ID: 920510402

View in Genome Browser
Species Human (GRCh38)
Location 1:206547315-206547337
Sequence CTGTAAATACAGATGAAGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 10, 2: 18, 3: 16, 4: 112}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920510402_920510403 -10 Left 920510402 1:206547315-206547337 CCACGCTTCATCTGTATTTACAG 0: 1
1: 10
2: 18
3: 16
4: 112
Right 920510403 1:206547328-206547350 GTATTTACAGCCACTCCCCATGG 0: 21
1: 21
2: 64
3: 49
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920510402 Original CRISPR CTGTAAATACAGATGAAGCG TGG (reversed) Intronic
900587284 1:3439467-3439489 CTGTAAACACAGAGGAAGCTGGG + Intergenic
901585014 1:10282903-10282925 CTGTTAATAAAGATGAAGTTTGG + Intronic
903510831 1:23873873-23873895 CTGGAAATACAGAGGAGGCTGGG - Exonic
905246933 1:36621573-36621595 CTGTGAATACAGATGAGGCTTGG + Intergenic
905378118 1:37538872-37538894 CTGAAAATATAGATGAAGTTTGG - Intronic
909375910 1:74941725-74941747 CTGTAAATACAGAATTAGCCGGG + Intergenic
911324728 1:96456772-96456794 CTGAAAACACTGATGAAGCCTGG - Intergenic
911436983 1:97872981-97873003 CTGAAAATAAAGATGAAGGAGGG - Intronic
911615752 1:100008985-100009007 CTGTAAGTACAGATGACTCCTGG + Intronic
916763839 1:167841373-167841395 ATGTAAAGACAGAGGAAGTGAGG - Intronic
916874804 1:168958018-168958040 CAGTAAATACAAATGAAGCTTGG + Intergenic
918484531 1:185015301-185015323 CTGGAAATACAGATGCAGATTGG - Intergenic
920510402 1:206547315-206547337 CTGTAAATACAGATGAAGCGTGG - Intronic
920939871 1:210471967-210471989 CTGTAATTACAGATAATCCGGGG + Intronic
922094715 1:222433502-222433524 CTGTACATACAGGTTAAGGGTGG - Intergenic
924535161 1:244929254-244929276 CTCTAAATACAGATCAGGCCAGG - Intergenic
1063506157 10:6601597-6601619 CTGTGAACACAGATGAAGTTTGG + Intergenic
1064969328 10:21048341-21048363 ATGTAAATACAGATGCAGTCTGG + Intronic
1066533770 10:36367987-36368009 CTGGAAATAAAGATGAAGAAGGG + Intergenic
1067467028 10:46508762-46508784 CTGTAAATGCTGATGAGGCTGGG + Intergenic
1067620158 10:47875843-47875865 CTGTAAATGCTGATGAGGCTGGG - Intergenic
1070012238 10:72487435-72487457 CTGTAACCACAGATGAAACATGG + Intronic
1072017304 10:91360969-91360991 TTCTAGATACAGATGAATCGGGG + Intergenic
1074051715 10:109886732-109886754 CTGTAAATACTGATGCAACAGGG + Intronic
1076206197 10:128605964-128605986 CTGTATACACACATGAAGCGAGG - Intergenic
1076815621 10:132913388-132913410 CTGTAAATGCAGATGGAGTTTGG - Intronic
1077440664 11:2567268-2567290 CTGCAAATACAGATGAACCCAGG + Intronic
1080589286 11:33707571-33707593 CTGTAAATCCAGATGAGTGGAGG + Intronic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1086096548 11:83055656-83055678 CTCTAAATACAGATGCATTGGGG - Intronic
1090367194 11:126216464-126216486 CTGTAAAGACAGAGGAAAAGAGG - Intronic
1092480905 12:8858284-8858306 ATGAGAATACAGATGAAGCCTGG + Intronic
1094242895 12:28249212-28249234 CTGTGAATCCAGTTGAAGAGGGG + Intronic
1099043570 12:77686741-77686763 CTGTAAAGTCAGATGAACCTAGG - Intergenic
1101851842 12:108409571-108409593 CTGTTAATACTGATGAAAAGGGG - Intergenic
1102866768 12:116381142-116381164 CTGTAAATCAAGACGAAGAGCGG + Intergenic
1103430572 12:120881746-120881768 CGCTAAATATAGATGAAGCTCGG + Intronic
1110337258 13:74346748-74346770 CTGGAAAGACAGCTGAAGCCAGG + Intergenic
1112683558 13:101795918-101795940 CTGAAAATACAGCTGAATTGAGG + Intronic
1112779191 13:102879479-102879501 ATGTATACACAGATGAATCGAGG - Intergenic
1113247220 13:108411092-108411114 CTGTAAATACAGATGACCCTTGG + Intergenic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1114879115 14:26761784-26761806 CTGCAAATACAGACTAAGCTTGG - Intergenic
1117630951 14:57690884-57690906 CTCTAAATACAGATGAAGCTTGG + Intronic
1118571826 14:67201715-67201737 CTGTTAATCCAGAAGAAGAGGGG + Intronic
