ID: 920510525

View in Genome Browser
Species Human (GRCh38)
Location 1:206548452-206548474
Sequence GATGCTCATTACCATGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 0, 2: 1, 3: 46, 4: 370}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920510520_920510525 5 Left 920510520 1:206548424-206548446 CCAGCTCTCACATGAAGGAACAA 0: 1
1: 0
2: 3
3: 28
4: 249
Right 920510525 1:206548452-206548474 GATGCTCATTACCATGGGGAGGG 0: 1
1: 0
2: 1
3: 46
4: 370
920510518_920510525 16 Left 920510518 1:206548413-206548435 CCTTTGAACAACCAGCTCTCACA 0: 1
1: 8
2: 49
3: 113
4: 340
Right 920510525 1:206548452-206548474 GATGCTCATTACCATGGGGAGGG 0: 1
1: 0
2: 1
3: 46
4: 370
920510517_920510525 23 Left 920510517 1:206548406-206548428 CCAAGCTCCTTTGAACAACCAGC 0: 2
1: 10
2: 86
3: 383
4: 913
Right 920510525 1:206548452-206548474 GATGCTCATTACCATGGGGAGGG 0: 1
1: 0
2: 1
3: 46
4: 370

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920510525 Original CRISPR GATGCTCATTACCATGGGGA GGG Intronic
902161040 1:14530544-14530566 CTCACTCATTACCATGGGGAGGG - Intergenic
902162498 1:14542646-14542668 TATGCTCACTACCAGGGTGACGG - Intergenic
903527390 1:24002107-24002129 CTCACTCATTACCATGGGGATGG + Intergenic
903757517 1:25672871-25672893 GAGGCTCAGTGCCATGGGGCTGG + Intronic
904371530 1:30050531-30050553 GTAACTCATTACAATGGGGATGG + Intergenic
904448724 1:30597398-30597420 GATGCAAATTTGCATGGGGAGGG + Intergenic
905011101 1:34747659-34747681 GATCCTCATTACCTTGTGGAAGG + Intronic
905389762 1:37628911-37628933 GATGCTCATTACCAAAAGCAGGG + Intronic
905622218 1:39458077-39458099 CTCACTCATTACCATGGGGAGGG + Intronic
907601842 1:55779730-55779752 GATGCCCATCAACATGGTGAAGG + Intergenic
907881585 1:58554359-58554381 GGTGGTCCTAACCATGGGGAGGG - Intergenic
908047806 1:60190414-60190436 CTTACTCATTATCATGGGGAGGG - Intergenic
908106078 1:60843630-60843652 TATGCTCATTACCTGGGTGATGG + Intergenic
909810543 1:79927800-79927822 GATGTGCATGTCCATGGGGAGGG - Intergenic
910229918 1:84974918-84974940 GGTGGTGATGACCATGGGGAAGG + Intronic
910532459 1:88253645-88253667 AATGTTCATTACCATGTGAATGG - Intergenic
912717820 1:111994375-111994397 CTCACTCATTACCATGGGGAGGG - Intergenic
913427792 1:118753838-118753860 TATGCTCAGTACCTTGGTGATGG - Intergenic
913513592 1:119584019-119584041 CCTGCTCATTACCATTGGGTGGG - Intergenic
913517214 1:119614937-119614959 CCTGCTCATTACCATTGGGTGGG - Intergenic
913965981 1:143377884-143377906 TATGCTCATTACCTGGGTGACGG - Intergenic
914060355 1:144203492-144203514 TATGCTCATTACCTGGGTGACGG - Intergenic
914118795 1:144762877-144762899 TATGCTCATTACCTGGGTGACGG + Intergenic
915848763 1:159298380-159298402 TGAACTCATTACCATGGGGAAGG - Intronic
915854440 1:159366775-159366797 GATCCTCATTCCCATGGGCTTGG + Intergenic
916580862 1:166106774-166106796 TATGCTCATTACCTGGGTGATGG + Intronic
917806772 1:178620904-178620926 CTCACTCATTACCATGGGGAGGG + Intergenic
917820225 1:178755280-178755302 CATGCTCACTACCAAGGTGATGG - Intronic
919172190 1:193968842-193968864 CATGCTCAATACCAGGGTGATGG + Intergenic
919182652 1:194104801-194104823 GATGCTCCCTCACATGGGGAAGG - Intergenic
919199495 1:194336540-194336562 CTTGCTTATTACCAAGGGGATGG + Intergenic
919242564 1:194934318-194934340 AATGCTCATTACCTGGGTGATGG + Intergenic
920510525 1:206548452-206548474 GATGCTCATTACCATGGGGAGGG + Intronic
920649466 1:207825896-207825918 GCTGCTCACTGCCATGGCGATGG + Intergenic
920982699 1:210853284-210853306 TATGCTCTATACCATGGGCAAGG - Intronic
921828138 1:219697192-219697214 TATGCTCATTAGCATAGGTAAGG - Intronic
923383545 1:233444920-233444942 TATGCTCACTACCTGGGGGATGG + Intergenic
923417073 1:233773372-233773394 AGAACTCATTACCATGGGGAGGG + Intergenic
923514095 1:234680207-234680229 GATGATAATTACTATGGGGTTGG + Intergenic
923851214 1:237797327-237797349 GATGCTAATTAAAATGAGGATGG + Intronic
