ID: 920513803

View in Genome Browser
Species Human (GRCh38)
Location 1:206569324-206569346
Sequence GGCAACACAGGTTTTGGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 2, 2: 15, 3: 62, 4: 238}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920513795_920513803 12 Left 920513795 1:206569289-206569311 CCAAATAGGTTATGGTTGGTAAA 0: 1
1: 0
2: 2
3: 6
4: 114
Right 920513803 1:206569324-206569346 GGCAACACAGGTTTTGGGAGGGG 0: 1
1: 2
2: 15
3: 62
4: 238
920513794_920513803 13 Left 920513794 1:206569288-206569310 CCCAAATAGGTTATGGTTGGTAA 0: 1
1: 0
2: 1
3: 4
4: 108
Right 920513803 1:206569324-206569346 GGCAACACAGGTTTTGGGAGGGG 0: 1
1: 2
2: 15
3: 62
4: 238
920513793_920513803 14 Left 920513793 1:206569287-206569309 CCCCAAATAGGTTATGGTTGGTA 0: 1
1: 0
2: 0
3: 12
4: 83
Right 920513803 1:206569324-206569346 GGCAACACAGGTTTTGGGAGGGG 0: 1
1: 2
2: 15
3: 62
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920513803 Original CRISPR GGCAACACAGGTTTTGGGAG GGG Intronic