1122810543 14:104285550-104285572 CTGTCATTGCAGATGAAGCCTGG - Intergenic
1125135183 15:36333047-36333069 CTGTAAATATAGATGAAACTTGG - Intergenic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1130263050 15:82374643-82374665 CTGTAAATAAAAATGTAGAGTGG - Intergenic
1130829375 15:87583967-87583989 CTGTGAATACGGAAGAAGCAAGG + Intergenic
1133214236 16:4281651-4281673 CTGTAGATACAGATGAAGCTTGG + Intergenic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1140567592 16:76062283-76062305 CCGTAAATACAGTTCAAGAGGGG + Intergenic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1144017416 17:11209145-11209167 CTGTAAAAACACATCAATCGGGG - Intergenic
1144939937 17:18931929-18931951 CTCTAAAGACAGATGAGGCCGGG - Intergenic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1150121653 17:62608465-62608487 CCCTGAATACAGATGAAGCTGGG - Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1151404688 17:73878696-73878718 GGGTAAATACAGAGGAAGCAAGG + Intergenic
1151416741 17:73971243-73971265 CTGTAAATACCCATGAATCTGGG - Intergenic
1152197970 17:78928628-78928650 CTGCAAAGTCAGATGAAGAGGGG + Intergenic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1156648533 18:39197154-39197176 CTATAAGCACAGATGAAGCTTGG + Intergenic
1162456131 19:10786135-10786157 CTGTAGATGCAGATGCAGCCGGG + Intronic
1162913095 19:13860542-13860564 CTGGAATTACAGATGGAGCCCGG - Intergenic
1163098409 19:15078143-15078165 CAGTAAAGACAGAAGTAGCGGGG - Intergenic
1163745159 19:19042506-19042528 CTGCAAATACAGAAGAGGCCGGG - Intronic
1165709888 19:38003586-38003608 CTGTAAATACAGACGTGGCAGGG + Intronic
1166230752 19:41424827-41424849 CTGTAACAACAGGTGAAGAGGGG - Exonic
1167418907 19:49391255-49391277 CTGTGAAGAGAAATGAAGCGGGG - Intronic
1168223019 19:54974744-54974766 CTATAAATACATACAAAGCGGGG + Intronic
926130238 2:10298399-10298421 CTGTAATTACAAATGAAACTGGG + Intergenic
930813578 2:55568892-55568914 CTGAAAATACAGCTAAAGTGTGG + Intronic
933227851 2:79771719-79771741 AAATAAATACAGATGAAGCTTGG + Intronic
939306319 2:140416092-140416114 TTGTGAATACAGATGAAGCTTGG - Intronic
942384838 2:175431740-175431762 CTTGAAAAACAGATGAAGAGTGG + Intergenic
943325458 2:186492121-186492143 CTGTAGTTACAGATGGAGCATGG + Intronic
946132956 2:217621877-217621899 CTGTAAATGCAGTGGAAGCTGGG + Intronic
948594717 2:239072559-239072581 CTGAAAATCCATATGAAGGGAGG - Intronic
1169875398 20:10291786-10291808 ATGAAAATACAGATGAAAAGAGG + Intronic
1173447339 20:43130961-43130983 ATCTAAATACAAATGAAGCCAGG + Intronic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175338537 20:58212623-58212645 CTGTACATACAGATCAAGTCAGG + Intergenic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1184643447 22:45884037-45884059 CTGTAATTTCAGATGTAGCTGGG + Intergenic
956148861 3:66220719-66220741 CTGTAAACCCAGAAGAGGCGTGG - Intronic
959409428 3:106001819-106001841 CTGTTAATACAGATCAAGTAGGG - Intergenic
961438797 3:126938350-126938372 CTGAGAAGACAGATGAAGAGCGG - Intronic
964645468 3:158954245-158954267 CTGTCACTACTTATGAAGCGAGG - Intergenic
971837391 4:31786161-31786183 CTGTAAATACAGATAAAGCTTGG - Intergenic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
977461879 4:97336434-97336456 CTGTAAATTCAGATTAATTGAGG + Intronic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
981182651 4:141763963-141763985 CTGTAAATACACATGAAGCTGGG + Intergenic
981980094 4:150781474-150781496 CTATAAATACAGATGAAGCTTGG + Intronic
984417930 4:179484223-179484245 CTGTAAATTAAGATGATGTGGGG + Intergenic
984601577 4:181733067-181733089 CTGAAAATGCAGATGAAGGTTGG + Intergenic
988150260 5:27368270-27368292 CTGTAAATACGGAGGGAGCTTGG + Intergenic
989153354 5:38321345-38321367 CTGTAAATACAGACGAAGCTTGG + Intronic