924446025 1:244132254-244132276 CTCACTCATTACCATGGGGAGGG + Intergenic
924654808 1:245964210-245964232 CCTGCTCATCACCAAGGGGAAGG + Intronic
924732160 1:246722334-246722356 CATACTCATTATCCTGGGGATGG + Intergenic
1063336127 10:5216218-5216240 AACACTCATTACCATGGGGAGGG + Intronic
1063625400 10:7684982-7685004 TATGCTCAGTACCTTGGTGATGG + Intergenic
1063787505 10:9402299-9402321 GATGCCCATTGCCAAGCGGACGG + Intergenic
1064187015 10:13170788-13170810 AATGCTCATTACCTGGGTGATGG - Intronic
1064555872 10:16546546-16546568 TTCGCTCATTACCATGAGGAGGG - Intergenic
1065607722 10:27436656-27436678 GCTGCTCAGTTCCATGGGCATGG + Intergenic
1065826093 10:29573149-29573171 TATGCTCAGTACCAGGGTGATGG - Intronic
1065851831 10:29796882-29796904 GATGCTCCTTACCAAGGGGTTGG - Intergenic
1066012197 10:31205181-31205203 CTAACTCATTACCATGGGGAGGG + Intergenic
1066113648 10:32220249-32220271 TATGCTCATTACCTGGGTGACGG + Intergenic
1066983946 10:42447146-42447168 TTTGCTTCTTACCATGGGGATGG - Intergenic
1067371099 10:45683194-45683216 TGTGCTTATTACCATGGGGATGG + Intergenic
1067388683 10:45842958-45842980 TGTGCTTATTACCATGGGGATGG - Intronic
1067417382 10:46114000-46114022 TTTGCTTATTACCATGGGGATGG + Intergenic
1067445581 10:46341614-46341636 TGTGCTTATTATCATGGGGATGG + Intergenic
1067502797 10:46820883-46820905 TGTGCTTATTACCATGGGGATGG + Intergenic
1067591794 10:47519129-47519151 TTTGCTTATTACCATGGGGATGG - Intronic
1067638909 10:48027203-48027225 TTTGCTTATTACCATGGGGATGG - Intergenic
1067874574 10:49993096-49993118 TGTGCTTATTACCATGGGGATGG + Intronic
1069274803 10:66576421-66576443 TATGCTCACTACCTTGGTGATGG - Intronic
1070135898 10:73693359-73693381 TTTGCTTTTTACCATGGGGATGG - Intronic
1071927546 10:90428044-90428066 AATGCTCATTACAATGGCAATGG + Intergenic
1071989693 10:91089360-91089382 GTCACTTATTACCATGGGGAAGG - Intergenic
1074733995 10:116408962-116408984 CTTACTCATTACCATGGAGATGG + Intergenic
1074776936 10:116773842-116773864 AATGGTCATTATCATGGTGACGG + Intergenic
1075427595 10:122353877-122353899 CTCACTCATTACCATGGGGAGGG - Intergenic
1076120665 10:127934627-127934649 CATGCTCCTTTCCATGGCGAAGG + Intronic
1076925746 10:133484524-133484546 CTTGCTCATTACCATGAAGATGG + Intergenic
1077447656 11:2606417-2606439 TTCGCTCATTACCACGGGGATGG - Intronic
1077811749 11:5644887-5644909 TGTATTCATTACCATGGGGATGG - Intronic
1077817685 11:5703140-5703162 TATGCTCATTACCTGGGTGATGG - Intronic
1079898763 11:26154784-26154806 CTTACTCATTACCATGAGGAGGG + Intergenic
1080546685 11:33326440-33326462 GATCCTCATTACTATTGGGATGG - Intronic
1080835574 11:35937401-35937423 GAGGCTGATGACCATGGGGTAGG - Intergenic
1081526384 11:43930458-43930480 CTCACTCATTACCATGGGGAGGG - Intronic
1082968232 11:58990396-58990418 GATGCTCACTACCAGGCAGATGG - Intronic
1082973365 11:59047662-59047684 TATGCTCACTACCAGGGTGATGG - Intergenic
1082977778 11:59091438-59091460 TATGCTCACTACCAGGGTGATGG - Intergenic
1085809387 11:79666886-79666908 GATGGTAATTACTATGGGGAAGG + Intergenic
1085922653 11:80977440-80977462 TATGCTCATTACCTGGGTGACGG - Intergenic
1086127507 11:83364499-83364521 GATGCCCACTCACATGGGGAGGG - Intergenic
1086283544 11:85219124-85219146 CATGCTCATTACCTGGGTGATGG + Intronic
1086756109 11:90564152-90564174 TATGCTCATTACCTGGGTGATGG + Intergenic
1086894100 11:92292405-92292427 GTTGAACATGACCATGGGGATGG + Intergenic
1087124605 11:94611641-94611663 CTCACTCATTACCATGGGGAGGG - Intronic
1087215593 11:95489802-95489824 TATGCTCACTACCAGGGAGATGG - Intergenic
1087339065 11:96878920-96878942 GATGCTGGCTACCATGGGGGAGG - Intergenic
1087568838 11:99897008-99897030 GATGCTCGCTATGATGGGGAGGG - Intronic
1087879182 11:103394524-103394546 GAGGCTCAATACCAAGAGGAGGG + Intronic
1088488920 11:110368334-110368356 CTTCCTCATTACCATGAGGATGG + Intergenic
1088546630 11:110965969-110965991 CTCACTCATTACCATGGGGAGGG + Intergenic
