ID: 920515454

View in Genome Browser
Species Human (GRCh38)
Location 1:206581776-206581798
Sequence CTGTGGGATTGGAAAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 1, 2: 1, 3: 25, 4: 385}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920515445_920515454 18 Left 920515445 1:206581735-206581757 CCAGCTCCTCTTGGCAGCCAGAG 0: 1
1: 0
2: 2
3: 37
4: 351
Right 920515454 1:206581776-206581798 CTGTGGGATTGGAAAGTGGAAGG 0: 1
1: 1
2: 1
3: 25
4: 385
920515448_920515454 1 Left 920515448 1:206581752-206581774 CCAGAGCCTGACATTGCATCGGT No data
Right 920515454 1:206581776-206581798 CTGTGGGATTGGAAAGTGGAAGG 0: 1
1: 1
2: 1
3: 25
4: 385
920515446_920515454 12 Left 920515446 1:206581741-206581763 CCTCTTGGCAGCCAGAGCCTGAC 0: 1
1: 0
2: 3
3: 17
4: 224
Right 920515454 1:206581776-206581798 CTGTGGGATTGGAAAGTGGAAGG 0: 1
1: 1
2: 1
3: 25
4: 385
920515444_920515454 23 Left 920515444 1:206581730-206581752 CCACGCCAGCTCCTCTTGGCAGC 0: 1
1: 0
2: 3
3: 17
4: 256
Right 920515454 1:206581776-206581798 CTGTGGGATTGGAAAGTGGAAGG 0: 1
1: 1
2: 1
3: 25
4: 385
920515449_920515454 -5 Left 920515449 1:206581758-206581780 CCTGACATTGCATCGGTTCTGTG 0: 1
1: 0
2: 0
3: 9
4: 55
Right 920515454 1:206581776-206581798 CTGTGGGATTGGAAAGTGGAAGG 0: 1
1: 1
2: 1
3: 25
4: 385

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920515454 Original CRISPR CTGTGGGATTGGAAAGTGGA AGG Intronic
900151932 1:1182615-1182637 CTGAGGAGTTGGAAAGGGGAGGG + Intronic
901071190 1:6519549-6519571 CTGTGGCATTGGCATGTGGCTGG - Intronic
902259891 1:15216877-15216899 CTGTGGGATTGGAGAGGGGTAGG + Intronic
902545718 1:17189019-17189041 CTGTGAGAATGGAAATTGGTAGG - Intergenic
902933986 1:19751139-19751161 CCCTGGGCTTGGAAACTGGAGGG + Intronic
903025812 1:20429324-20429346 CTGTGGCACTGCAAAGTGGAAGG - Intergenic
903176706 1:21585851-21585873 CTGTGGAAATGGAGAGGGGAGGG + Intergenic
903314285 1:22489054-22489076 CTGTGAGGTGGGAAAGTGGCAGG + Intronic
903322660 1:22552192-22552214 CAGAGGGACTGGGAAGTGGAGGG + Intergenic
903463380 1:23534840-23534862 CTGGGAGATGGGAAAGTGTAGGG - Intergenic
904464962 1:30702159-30702181 ATGAGTGATGGGAAAGTGGAGGG - Intergenic
904757373 1:32775530-32775552 CTGTGGGATTTGAAAAGGAAAGG - Exonic
904876908 1:33662380-33662402 ATGTGGGCTTTGGAAGTGGAGGG - Intronic
905893932 1:41533308-41533330 CTGTGGGAGAGGACAGTGGGTGG - Intronic
905927792 1:41764270-41764292 GTGTAAGATTGGAAAATGGAAGG + Intronic
907033066 1:51191489-51191511 CTGTGGGATTGGAAGATTGTTGG - Intergenic
907651155 1:56296067-56296089 ATGTGTGAATGGAGAGTGGATGG - Intergenic
907935818 1:59041425-59041447 CTGTGGGATTGTAAAGGACAGGG - Intergenic
908110101 1:60888338-60888360 CTCAGGGATGGGGAAGTGGATGG - Intronic
908322819 1:62994597-62994619 TTGGGGGATGGGACAGTGGATGG - Intergenic
908934824 1:69362656-69362678 CTGTCGAATGGGAAAGTGGGAGG - Intergenic