991202263 5:64008296-64008318 CTGTAAACACTGAGGAAGCATGG - Intergenic
991444276 5:66682864-66682886 ATTAAAATCCAGATGAAGCGGGG - Intronic
993292745 5:86096012-86096034 GTGTAAAAACAGGTGAAGGGTGG + Intergenic
993613599 5:90084100-90084122 CTGAAAATCCAGATGACGGGAGG + Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
995405698 5:111793100-111793122 CTGTAAATTCAAATGAAACATGG + Intronic
996673425 5:126147258-126147280 CAGTAAATACTGATGAAGGAAGG + Intergenic
998520327 5:142794361-142794383 CTATAAATACAGAAGGAGGGGGG + Intronic
998832127 5:146170981-146171003 TTGTAACTACAGGTGAAGGGTGG + Intronic
1002291975 5:178206168-178206190 ATGAAAATACAGATTAAGCTGGG + Intronic
1003110910 6:3251490-3251512 CTGCAATTGCAGATGAAGCACGG - Intronic
1003946711 6:11082815-11082837 CTGAAAATACACCTGAAGCCTGG - Intergenic
1004327268 6:14686698-14686720 CTGTAAAAACAGATGAAGCCTGG + Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1007899641 6:45399169-45399191 GTAGAAATACAGATGAAGAGAGG - Intronic
1012472528 6:99588347-99588369 CTGTAAAGACTGAAGAACCGTGG + Intergenic
1016841397 6:148529110-148529132 CTGTGAAAACAGATGAAGCTTGG + Intronic
1016940900 6:149482222-149482244 TTCTAAATACGGAAGAAGCGGGG + Intronic
1017530156 6:155281896-155281918 CTGAAAAAAAAGATTAAGCGTGG + Intronic
1018968130 6:168504574-168504596 CTGTAAATACAGATGAATACAGG + Intronic
1020184334 7:5947411-5947433 CTGTAAAAACAGATGAAGGTAGG + Intronic
1020298583 7:6777355-6777377 CTGTAAAAACAGATGAAGGTAGG - Intronic
1022513808 7:30962872-30962894 CCCTAAATCCAGATGTAGCGGGG + Intronic
1025851314 7:65246956-65246978 CTGTAAAAGTAGATGAAGAGGGG + Intergenic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1026363760 7:69627131-69627153 ATGTAAATACAGAGGAGGCAAGG + Intronic
1028363909 7:90005006-90005028 CTGTAGAGACAGATAAAGCGTGG + Intergenic
1029047641 7:97646575-97646597 CTGTAAATACAGATGATACTTGG + Intergenic
1030025447 7:105319699-105319721 CTGTAAATACAGCTGAGTCCTGG + Intronic
1030563582 7:111122431-111122453 CTGCAAATACTGAAGAAGCATGG + Exonic
1031351875 7:120742858-120742880 CAGTTAATGCAGATGAAGAGTGG + Intronic
1031376486 7:121032950-121032972 CTTTAGATACAGAGGAAGCTGGG - Intronic
1032625078 7:133583158-133583180 ATGTAAATAAAGAAGAAGAGAGG - Intronic
1034288768 7:149910504-149910526 CTGGAAATAAAGTTGAAACGCGG + Intergenic
1034662309 7:152782362-152782384 CTGGAAATAAAGTTGAAACGCGG - Intronic
1035957251 8:4094658-4094680 CTGTAAATGCATCTGAAGTGCGG - Intronic
1037096169 8:14990397-14990419 CTGAAAGTACAGATGCAGCTTGG - Intronic
1038657330 8:29465761-29465783 CTGTAAATATAGATGAAGCTTGG - Intergenic
1038863630 8:31414846-31414868 CTGTAAATACAGATGATGCTTGG + Intergenic
1044151106 8:88775571-88775593 CTGTAGATACAGATTAAGGGTGG - Intergenic
1046639421 8:116710364-116710386 CTGAAAATACAGATCAAGCTGGG - Intronic
1050980266 9:12002533-12002555 CTGAAAATACAGAAGAATAGTGG + Intergenic
1051045723 9:12871139-12871161 CTGAAAATACAGAAGTAGCTTGG + Intergenic
1052570910 9:30222310-30222332 CTGTAAATATTTATGAAGTGTGG - Intergenic
1057466746 9:95321148-95321170 CTGTAAATGGAGTTGAAGCCAGG - Intergenic
1059656386 9:116361408-116361430 CTGGTAACACAGATAAAGCGTGG - Intronic
1185933727 X:4232239-4232261 CTGTACATAAAGATGAAGAATGG - Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1192796357 X:74426867-74426889 CTTTAAATACAAATGACGTGGGG - Intronic
1194560082 X:95409640-95409662 ATGTAAAGAGAGATGAAGCATGG - Intergenic
1194806546 X:98335811-98335833 CTGTAACTACAGATGAGACCAGG - Intergenic
1196253557 X:113489466-113489488 CTGGAAATACAAATGAAGGAAGG + Intergenic
1200752070 Y:6955302-6955324 GTGTAAATCCAGATGAACTGTGG - Intronic
1201577511 Y:15477023-15477045 CTGTGAATACAGATGAAGCTTGG + Intergenic