1088896067 11:114079238-114079260 TATCCTCATTACCATGGACAAGG - Intronic
1088951808 11:114579245-114579267 CTCACTCATTACCATGGGGAGGG + Intronic
1090338962 11:125998358-125998380 CTTGCTTACTACCATGGGGAGGG - Intronic
1090447526 11:126776768-126776790 GCTGCTCTTTCCCATGGGAAGGG + Intronic
1093208984 12:16284892-16284914 TATGCTCACTACCAAGGTGATGG - Intergenic
1093614554 12:21207231-21207253 TATGCTCACTACCTGGGGGATGG - Intronic
1094816185 12:34187190-34187212 TATGCTCACTACCTTGGTGATGG - Intergenic
1095320744 12:40822841-40822863 CATGCTCATTACCTGGGTGATGG - Intronic
1095636058 12:44434966-44434988 GCAACTCATTAGCATGGGGAGGG - Intergenic
1096764129 12:53869108-53869130 TATGCTCATTACCTGGGTGACGG - Intergenic
1097238274 12:57554851-57554873 CTCACTCATTACCATGGGGAAGG + Intronic
1099646335 12:85362006-85362028 TATGCTCATTACCTGGGTGATGG + Intergenic
1099926457 12:89024527-89024549 TATGCTCATTACCAAGATGATGG - Intergenic
1100002558 12:89855123-89855145 CACACTCATTACCAAGGGGATGG + Intergenic
1100986798 12:100209469-100209491 CATGATCATTACCACCGGGAAGG + Intronic
1101725333 12:107383996-107384018 GATGCTCATTACTGGGTGGATGG - Intronic
1102529784 12:113537822-113537844 CTTGCTCATCACCAAGGGGATGG + Intergenic
1104110239 12:125697874-125697896 CAGGCTCATGACCATGAGGAGGG + Intergenic
1106399643 13:29417250-29417272 CAAACTCCTTACCATGGGGAGGG + Intronic
1106492086 13:30235406-30235428 CTTGCTCATTACCATGAGGCTGG + Intronic
1107718610 13:43225313-43225335 TATGCCCATTACCAGGGGGATGG + Intronic
1107762009 13:43689577-43689599 GATTTTCATTACCATGCAGATGG + Intronic
1108445189 13:50501570-50501592 CTCACTCATTACCATGGGGAGGG + Intronic
1108764445 13:53609520-53609542 AATGCTAATTATCTTGGGGAAGG - Intergenic
1109121152 13:58459395-58459417 TATGCTCACTACCTTGGTGATGG + Intergenic
1110637558 13:77783448-77783470 TGTGCTCATTACCAGGGTGATGG + Intergenic
1111440841 13:88281175-88281197 CATACTCATTTCAATGGGGAGGG + Intergenic
1111618606 13:90694425-90694447 GTAACTCATTACCACGGGGAGGG + Intergenic
1111635947 13:90903722-90903744 GTAACTCATTACCATGGGGAGGG - Intergenic
1114053671 14:18945887-18945909 GATGCTCATTACCTTAGTGATGG - Intergenic
1114108885 14:19456038-19456060 GATGCTCATTACCTTAGTGATGG + Intergenic
1114359316 14:21953143-21953165 TATGCTCATTACCTGGGTGATGG - Intergenic
1115877830 14:37880511-37880533 TGAACTCATTACCATGGGGAGGG - Intronic
1116361656 14:44005974-44005996 TATGCTCATTACCAGGGTGATGG - Intergenic
1116586917 14:46717687-46717709 CTCACTCATTACCATGGGGATGG + Intergenic
1116975358 14:51109861-51109883 AGAACTCATTACCATGGGGAGGG + Intergenic
1118307519 14:64667649-64667671 AGGACTCATTACCATGGGGAGGG + Intergenic
1118588941 14:67386008-67386030 GATGACCATTACCTTGGGGTTGG - Exonic
1121462900 14:94095715-94095737 TTTGTTCATTACCATGGGGAGGG + Intronic
1122653982 14:103244695-103244717 AAGGCTCATTCCCATGGGGGGGG + Intergenic
1126424955 15:48517277-48517299 GATACTCAAAGCCATGGGGATGG + Intronic
1127726078 15:61751269-61751291 GATGCTCATTAGTATTGGTAGGG - Intergenic
1128467466 15:67924967-67924989 CTCACTCATTACCATGGGGAGGG + Intergenic
1128575811 15:68774202-68774224 CTCACTCATTACCATGGGGATGG - Intergenic
1129035062 15:72644154-72644176 CTCACTCATTACCATGGGGAGGG + Intergenic
1129214820 15:74093062-74093084 CTCACTCATTACCATGGGGAGGG - Intergenic
1129390565 15:75218605-75218627 CTCACTCATTACCATGGGGAGGG + Intergenic
1129473711 15:75769014-75769036 CTCACTCATTACCATGGGGAGGG - Intergenic
1129731953 15:77937413-77937435 CTCACTCATTACCATGGGGAGGG - Intergenic
1130081706 15:80739520-80739542 AGAACTCATTACCATGGGGAGGG - Intronic
1131055460 15:89371975-89371997 GATGCGCGTCACCATGGCGACGG + Intergenic
1131506205 15:93022057-93022079 GAGGCTCTTTACCTTGGGGGTGG - Intronic
1135477098 16:22786314-22786336 GATGGTGATCCCCATGGGGATGG - Intergenic