909127787 1:71696554-71696576 TTGAGGGCTTGGGAAGTGGAGGG - Intronic
910569981 1:88689059-88689081 CAGTGACACTGGAAAGTGGAAGG + Intronic
910658593 1:89644661-89644683 CTCTGTGGTTGGAAAGTGAAGGG + Intronic
910894370 1:92052428-92052450 CTTTGGCTTTGGAAAGGGGATGG - Intronic
912041469 1:105396691-105396713 ATGGGGAATTGGAAAGGGGATGG + Intergenic
912041738 1:105398696-105398718 GTGGGGAATTGGAAAGGGGATGG + Intergenic
914217305 1:145643787-145643809 TTGTGAGACTGGAAAATGGATGG + Intronic
914218712 1:145658018-145658040 CTGAGGGAGTGGGAATTGGAGGG - Intronic
914416795 1:147491375-147491397 CTGTGGAACTGGGAAGTGGTGGG + Intergenic
914469874 1:147966472-147966494 TTGTGAGACTGGAAAATGGATGG + Intronic
914471294 1:147980882-147980904 CTGAGGGAGTGGGAATTGGAGGG - Intronic
914853798 1:151335256-151335278 CTGTGGTATTCTAAAGTGAATGG + Intergenic
916821038 1:168399009-168399031 GAGTGGGATGGGAAGGTGGATGG + Intergenic
917515327 1:175702424-175702446 CTGTGGGTCTGGAAGCTGGAAGG - Intronic
918666170 1:187154223-187154245 CTGTGCCTTTGGAAAGGGGAGGG - Intergenic
919076115 1:192814937-192814959 TTGTGGGGTTGGACAGTGAAGGG + Intergenic
919755291 1:201062581-201062603 CTCTGGGAGTGAACAGTGGAAGG + Intronic
919775492 1:201191604-201191626 CTGTTGGATTGGAGACTAGAGGG - Intronic
919972652 1:202591046-202591068 CTGTGGGTGTGGAGAGTGGGAGG + Exonic
920369519 1:205469298-205469320 CTGTGGGCTGGGGAAGGGGAAGG - Intergenic
920515454 1:206581776-206581798 CTGTGGGATTGGAAAGTGGAAGG + Intronic
920747546 1:208643357-208643379 CTGTGAAATTGTAAAGTGAAGGG - Intergenic
920913318 1:210237344-210237366 CTTTGGGAGAAGAAAGTGGAGGG + Intronic
921102078 1:211937253-211937275 CTATGGAGTTGGAAAGTGCAGGG - Intergenic
921988008 1:221333724-221333746 GTGTGGGAGTGGAAAAGGGAAGG + Intergenic
922165793 1:223114878-223114900 CTGAGGGATTGGATATTGGGGGG - Intronic
922770274 1:228178140-228178162 ATGTGGGCTCAGAAAGTGGAAGG - Exonic
922934283 1:229411493-229411515 CTCTGGGGCTGGAAAGGGGAGGG - Intergenic
1062805518 10:416824-416846 CTGTGGGCTTGGACGGTGCAGGG + Intronic
1067174478 10:43933941-43933963 ATGGGGAATTGGAAAGGGGATGG - Intergenic
1067225366 10:44372852-44372874 CTGTGGGATGGGATGGTGGAGGG - Intronic
1067538670 10:47135933-47135955 TTGGGAGATTGGAAAGTCGATGG + Intergenic
1067558117 10:47286247-47286269 ATGCCGGATTGGGAAGTGGATGG + Intergenic
1068117794 10:52752994-52753016 CTGTGGGCTTGGACAGGAGAAGG + Intergenic
1070344303 10:75526607-75526629 CTTTGGGAGTCCAAAGTGGAAGG + Intronic
1071502088 10:86211426-86211448 CTGTGTCCTGGGAAAGTGGAGGG + Intronic
1072449867 10:95531358-95531380 CTGTTGGCTTTGAAAATGGAAGG - Intronic
1073181080 10:101583645-101583667 CCCTGGGATTGGGAAGCGGATGG - Exonic
1073755120 10:106573034-106573056 CTGTGGGAATGGAAAGGTTAAGG + Intergenic
1073988118 10:109232496-109232518 CTTTGGGACTGGAGAGTGGTAGG - Intergenic
