551988 7:71376631-71376653 GGGAACTATGGTAGAATTGAGGG + Intronic
1032703086 7:134398979-134399001 ATGGTCAAGGGTAAACTTGAGGG + Intergenic
1033577025 7:142695275-142695297 GGGGTCTAGGGCAGGTTTTAAGG + Intergenic
1034068062 7:148155757-148155779 GGGGTCTAGGGTGGAATGGAGGG + Intronic
1034250619 7:149687713-149687735 AGGATCTTGGGTAAACTTGAGGG - Intergenic
1036634189 8:10537782-10537804 GGGTTCTATGGTAGACTGGCTGG - Intronic
1038333065 8:26624729-26624751 TGGATCTAGGATAGATTTGAGGG + Intronic
1043063906 8:75542335-75542357 GGGGTCTAGGTTCTACTTGAAGG + Intronic
1043777480 8:84287867-84287889 GGAGTCTAGGGCACTCTTGATGG + Intronic
1044514002 8:93117326-93117348 GGGCTCTAAGCTAGATTTGAAGG - Intergenic
1045393664 8:101739229-101739251 GGAGACTGGGGTAGACCTGAAGG - Intronic
1046146505 8:110167929-110167951 GGATACTAGGGTAGACGTGATGG + Intergenic
1047204802 8:122794500-122794522 GGGGTCAAGGGTAGAATAGTAGG + Intronic
1048375897 8:133822206-133822228 AGGGTCTGGGGTGGAGTTGATGG + Intergenic
1049845658 8:144799605-144799627 GGGGGTTAGGGTAGCCTTGGCGG + Intronic
1051437586 9:17049270-17049292 GGGGTCTATGTTAGACCTGAAGG + Intergenic
1052890516 9:33695157-33695179 GGGGTCTAGGGCAGGTTTTAAGG + Intergenic
1056572279 9:87826058-87826080 GGATTCTTGGGTAGACTTCAGGG + Intergenic
1056578224 9:87871889-87871911 GGGGCCTGGGATGGACTTGAGGG - Intergenic
1060728580 9:126022545-126022567 TGGGTTTAGTGTAGACTTGTGGG + Intergenic
1061608449 9:131729607-131729629 GGGGTCTAGGGCTGACTTGCCGG - Intronic
1062335134 9:136061618-136061640 GGGGGCTGGGGTAGACCTGCTGG - Intronic
1062536090 9:137021741-137021763 GGGGTCTATGGCAGGCATGAGGG - Intronic
1185716246 X:2345017-2345039 AGGGTATAGGGTAGACTGCAGGG - Intronic
1186469039 X:9807050-9807072 GGGGTCTAGGGAAGGCCTGCCGG + Intronic
1186823037 X:13311199-13311221 GGGGTCTAGTAAAGACATGATGG + Intergenic
1189540592 X:41983680-41983702 GGAGTCTAGGGAAGAGTTGATGG + Intergenic
1189701279 X:43717707-43717729 GGGGTCGAGGGAAGACTGGTAGG + Intronic
1190299949 X:49051315-49051337 GTGGTCTGGGGTACAGTTGAGGG + Intergenic
1192543370 X:71993525-71993547 AGGGTCTGAGGTAGACATGATGG + Intergenic
1195165173 X:102213029-102213051 GGGGTCCCAGGTAAACTTGAAGG - Intergenic
1195193685 X:102474062-102474084 GGGGTCCCAGGTAAACTTGAAGG + Intergenic
1196983258 X:121239009-121239031 GGGGTGCAGGGAAGAGTTGAGGG + Intergenic
1199904003 X:152206393-152206415 GGGGTCCAGTGGAGACGTGAGGG + Intronic