1137418400 16:48307996-48308018 TGAACTCATTACCATGGGGAAGG + Intronic
1137506689 16:49060129-49060151 TATGCTCACTACCAGGGTGATGG - Intergenic
1138927436 16:61609885-61609907 TATGCTCACTACCAGGGTGATGG - Intergenic
1138983786 16:62302248-62302270 GAAGCTCATTACCATGGAAGGGG - Intergenic
1139141418 16:64267401-64267423 CTTACTGATTACCATGGGGAAGG + Intergenic
1139233848 16:65313893-65313915 TATGCTCACTACCAGGGTGATGG + Intergenic
1139971815 16:70781087-70781109 CTCGCTCAGTACCATGGGGAGGG - Intronic
1141386346 16:83625446-83625468 GATGGTCAGTAGCATGTGGAAGG - Intronic
1142734262 17:1885230-1885252 GCTGCTCCTTACGATGGGCAAGG - Intronic
1144159370 17:12542749-12542771 CACACTCATTACCATAGGGAGGG + Intergenic
1144427141 17:15153875-15153897 TACACTCATTACCATGGGGAAGG + Intergenic
1144611481 17:16722080-16722102 GATGCTCTTTATCATGCTGATGG + Intronic
1144901260 17:18593277-18593299 GATGCTCTTTATCATGCTGATGG - Intergenic
1145131246 17:20352820-20352842 GATGCTCTTTATCATGCTGATGG + Intergenic
1147792902 17:43024685-43024707 GCTGCCCGTTGCCATGGGGACGG + Intronic
1148889011 17:50794363-50794385 CTCACTCATTACCATGGGGAGGG + Intergenic
1148994106 17:51693434-51693456 TATGCTCAGTACCTTGGTGATGG - Intronic
1149112700 17:53052309-53052331 TATGCTCAGTACCCTGGTGATGG + Intergenic
1150173106 17:63020979-63021001 CTCCCTCATTACCATGGGGAGGG + Intronic
1150969301 17:70009577-70009599 TGAACTCATTACCATGGGGAAGG - Intergenic
1150969561 17:70011551-70011573 TGAACTCATTACCATGGGGAGGG - Intergenic
1153171384 18:2319855-2319877 CACACTCATTATCATGGGGATGG - Intergenic
1153198608 18:2627026-2627048 TATGCTCATTACCTGGGTGATGG + Intergenic
1154484552 18:14863314-14863336 CTTGCTCATCACCAAGGGGATGG - Intergenic
1155414844 18:25586648-25586670 CTTGCTCATTACCAAGGGGAGGG + Intergenic
1155816754 18:30320943-30320965 ATAACTCATTACCATGGGGAGGG + Intergenic
1156132644 18:33996516-33996538 TATGCTCACTACCTTGGTGATGG - Intronic
1156134426 18:34019902-34019924 CTCACTCATTACCATGGGGATGG - Intronic
1156167248 18:34437031-34437053 TATGCTCATTACCAATGAGAAGG - Intergenic
1156434162 18:37108410-37108432 TATGCTCACTACCAGGGTGATGG + Intronic
1156622147 18:38865006-38865028 CTTACTCATTACCAAGGGGAGGG - Intergenic
1156832084 18:41503901-41503923 GTAACTCATTACCATGGGGAGGG + Intergenic
1157042477 18:44057128-44057150 TTCACTCATTACCATGGGGAAGG - Intergenic
1157751820 18:50185708-50185730 AATGCTCATCAGCATGGGAATGG + Intronic
1158189753 18:54813462-54813484 TCCACTCATTACCATGGGGAGGG - Intronic
1159075484 18:63676894-63676916 GTTCCTCAATAGCATGGGGAAGG + Intronic
1159800178 18:72889172-72889194 GTTGCTCAGTACCGTGGGGGTGG - Intergenic
1160121632 18:76135487-76135509 CTCACTCATTACCATGGGGAGGG + Intergenic
1162211631 19:9096514-9096536 CTTCCTCATTACTATGGGGAGGG - Intergenic
1164497983 19:28786118-28786140 CTTGCTCATTACCATAGGGAAGG + Intergenic
1164604531 19:29588052-29588074 TATGCTCATTACCTGGGTGATGG - Intergenic
1164850804 19:31482647-31482669 CTCACTCATTACCATGGGGATGG + Intergenic
1164858563 19:31544446-31544468 CTCACTCATTACCATGGGGAGGG + Intergenic
1164921274 19:32090340-32090362 CACACTTATTACCATGGGGAGGG - Intergenic
1165147740 19:33742504-33742526 CTCGCTCATTACCATGGGGAGGG + Intronic
1165223110 19:34333791-34333813 GAGGCACGTTACCATGTGGATGG - Exonic
1166653981 19:44596707-44596729 GATGGTCAATGCCATGGAGAAGG + Intergenic
1202699759 1_KI270712v1_random:155377-155399 TATGCTCATTACCTGGGTGACGG - Intergenic
925320733 2:2965342-2965364 GATGCTCACTACCATGGTGATGG + Intergenic
926498617 2:13622835-13622857 TATGCTCATTACCAAGGTAATGG + Intergenic
927171250 2:20371999-20372021 CTCACTCATTACCATGGGGAAGG + Intergenic
928069853 2:28203807-28203829 GCTGCTTATTACCATGGGAATGG - Intronic
928411409 2:31057182-31057204 TATGCTCATTACCTGGGTGATGG + Intronic
930604138 2:53475124-53475146 GATGCCCATTTCCAGGAGGAGGG + Intergenic
