ID: 920512328

View in Genome Browser
Species Human (GRCh38)
Location 1:206560382-206560404
Sequence GGTCTCCCCATTTCATAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 147}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920512317_920512328 14 Left 920512317 1:206560345-206560367 CCAATGCCCTTTGGGAAGAGGTC 0: 1
1: 0
2: 1
3: 11
4: 148
Right 920512328 1:206560382-206560404 GGTCTCCCCATTTCATAGGAAGG 0: 1
1: 0
2: 2
3: 16
4: 147
920512322_920512328 7 Left 920512322 1:206560352-206560374 CCTTTGGGAAGAGGTCGGAGGGG 0: 1
1: 0
2: 1
3: 14
4: 134
Right 920512328 1:206560382-206560404 GGTCTCCCCATTTCATAGGAAGG 0: 1
1: 0
2: 2
3: 16
4: 147
920512315_920512328 19 Left 920512315 1:206560340-206560362 CCTCTCCAATGCCCTTTGGGAAG 0: 1
1: 0
2: 0
3: 13
4: 181
Right 920512328 1:206560382-206560404 GGTCTCCCCATTTCATAGGAAGG 0: 1
1: 0
2: 2
3: 16
4: 147
920512311_920512328 28 Left 920512311 1:206560331-206560353 CCCAAGACTCCTCTCCAATGCCC 0: 1
1: 0
2: 0
3: 27
4: 224
Right 920512328 1:206560382-206560404 GGTCTCCCCATTTCATAGGAAGG 0: 1
1: 0
2: 2
3: 16
4: 147
920512312_920512328 27 Left 920512312 1:206560332-206560354 CCAAGACTCCTCTCCAATGCCCT 0: 1
1: 1
2: 2
3: 30
4: 298
Right 920512328 1:206560382-206560404 GGTCTCCCCATTTCATAGGAAGG 0: 1
1: 0
2: 2
3: 16
4: 147
920512320_920512328 8 Left 920512320 1:206560351-206560373 CCCTTTGGGAAGAGGTCGGAGGG 0: 1
1: 0
2: 1
3: 8
4: 163
Right 920512328 1:206560382-206560404 GGTCTCCCCATTTCATAGGAAGG 0: 1
1: 0
2: 2
3: 16
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920512328 Original CRISPR GGTCTCCCCATTTCATAGGA AGG Intronic
901786888 1:11630497-11630519 GGTCTCCCTATGTCATAGGCTGG + Intergenic
901832244 1:11899521-11899543 TCTCTCCCCATTTCCAAGGAAGG - Intergenic
902743059 1:18453596-18453618 GTTCTCCTCATTTCACAGGAGGG - Intergenic
903885054 1:26536279-26536301 GGACTCCCCATTTATTAGGAAGG + Intronic
905914143 1:41673443-41673465 ATTACCCCCATTTCATAGGAGGG + Intronic
908571105 1:65411311-65411333 GGTCTCCCCAGCCCATAGTACGG - Exonic
914741719 1:150471355-150471377 GGTCTCTCCATTCCATCAGAAGG - Exonic
915602768 1:156932628-156932650 TGTCTCCCCATTTCCAAGGAAGG + Intronic
917152556 1:171960433-171960455 GGGCTCCACTTTTTATAGGATGG + Intronic
919274473 1:195395073-195395095 GGTCTCTCTATTTCATAGCAAGG - Intergenic
919842204 1:201617912-201617934 GTTCCCCTCATTTCAGAGGAAGG + Intergenic
920039661 1:203087179-203087201 GGTCTGCCCACTGCATTGGAAGG - Intergenic
920382430 1:205543204-205543226 GATTTCCCCATTTCAGTGGATGG + Intergenic
920512328 1:206560382-206560404 GGTCTCCCCATTTCATAGGAAGG + Intronic
920867980 1:209769067-209769089 TCTCTCCCCATTCCATAGTATGG - Intronic