1074710418 10:116172685-116172707 ATGTGTAAGTGGAAAGTGGAGGG + Intronic
1075391151 10:122093226-122093248 CAATTGGATTGAAAAGTGGAGGG + Intronic
1076150222 10:128155862-128155884 CTCTGGGATTGGAGAAGGGAAGG - Intergenic
1076212950 10:128664949-128664971 CTGGGGGATGGGAATGGGGAAGG + Intergenic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076450256 10:130552190-130552212 CTGTGGGCTGGGGAGGTGGAGGG + Intergenic
1076566121 10:131400659-131400681 CTGTGGCAGTGCAAAGGGGAGGG + Intergenic
1077320536 11:1938971-1938993 CTATGGGAGTGGAGAGTGGAGGG - Intergenic
1077327808 11:1971264-1971286 CTGTGTGGCTGGAAGGTGGAGGG - Intronic
1078058913 11:8031265-8031287 AGGTAGGATTGGGAAGTGGAAGG + Intronic
1080613405 11:33925105-33925127 CTGTGGGGATGGAATGTGTAGGG + Intergenic
1080711833 11:34755832-34755854 CTGTGGGAGTGGAAACTGTGAGG + Intergenic
1082789568 11:57338102-57338124 CTGGGGGATGGGAAATTGCAAGG + Intergenic
1083304679 11:61756182-61756204 CTGTGGGATGGGTAAGGGGAGGG + Intronic
1084805542 11:71576597-71576619 CTGTGGGAATGGCAGGTGGTGGG + Intergenic
1085804566 11:79623245-79623267 CTGTGGGAATTGATAGAGGAAGG - Intergenic
1086092126 11:83015353-83015375 CTAAAGGATTGGAAAGAGGATGG + Intronic
1086855440 11:91860106-91860128 ATGTGGAAGAGGAAAGTGGAGGG - Intergenic
1088679685 11:112228290-112228312 ATGTTGAATTGAAAAGTGGAAGG + Intronic
1089009200 11:115119059-115119081 ATGGGGGGTTGGGAAGTGGAGGG + Intergenic
1089350411 11:117818799-117818821 CTGTGGGTTTGGAGAGTGAAGGG - Intronic
1089512355 11:119007728-119007750 CTTTGGGATGCCAAAGTGGAAGG - Intronic
1089541991 11:119194836-119194858 CTGGGGGATTGGAGAGTTGGAGG - Intronic
1089680587 11:120116917-120116939 CTGTGGGAGAGAAAAGGGGAGGG + Intronic
1089878408 11:121748218-121748240 CTGTGGGATTGCAAAAGGGATGG - Intergenic
1090333914 11:125950471-125950493 CTGTGGGAAGGGGAAGGGGAAGG + Intergenic
1202810788 11_KI270721v1_random:26444-26466 CTGTGTGGCTGGAAGGTGGAGGG - Intergenic
1092081655 12:5721332-5721354 CTGTGGGCTAGGAAAGTGCCAGG - Intronic
1094583105 12:31752421-31752443 ATGGGGAATTGGAAAGGGGATGG + Intergenic
1095498600 12:42811938-42811960 CTGTGGGAGTGGAGAAGGGAGGG + Intergenic
1096296791 12:50390931-50390953 CTTTGGGAGTCCAAAGTGGAAGG - Intronic
1097234875 12:57532531-57532553 CTGAGGGAGTGGAAAGGAGATGG + Intronic
1097651117 12:62298279-62298301 CTGTGGGAGGCCAAAGTGGACGG + Intronic
1098104939 12:67059629-67059651 CAGTGGGAATGGAAACTTGAAGG + Intergenic
1098174562 12:67777570-67777592 ATGTGGGATTGGGAAATGTAAGG - Intergenic
1099648738 12:85396332-85396354 TTGGGGGACTGGAAAGTAGATGG - Intergenic
1100538278 12:95532530-95532552 CTGAGGGATTGAGAAGAGGAGGG - Intronic
1101787164 12:107894037-107894059 CTGCGGGGTTGGAAAGAGGGTGG - Intergenic
1102368612 12:112361773-112361795 CTGTGGGATTTAAAGGAGGATGG - Intronic