931704466 2:64935871-64935893 CTTGCCCATTACCATGGGGAGGG - Intergenic
931802719 2:65774174-65774196 GATTGTCATAACCAGGGGGAGGG + Intergenic
932051849 2:68405718-68405740 GGTGCTCTTTCCCATGGAGATGG - Intergenic
933141909 2:78801662-78801684 TATGCTCATTACCTGGGTGATGG + Intergenic
933266184 2:80182530-80182552 CATGCTCATTCTGATGGGGAAGG + Intronic
934170702 2:89538865-89538887 TATGCTCATTACCTGGGTGACGG - Intergenic
934770556 2:96905097-96905119 GATACTCATGACCCTGGGGTGGG + Intronic
935528371 2:104201009-104201031 ACTGATCATTAGCATGGGGAAGG - Intergenic
938471632 2:131568389-131568411 GATGCTCACTACCTTAGTGATGG - Intergenic
938788758 2:134657904-134657926 TATGCTCATTACCTGGGTGATGG + Intronic
939196080 2:138974272-138974294 GTAACTCATTACCATAGGGAGGG + Intergenic
939546836 2:143565183-143565205 GATTCAATTTACCATGGGGAAGG + Intronic
940198726 2:151126329-151126351 TATGCTCACTACCCTGGTGACGG + Intergenic
940541450 2:155025240-155025262 AATGCTCATTACCTGGGTGAGGG - Intergenic
940995241 2:160142590-160142612 GGAGCTCATTACCAGGAGGAAGG - Intronic
941436719 2:165481978-165482000 TATGCTCACTACCTTGGAGATGG + Intronic
942364727 2:175212827-175212849 GAAACTCTTTACCATAGGGAGGG - Intergenic
942366355 2:175232321-175232343 GATGGTCATTACAATTGGGATGG + Intergenic
943597143 2:189872007-189872029 CTCACTCATTACCATGGGGATGG + Intronic
943920108 2:193695942-193695964 AATACTCTTTGCCATGGGGATGG + Intergenic
944160210 2:196652008-196652030 CTCACTCATTACCATGGGGAGGG + Intronic
946825441 2:223672957-223672979 TGAACTCATTACCATGGGGAGGG + Intergenic
947197348 2:227582250-227582272 TGAACTCATTACCATGGGGAAGG - Intergenic
948773432 2:240265370-240265392 TATGCTCATTACCTGGGTGATGG - Intergenic
1171015035 20:21532853-21532875 GATCCTCTGGACCATGGGGAAGG + Intergenic
1171778026 20:29388975-29388997 TATGCTCACTACCTTGGTGATGG - Intergenic
1171819796 20:29824367-29824389 TATGCTCACTACCTTGGTGATGG - Intergenic
1172314835 20:33945570-33945592 CTCACTCATTACCATGGGGATGG + Intergenic
1172911414 20:38411997-38412019 CTCACTCATTACCATGGGGAGGG + Intergenic
1173134779 20:40429838-40429860 GGAACTCATTAGCATGGGGAGGG + Intergenic
1174123269 20:48283423-48283445 CTCGCTCATTACCAAGGGGATGG + Intergenic
1175395160 20:58652504-58652526 GAGGCTCATTACTGGGGGGAGGG - Intronic
1175535371 20:59707373-59707395 GGAACTCATCACCATGGGGAGGG - Intronic
1175589295 20:60174913-60174935 GATGCTCAGTTCTTTGGGGATGG - Intergenic
1178153655 21:29826147-29826169 ATTGGTCATTACTATGGGGAAGG + Intronic
1180323794 22:11349058-11349080 TATGCTCACTACCTTGGTGATGG - Intergenic
1180472140 22:15668268-15668290 GATGCTCATTACCTTAGTGATGG - Intergenic
1180986791 22:19909370-19909392 GATGCTCATTAACAAGAGAAAGG + Intronic
1181975649 22:26727477-26727499 GTAACTCATTACCATGGGGAGGG + Intergenic
1182856491 22:33522049-33522071 GTCACTCATTACCACGGGGATGG + Intronic
1184319466 22:43729156-43729178 CCCACTCATTACCATGGGGAGGG + Intronic
949612428 3:5716120-5716142 GTCACTCATTACCATGAGGATGG - Intergenic
949663540 3:6309985-6310007 TATGCTCACTACCTTGGTGATGG + Intergenic
950201070 3:11044425-11044447 CAAACTCATTACCATGGGGAGGG - Intergenic
950329259 3:12143379-12143401 GATGCTCATTATTTTGGCGATGG - Intronic
950726148 3:14918347-14918369 TAGGCTCTTTACCATGGGGAAGG + Intronic
951351783 3:21615174-21615196 TGAGCTCATTACCATGGTGAGGG - Intronic
952699522 3:36311417-36311439 TATGATCATTAGCATGGAGAGGG - Intergenic
954419342 3:50410416-50410438 CATGCTCACTACCTTGGGGTTGG + Intronic
954950570 3:54468949-54468971 GGTGCTCTTTACCAGGGAGATGG - Intronic
955577340 3:60380209-60380231 CCCACTCATTACCATGGGGAGGG - Intronic
956230570 3:67011619-67011641 TGCGCTCATTACCATAGGGAGGG + Intergenic
956553154 3:70484730-70484752 GATGCTCTTAGCCATGGGCATGG + Intergenic
957087137 3:75691578-75691600 TATGCTCACTACCTTGGTGATGG + Intergenic