921294351 1:213688157-213688179 GGTCTCCGCATTCCACAGGGTGG - Intergenic
923084783 1:230694990-230695012 GGTCTCCCCATTTCAGTGATGGG + Intergenic
923636324 1:235700807-235700829 TGTGTCCCCAGTTCCTAGGAAGG - Intronic
923840894 1:237669669-237669691 GGTCCCCACATCTCAGAGGATGG + Intronic
1063042483 10:2357716-2357738 GGTCTCCCCGTTTCCCAGGCTGG + Intergenic
1067217048 10:44311681-44311703 GGTCTGCCCACTGCACAGGACGG + Intergenic
1069236635 10:66083672-66083694 GGTTTCCACAATACATAGGATGG - Intronic
1069876000 10:71563233-71563255 AGCCTCCCCATTTCCTAGGGTGG - Intronic
1070253909 10:74797736-74797758 GGACTCCCCATCTCCCAGGAGGG - Intergenic
1072189158 10:93066438-93066460 GCTCAGCCCATTTTATAGGACGG - Intronic
1079031638 11:16990575-16990597 GGTGTGCCCATTTGATGGGATGG - Intronic
1079804436 11:24911403-24911425 AATCTCCACATTTCAAAGGAGGG + Intronic
1080687190 11:34525281-34525303 TGTATCCCCATTTTATAGAAGGG + Intergenic
1082401257 11:52237306-52237328 GATCTACCCGTTTCAAAGGAAGG - Intergenic
1083341246 11:61959761-61959783 CATCTCCCCATTTCACAGGCAGG + Intronic
1085829092 11:79880644-79880666 GGTTGACCCATTTCATAGAAGGG - Intergenic
1090069189 11:123528807-123528829 GGTGTCTCCATTTCAGAGGTAGG + Intronic
1091341196 11:134815417-134815439 GGTCTCCCTCTTTCATTTGAAGG - Intergenic
1103192275 12:119011760-119011782 GGTCTCCCTATTTTGTAGAAGGG - Intronic
1103920851 12:124398472-124398494 GATCACCCCATTTTATAGAAGGG + Intronic
1105221068 13:18327963-18327985 GGTCACCCCATTCCAAAGCATGG - Intergenic
1109256711 13:60092149-60092171 GGTATTCCCATTTTATAGTAAGG + Intronic
1110382976 13:74875827-74875849 TGTCTCCCCATTTCATTCTAGGG - Intergenic
1111851556 13:93582536-93582558 ATTAACCCCATTTCATAGGAGGG + Intronic
1112421970 13:99260471-99260493 AGTCTCCCCATCTCATAAGCTGG - Intronic
1115556673 14:34549771-34549793 GGTCACCCCTTTACATAGGTAGG - Intergenic
1116741088 14:48755621-48755643 GGTGTCACAATTTAATAGGAAGG - Intergenic
1121536942 14:94697448-94697470 GGTCTACCCATTTCACAGACGGG + Intergenic
1125577935 15:40767774-40767796 GGTCTGCCCACTTCCTGGGAGGG + Exonic
1127009710 15:54610019-54610041 AATCTCCCCATGTCATTGGAGGG - Intronic
1128311699 15:66634912-66634934 GGTCTCACCATGTCACAGGGAGG + Intronic
1129453443 15:75663444-75663466 GGTACCCCCACTTCATAGGTTGG + Intergenic
1130428783 15:83825587-83825609 GGTCTCACCCTATCATAGGCTGG - Intronic
1131592283 15:93762583-93762605 GTTCTCTCCATGTCATTGGATGG - Intergenic
1132539438 16:501669-501691 GCTCCCCCCATTTCATAGGCAGG + Intronic
1132618251 16:852781-852803 GGTCTCCCCCTTGCAGAGGCTGG + Intergenic
1134066329 16:11230786-11230808 TGTCTCCCCATCTCATAGATGGG + Intergenic