957593004 3:82225085-82225107 GATGATCATTTTCATGGGCAAGG - Intergenic
957909827 3:86606904-86606926 CTTAGTCATTACCATGGGGAGGG + Intergenic
958042821 3:88246518-88246540 CACACTCATTACCATGTGGAGGG - Intergenic
958538640 3:95438415-95438437 TATGCTTATTACCTTGGTGATGG - Intergenic
959245384 3:103861715-103861737 TTCACTCATTACCATGGGGAAGG - Intergenic
959655556 3:108800493-108800515 GTAACTCATTACTATGGGGAGGG - Intergenic
960350714 3:116589485-116589507 TATGCTCATTACCTGGGTGATGG - Intronic
960516045 3:118603963-118603985 CTCACTCATTACCATGGGGATGG - Intergenic
961184754 3:124904983-124905005 AATGCTCATCATCATGGGGTAGG + Intergenic
961261820 3:125607813-125607835 GTTGCTCAGTACAATGGGCATGG + Intergenic
961438180 3:126933623-126933645 TTCGCTCATTACCATGGGGAGGG + Intronic
962073494 3:132056191-132056213 GTTGCTCATTGCCTTGGGAATGG + Intronic
963895818 3:150683979-150684001 GATGGGTCTTACCATGGGGAAGG - Intronic
963931691 3:151010140-151010162 GTCACTCATTACCATGGGGATGG + Intergenic
964269259 3:154937854-154937876 CTTGCTCATTACTATGAGGATGG - Intergenic
964903178 3:161685934-161685956 CTCACTCATTACCATGGGGAGGG - Intergenic
965637779 3:170801789-170801811 GCTGATCAGTACCATGGGGCAGG + Intronic
966325580 3:178749958-178749980 GAGGCTCTTTCCCATGGGCATGG + Intronic
968943884 4:3653599-3653621 GATGCTCCTTCCCCTGGTGAAGG - Intergenic
969029090 4:4197013-4197035 TATGCTCATTACCTGGGTGATGG + Intronic
969842594 4:9893385-9893407 GATTCTCATTTGCAGGGGGAGGG + Intronic
970088899 4:12380757-12380779 TTTGCTCATTATCATGGGAAAGG + Intergenic
971530861 4:27687106-27687128 TATGCTCATTACCTGGGCGATGG - Intergenic
971614481 4:28770007-28770029 TATGCTCATTACCTGGGTGATGG + Intergenic
971823541 4:31591280-31591302 CCCACTCATTACCATGGGGAAGG + Intergenic
972254823 4:37342184-37342206 CTCACTCATTACCATGGGGAGGG - Intronic
973937445 4:55862087-55862109 AATTTTTATTACCATGGGGAGGG + Intronic
973990996 4:56407261-56407283 GATGATCATTAATATGGGGAGGG - Intronic
974016313 4:56652479-56652501 GTTGCTCCTTTCCATGGGAAAGG - Intronic
974748769 4:66109812-66109834 TATGCTCACTACCTTGGTGATGG - Intergenic
975403587 4:73965066-73965088 GATGGTGGTTACCATTGGGAGGG + Intergenic
976132289 4:81897496-81897518 TATGCTCACTACCTTGGTGATGG - Intronic
977055873 4:92189653-92189675 CTTGCTCATTACCAAGAGGATGG + Intergenic
978033356 4:103964330-103964352 TATGCTCACTACCTTGGTGACGG - Intergenic
980724104 4:136735726-136735748 GATGAACGTTAGCATGGGGAGGG + Intergenic
980782256 4:137506093-137506115 GATGCCCATAACATTGGGGAGGG + Intergenic
981122018 4:141062869-141062891 GGTGCACATGACCATGAGGATGG - Intronic
983460195 4:168017353-168017375 CTCACTCATTACCATGGGGATGG + Intergenic
985050432 4:185985731-185985753 TATGCTCATTACCTGGGTGATGG - Intergenic
985300929 4:188488624-188488646 TATGCTCACTACCAGGGTGATGG - Intergenic
985375555 4:189333701-189333723 TATGCTCAGTACCTTGGTGATGG + Intergenic
989459277 5:41678610-41678632 GATGCTCACTACCTGGGTGACGG - Intergenic
989563686 5:42879282-42879304 GATTTCCATTTCCATGGGGATGG + Intronic
990886475 5:60600125-60600147 GATTCTCAATGCCTTGGGGATGG + Intronic
991003738 5:61807876-61807898 GTTGCTGATTTCCATGGGGAAGG - Intergenic
992240806 5:74767353-74767375 CATCCTCCTTACCATGGTGACGG - Exonic
992558019 5:77922180-77922202 ATAACTCATTACCATGGGGAGGG - Intergenic
993819804 5:92600690-92600712 GTGCCTTATTACCATGGGGAGGG - Intergenic
995876801 5:116798803-116798825 GATGTTCATTATGATGGGGGAGG + Intergenic
996909676 5:128640843-128640865 GATGAACGTTAACATGGGGAAGG + Intronic
997111162 5:131076145-131076167 CTCACTCATTACCATGGGGAGGG + Intergenic
997447075 5:133948337-133948359 TGCGTTCATTACCATGGGGAGGG + Intergenic
997768602 5:136530658-136530680 CTCACTCATTACCATGGGGAGGG + Intergenic
999641957 5:153681240-153681262 CTTATTCATTACCATGGGGAGGG + Intronic
1000422587 5:161055527-161055549 ACTACTCATTACCATGAGGATGG + Intergenic
1000726550 5:164778974-164778996 TATGCTCAGTACCAGGGTGAAGG + Intergenic
1001975627 5:175996388-175996410 GAGGCTCAGGGCCATGGGGATGG - Intronic
1002241802 5:177847384-177847406 GAGGCTCAGGGCCATGGGGATGG + Intergenic
1003461477 6:6332719-6332741 GAAGCTAATGACCATGGAGAGGG - Intergenic
1004097173 6:12568171-12568193 GAAGGTCATTGCCATGGGGAAGG + Intergenic
1005016236 6:21377880-21377902 GCTGGACATTCCCATGGGGACGG - Intergenic
1005766622 6:29017236-29017258 TGTTCTCATTACAATGGGGACGG + Intergenic
1005933028 6:30497963-30497985 GACGCTGATTTGCATGGGGAGGG - Intergenic
1007961924 6:45967859-45967881 CTCACTCATTACCATGGGGAGGG + Intronic
1009965894 6:70577651-70577673 TATGCTCATTACCTGGGTGATGG - Intronic
1010099875 6:72091331-72091353 GATTCTCATTACTTTGGGAATGG + Intronic
1010266405 6:73873047-73873069 AGAACTCATTACCATGGGGAGGG - Intergenic
1010726690 6:79343184-79343206 CATGCTCATTACCTGGGTGATGG - Intergenic
1010974780 6:82299425-82299447 CACACTCATTACCATGGGGAGGG + Intergenic
1011746566 6:90412817-90412839 GAGGCTCAGTATCATGGGGAGGG + Intergenic
1012010400 6:93777186-93777208 GATGCTAGATACCATGGGTAAGG - Intergenic
1012918169 6:105193295-105193317 CTTGCTCATCACCAAGGGGAGGG - Intergenic
1013740138 6:113273748-113273770 TTCGCTCATTACCATGGGGTGGG + Intergenic
1015054000 6:128877265-128877287 GATGCTCAGTACAAAGTGGAGGG - Intergenic
1018957185 6:168418114-168418136 GAGGCTCATTTCAAAGGGGAAGG + Intergenic
1019476292 7:1246197-1246219 GATGCCAATTCCCACGGGGAGGG + Intergenic
1021127170 7:16864757-16864779 TATGCTCATTGCCAAGGAGAAGG - Intronic
1021170409 7:17392385-17392407 AACTCTCATTACCATGGAGAGGG + Intergenic
1021507690 7:21403588-21403610 GTAACTCATTACCATGGGGAGGG - Intergenic
1021908390 7:25359393-25359415 GAGACTCATTACCTGGGGGACGG + Intergenic
1022142166 7:27501837-27501859 TGTGCTCATTACCAGGGGGATGG - Intergenic
1022513682 7:30961709-30961731 CTCACTCATTACCATGGGGAGGG - Intronic
1022670252 7:32448896-32448918 CTCACTCATTACCATGGGGATGG - Intergenic
1025116392 7:56262218-56262240 CATTCTCATCATCATGGGGAGGG + Intergenic
1026231899 7:68491116-68491138 GATGGTCATCAGGATGGGGAGGG + Intergenic
1026619073 7:71934606-71934628 CTCACTCATTACCATGGGGAGGG + Intronic
1028350752 7:89844475-89844497 AATACTCCTTACCATGGGGCAGG - Intergenic
1028791024 7:94853203-94853225 GCAACTCATTACCATGGGCAGGG - Intergenic
1028868941 7:95744630-95744652 TATGCTCATTACCTGGGTGATGG + Intergenic
1028870648 7:95768077-95768099 CTCACTCATTACCATGGGGAGGG - Intergenic
1029162842 7:98564751-98564773 GTCACTCATTACCATGGAGATGG - Intergenic
1029236062 7:99120047-99120069 CTGACTCATTACCATGGGGATGG - Intronic
1029645605 7:101853852-101853874 GTTTCTCATGACCATGGGCAGGG - Intronic
1029880790 7:103807553-103807575 TATGCTCACTACCTTGGTGATGG - Intronic
1032492054 7:132331093-132331115 GCTGCTCATTAACATGGCCAAGG - Intronic
1032686338 7:134237727-134237749 GATGTTCATTACTATTGGGGTGG + Intronic
1033132637 7:138758204-138758226 GATGCACAGTAATATGGGGAGGG + Intronic
1033737582 7:144238732-144238754 CATGCTCATCTCCTTGGGGAAGG + Intergenic
1033745475 7:144312225-144312247 CATGCTCATCTCCTTGGGGAAGG - Intergenic
1033812750 7:145035772-145035794 TTCACTCATTACCATGGGGATGG + Intergenic
1035929300 8:3763378-3763400 CTTACTCATTACCATGGGGAAGG - Intronic
1036189621 8:6658542-6658564 GTTGATCATGACCATGGGGATGG - Intergenic
1036225526 8:6954516-6954538 CATGGCCATTCCCATGGGGATGG + Intergenic
1036539582 8:9692150-9692172 TATGCTCACTACCTTGGTGATGG - Intronic
1038867140 8:31451506-31451528 TATGCTCATTACCTAGGTGATGG + Intergenic
1039108692 8:34018588-34018610 CTGACTCATTACCATGGGGATGG + Intergenic
1039547660 8:38421440-38421462 GATGCTCAGTACCCAGCGGAGGG + Intronic
1039677663 8:39687559-39687581 TATGCTCACTACCTTGGTGATGG - Intronic
1039948384 8:42149431-42149453 CTCACTCATTACCATGGGGAGGG - Intergenic