1134410593 16:14000466-14000488 GGTCTCCCCATTTCCCAGTTGGG + Intergenic
1138180046 16:54935074-54935096 GGTTTCCCCCTTTCACAGGTAGG + Intergenic
1141374506 16:83518035-83518057 AATCTCCACATGTCATAGGAGGG + Intronic
1143994471 17:10994651-10994673 GATCTTCCCATTTCATGGCATGG + Intergenic
1151161638 17:72170961-72170983 AGTCTCACCAATTCAGAGGATGG - Intergenic
1154326785 18:13397030-13397052 GGTGTGCCCATTTCACACGAGGG + Intronic
1155160488 18:23191441-23191463 GGTCTTCCCATTTTATAGATGGG - Intronic
1158684228 18:59598522-59598544 TGCCTCCACATTTCAGAGGATGG - Intronic
1162940282 19:14005538-14005560 ATTCTCCCCATTTTACAGGATGG + Intronic
1163742651 19:19025655-19025677 AGTCTCCCCCTTTCCTAGGAGGG + Exonic
1165595932 19:37011317-37011339 GGTCTCCATGTTTCATGGGATGG + Intronic
1165657971 19:37550292-37550314 GGTCTCCCCATTGCATCAGATGG + Intergenic
1167914918 19:52733039-52733061 TGTCTCCCCTTTTCCTAGGATGG - Intronic
931666087 2:64610293-64610315 ATTATTCCCATTTCATAGGAAGG + Intergenic
932588029 2:73044464-73044486 GGTGTCCCCACTTCAGAGAAAGG + Intronic
934182989 2:89644505-89644527 GGTCACCCCATTCCAAAGCATGG + Intergenic
934293275 2:91718692-91718714 GGTCACCCCATTCCAAAGCATGG + Intergenic
935744998 2:106182707-106182729 GTTCTCTCCATTTCATAGGTGGG - Intronic
937682301 2:124657111-124657133 GGTCTCCCAATCTCATAGTGTGG + Intronic
937968431 2:127532109-127532131 CTTCTCCTCATTTCATAGCAAGG - Intergenic
940655413 2:156481970-156481992 GTTATCCCTATTTCATAGAAGGG - Intronic
942345334 2:174996871-174996893 AATTTCCCCATTTCATATGATGG + Intronic
945917127 2:215715696-215715718 GGTATCCCCATTTCTTGAGAAGG + Intergenic
946008852 2:216548660-216548682 GGTCTTTCCATTTTATAGGTGGG + Intronic
946576939 2:221085984-221086006 GGGCTTCACATTTCATAGTAGGG + Intergenic
946831474 2:223732477-223732499 GATCTCCACATGTCATGGGAGGG - Intergenic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
948464901 2:238147706-238147728 GGGCTCCCCATTTCACAGACAGG - Intronic
1168765622 20:380353-380375 GTTCTTCCCATTTCATAGGTGGG + Intronic
1170628244 20:18045932-18045954 TTTCTCCCCATTTCACAGCATGG + Intronic
1170670883 20:18432130-18432152 GTTCTTCCCATTTTATGGGAAGG - Intronic
1170974405 20:21149080-21149102 GTTGTCCCCATTTTATAGTAAGG + Intronic
1171137628 20:22711117-22711139 TGTCTCCCCACTTCTTAGGTGGG + Intergenic
1174361739 20:50033156-50033178 GGTCTCCTCATTTCTTAGCGAGG + Intergenic
1174398936 20:50265387-50265409 GCTATCCCCATTTCATAGATGGG + Intergenic
1174956826 20:55106624-55106646 AGGCTCCCTATTTCATGGGAGGG - Intergenic
1175539936 20:59742064-59742086 GGGTTCCCCATTTCTTTGGAGGG + Intronic
1178471288 21:32895194-32895216 AATCCCCCCATTTCATGGGAGGG - Intergenic