1040758581 8:50810133-50810155 GATGCTCACTACCTAGGTGATGG - Intergenic
1041023879 8:53664994-53665016 GATGCTCATGACTGTGGGGGTGG - Intergenic
1041491627 8:58438948-58438970 AGAACTCATTACCATGGGGATGG - Intronic
1042386689 8:68184100-68184122 GATGCTTATGGGCATGGGGAAGG + Intronic
1042799299 8:72701123-72701145 TATGCTCATTACCTGGGTGATGG + Intronic
1043421323 8:80101752-80101774 CTTGATCATTACCAAGGGGAGGG + Intronic
1043597943 8:81905638-81905660 GAGAATCATTACCTTGGGGAAGG + Intergenic
1043993126 8:86780639-86780661 CAGGCTCAATACCATGTGGAAGG - Intergenic
1044109561 8:88255170-88255192 CTCACTCATTACCATGGGGAGGG - Intronic
1044194718 8:89361095-89361117 AGAACTCATTACCATGGGGAGGG - Intergenic
1044376960 8:91486418-91486440 CATGCTCATTACCTGGGTGACGG - Intergenic
1044752077 8:95426076-95426098 TATGCTCATTACCTTAGGGGAGG + Intergenic
1045878539 8:107011261-107011283 CTCACTCATTACCATGGGGAGGG - Intergenic
1046829699 8:118730831-118730853 CTCACTCATTACCATGGGGATGG - Intergenic
1047103133 8:121702990-121703012 TGAACTCATTACCATGGGGAGGG + Intergenic
1048029101 8:130614109-130614131 CTCACTCATTACCATGGGGATGG + Intergenic
1049436552 8:142588764-142588786 GAGGCTTCTAACCATGGGGACGG - Intergenic
1049681360 8:143919941-143919963 GATTCTCATTACCATCGTGGAGG - Exonic
1051366491 9:16325105-16325127 GATAGGCACTACCATGGGGAAGG + Intergenic
1053177283 9:35936911-35936933 CTCACTCATTACCATGGGGATGG - Intergenic
1053428359 9:38025823-38025845 GCTCCTCATCAACATGGGGAGGG - Intronic
1053558450 9:39162866-39162888 TATGCTCATTACCTGGGTGATGG + Intronic
1053750597 9:41250608-41250630 TATGCTCACTACCTTGGTGATGG + Intergenic
1053822568 9:41983091-41983113 TATGCTCATTACCTGGGTGATGG + Intronic
1054138664 9:61456075-61456097 TATGCTCATTACCTGGGTGATGG - Intergenic
1054256105 9:62814951-62814973 TATGCTCACTACCTTGGTGATGG + Intergenic
1054335202 9:63800661-63800683 TATGCTCACTACCTTGGTGATGG - Intergenic
1054608008 9:67204275-67204297 TATGCTCATTACCTGGGTGATGG - Intergenic
1054972636 9:71106369-71106391 CTCCCTCATTACCATGGGGAGGG - Intronic
1055320680 9:75080737-75080759 CTCACTCATTACCATGGGGATGG - Intronic
1055823851 9:80300895-80300917 GATGCTCCGTCCCATGGAGATGG + Intergenic
1060116849 9:120948544-120948566 AACTCTCATTACCATGGGGAGGG + Intergenic
1060808679 9:126596341-126596363 AATGCTCATTACTATTGGGTTGG - Intergenic
1062175390 9:135159273-135159295 GAAGCTGATTACAATGGTGATGG + Intergenic
1203371470 Un_KI270442v1:309632-309654 TATGCTCACTACCTTGGTGATGG - Intergenic
1186098629 X:6130791-6130813 CGTGCTCATTACCATGGGATTGG - Intronic
1186283860 X:8023442-8023464 GATGCCCACTCACATGGGGAGGG - Intergenic
1187816043 X:23232829-23232851 TGTACTCATTACCATGGGGATGG - Intergenic
1188029799 X:25251669-25251691 TATGCTCATTACCTTGGTGACGG - Intergenic
1188580595 X:31707515-31707537 TATGCTCACTAACATGGCGATGG + Intronic
1189255436 X:39634920-39634942 GTAACTCATTACCATGGGAAGGG - Intergenic
1189936276 X:46072333-46072355 TATGCTCATTACCTGGGTGATGG - Intergenic
1190882936 X:54506298-54506320 GATGGTGATGACAATGGGGAGGG - Intergenic
1192743899 X:73919800-73919822 GATGCTTATTCACATGGGGAAGG - Intergenic
1193181256 X:78459857-78459879 TATGCTCAGTACCAGGGTGATGG - Intergenic
1194846562 X:98816553-98816575 CTCACTCATTACCATGGGGAGGG + Intergenic
1194853065 X:98892517-98892539 TAGACTCATTACCATGGGGAGGG - Intergenic
1195151855 X:102079616-102079638 GTTGCTCATTGCTATGGGGTTGG - Intergenic
1197380188 X:125729355-125729377 GATGCAGATTTCCTTGGGGAAGG + Intergenic
1198681140 X:139183487-139183509 CTCACTCATTACCATGGGGATGG - Intronic
1199120857 X:144052226-144052248 GATTCTTATTACCATGAGCAAGG - Intergenic
1200056750 X:153465584-153465606 GAGGCTCATCACCTTGGGCACGG + Intronic
1201760986 Y:17537879-17537901 TATGCTCATTACCTTGGTAATGG - Intergenic
1201840566 Y:18368111-18368133 TATGCTCATTACCTTGGTAATGG + Intergenic