1181518978 22:23434542-23434564 GGTCTCCCCATTTCACAGGTGGG + Intergenic
1183481746 22:38069108-38069130 GGACTCACCATTGCACAGGATGG - Exonic
1184580290 22:45412733-45412755 GCTCTCCCCATTTTATAGTTGGG - Intronic
950888283 3:16379968-16379990 TGTCTCCTCATTTCATTTGAGGG - Intronic
951574375 3:24098892-24098914 GTTCTCCCCATTTCACAGATAGG - Intergenic
953260834 3:41337686-41337708 GCTGTCCTCATTTCATAAGATGG + Intronic
954988302 3:54815228-54815250 GGTCTCCCAATTTAAGAAGACGG - Intronic
955489351 3:59466686-59466708 CCTATCCCCATTTCAAAGGAAGG + Intergenic
957220652 3:77378344-77378366 GTTATCCCCATTTTATAGAATGG + Intronic
962113321 3:132473608-132473630 GGTTACCACATTTGATAGGAGGG - Intronic
962477161 3:135765178-135765200 GCTCTCCACATGTCATGGGAAGG + Intergenic
964435297 3:156644895-156644917 GGTCAGCCTTTTTCATAGGATGG - Intergenic
965612301 3:170557259-170557281 GGGCTCCACATTCCAAAGGATGG - Intronic
965802851 3:172512352-172512374 GGTCTTCCCATTTAATAGAGAGG - Intronic
968360017 3:198140009-198140031 TGCCTGCCCATTTCACAGGACGG - Intergenic
970610742 4:17722711-17722733 AGTCTCCCCACTGCATAAGATGG + Intronic
971560491 4:28074019-28074041 GGTGTCCCCAGTGCACAGGATGG - Intergenic
971639395 4:29111357-29111379 AGGCTTCTCATTTCATAGGAAGG - Intergenic
976863094 4:89690011-89690033 GATCCCCACATGTCATAGGAGGG - Intergenic
978337111 4:107681366-107681388 CCTTTCCCCATTTCATTGGAGGG - Intronic
981426944 4:144614308-144614330 AGTCTACCCATATCATAGAAGGG + Intergenic
981723039 4:147820618-147820640 GGTCTCCCTATTGCCTAGGCTGG + Intronic
982050823 4:151499885-151499907 AATCTCCACATTTCATGGGAGGG - Intronic
982689044 4:158527899-158527921 GGTCTCCAAATTTCATATGTAGG + Intronic
992402314 5:76422911-76422933 GTTATCCCCATTTTATAGGTGGG + Intronic
993514039 5:88807251-88807273 GGTCTCCCCGTCTCCTAGGCTGG + Intronic
994694968 5:103062627-103062649 AGTCTCCACATGTCATTGGAGGG + Intergenic
997228215 5:132225446-132225468 GGTCTCCTCATTTCCTAAGAAGG - Intronic
998697651 5:144658293-144658315 GGTCTTCCCAGTTCACAGCATGG + Intergenic
999648829 5:153746012-153746034 GGTATCCCCATTTCACAGCTAGG + Intronic
1000609736 5:163360690-163360712 AATCTCCACATGTCATAGGAGGG + Intergenic
1001748191 5:174108156-174108178 GGTCTGCCCAGGTCCTAGGATGG - Exonic
1001948614 5:175800257-175800279 GCCCTCCCCATTTGATAGGCAGG - Intronic
1004170933 6:13295100-13295122 GCTCTCCACATTTCATAATAGGG + Intronic
1006527409 6:34618774-34618796 GGTGGGCCCATTTCAGAGGAGGG - Intronic
1007903251 6:45431653-45431675 GGTCCACCCATTTCAAAGGCAGG - Intronic
1012805473 6:103887319-103887341 AGTCTGGCCATTTCATAGGCTGG + Intergenic
1013053265 6:106558274-106558296 AGTTTCTCCATTGCATAGGAAGG - Intronic
1014470114 6:121802639-121802661 GATCTCCACATGTCATGGGAGGG + Intergenic
1014791720 6:125680084-125680106 AGTCTCCCCATTTCATAGCTGGG + Intergenic
1015319113 6:131851643-131851665 AGTGTCCCCATTTACTAGGAGGG - Intronic
1016809620 6:148247410-148247432 GGTCTCCCCATTTTAGGAGATGG - Intergenic
1016894971 6:149042563-149042585 GGTCACTCCACTTCAAAGGAAGG + Intronic
1018153935 6:160967542-160967564 ATTATCCCCATTTTATAGGATGG - Intergenic
1018324753 6:162654324-162654346 AGTATCCCCATTTCATACAAAGG + Intronic
1019592308 7:1841784-1841806 GGTCTCCCCATTTCACAGGTGGG - Intronic
1021002495 7:15349898-15349920 AATCCCCCCATGTCATAGGAGGG - Intronic
1022258087 7:28679352-28679374 GGTCTCCCCATTTCACAGAGAGG - Intronic
1023756828 7:43426433-43426455 GGTCTCTTGATTTCACAGGAGGG + Intronic
1025810329 7:64871545-64871567 GCTCTCCCTATTCCATTGGAGGG + Intronic
1025811164 7:64876530-64876552 GTTCTCCCTATTCCATCGGAGGG + Intronic
1026357376 7:69570297-69570319 GGTCTCGCTATGTTATAGGATGG - Intergenic
1032022337 7:128415502-128415524 GGCCTCAGCATTTCATATGAAGG + Intergenic
1036215552 8:6877243-6877265 AGTCTCCCCAGTCAATAGGAGGG - Intronic
1036569980 8:9971678-9971700 GGTTTCCCCATGTTATAGCATGG + Intergenic
1037100420 8:15037172-15037194 GATCCCCACATGTCATAGGAGGG + Intronic
1047345213 8:124021186-124021208 GATCCCCACATATCATAGGAGGG - Intronic
1048878912 8:138857470-138857492 GGTCTCCCTATTTCACAGCAAGG + Intronic
1049181864 8:141227026-141227048 GGTCTCCCCCGTTCGTAGCAGGG + Intronic
1050508404 9:6370416-6370438 GGTCTCACCCTGTCATAGGCTGG + Intergenic
1050523866 9:6528577-6528599 GGGATACCCAGTTCATAGGATGG + Intergenic
1050787062 9:9416727-9416749 GTTCTACCCATTTGATAGGCAGG + Intronic
1051328870 9:16002304-16002326 TGTCTTCCACTTTCATAGGAGGG - Intronic
1051507453 9:17842267-17842289 CTTCTCCCCATTTTATAGGTGGG + Intergenic
1056565167 9:87765432-87765454 GGTCACTCCAGTTCATAGGCAGG + Intergenic
1057481916 9:95451385-95451407 GGGCTTCCCATTTTCTAGGATGG - Intronic
1060018250 9:120106250-120106272 AGAGTCCCTATTTCATAGGATGG + Intergenic
1060104513 9:120865501-120865523 GGCCTCCCCAGTTCAGTGGAGGG - Intronic
1061020550 9:128011493-128011515 GGTCTGACCATTTTAGAGGATGG + Intergenic
1061856353 9:133443787-133443809 GGCATCCCCATTTCAGAGCAGGG - Intronic
1062744723 9:138203850-138203872 TGCCTGCCCATTTCACAGGACGG - Intergenic
1193903640 X:87216244-87216266 GATCTCCCCCTTTCATTGGTTGG - Intergenic
1199052176 X:143249050-143249072 GGTATACCCATTTTTTAGGAGGG + Intergenic
1199461922 X:148094309-148094331 AGTCTCCGCATGTCATAGGAGGG - Intergenic
1200809909 Y:7473550-7473572 GGTCTTACCATTTTAAAGGAAGG + Intergenic
1201912302 Y:19145248-19145270 AGTCTCCACATGTCATGGGAGGG + Intergenic