1103150329 12:118632753-118632775 GTGAGAGATTGGAGAGTGGAAGG - Intergenic
1104624668 12:130341226-130341248 CAGTGGGACTGGAAAGAGAAGGG - Intronic
1105051905 12:133061609-133061631 CTCTGGGATTGGAAAGAGAATGG - Exonic
1105821104 13:24081851-24081873 CTGTGGGCGTGGAAAGTGAAAGG - Intronic
1107023293 13:35774022-35774044 CTGTGGGTTTAGAACGTGGCAGG - Exonic
1107798022 13:44074762-44074784 CTGTGGGCCTGGAAAATTGAAGG - Intergenic
1108525439 13:51282122-51282144 CTGTGGTTTTTGAAAGTTGAAGG - Intronic
1113055102 13:106259475-106259497 ATGGGGAATTGGAAAGGGGATGG + Intergenic
1113536345 13:111069348-111069370 CTGTGGGAGGGGAGAGTGTAAGG + Intergenic
1113782188 13:112983043-112983065 CTTTGGGTGTGGAAAGTGGTGGG + Intronic
1114571546 14:23672672-23672694 CTGTGGGCTTTGAAGATGGAAGG - Intergenic
1117066799 14:52019349-52019371 CTGTGGGCTGGTGAAGTGGATGG - Intronic
1119092933 14:71801416-71801438 CTGTGGGATGGGATGGGGGATGG - Intergenic
1119432231 14:74575916-74575938 CTGTGGGTTTGGAAGAGGGAGGG - Intronic
1120134894 14:80856221-80856243 CTGTGGGATAGGCAAGGGCATGG - Intronic
1120820790 14:88910244-88910266 CTGTGGAAGGGGAAAGTGGCTGG - Intergenic
1120948964 14:90023340-90023362 CTGTGTGCTTGGAATGGGGATGG + Intronic
1121794737 14:96725514-96725536 CTGTGGGCTGGGAAGGTGGGAGG - Intergenic
1125182626 15:36895066-36895088 CAGTGGGATAGTAGAGTGGATGG + Intronic
1125609031 15:40958498-40958520 CAGTGGGAATGGACAGTGGAGGG + Intergenic
1125801206 15:42449090-42449112 GTGTGGGAAAGGAAAGTGGGGGG + Intronic
1126118353 15:45229073-45229095 CTGTGGCATTAAAAACTGGAAGG - Intergenic
1126292348 15:47096295-47096317 CTGTGGAATAGAAAGGTGGAAGG + Intergenic
1127035246 15:54908712-54908734 CTGTGCCTTTGGAAAGAGGAGGG + Intergenic
1129055494 15:72817077-72817099 GTGTGTGTTTGCAAAGTGGAGGG + Intergenic
1129594890 15:76955094-76955116 ATTTGGGATTGTAAAGTGGAAGG - Intergenic
1130129998 15:81133107-81133129 CTGTGAGAATGGGAATTGGATGG - Intronic
1131310502 15:91286188-91286210 CTGTGACATTGGCAAGTGCATGG + Intronic
1132598004 16:761997-762019 CTGTGGGGTGGGGAAGTGGGTGG - Intronic
1132819913 16:1859836-1859858 CTGCGGGTTTGGGGAGTGGATGG + Intronic
1133512336 16:6472140-6472162 ATGTGGAATTGAGAAGTGGATGG - Intronic
1133808772 16:9145267-9145289 ATGGGGAATTGGAAAGGGGATGG - Intergenic
1134327407 16:13219647-13219669 CTGGGGCATGGGGAAGTGGAGGG + Intronic
1134752608 16:16638107-16638129 CTCTGGGATTGAATGGTGGAGGG + Intergenic
1134993453 16:18720969-18720991 CTCTGGGATTGAATGGTGGAGGG - Intergenic
1135136200 16:19886410-19886432 CTGCGCAATTGGAAAGTGGATGG + Intergenic
1135631008 16:24035591-24035613 CTGTGTGATTGAGAAGGGGAGGG + Intronic
1135850716 16:25960592-25960614 CTTTGGGGTTTGAAATTGGAAGG + Intronic
1136914078 16:34164765-34164787 CTATGGGATTGCCAAGGGGAAGG + Intergenic
1137299458 16:47133720-47133742 CAGTGTGGTTGGCAAGTGGAAGG + Intronic
1138159059 16:54736298-54736320 GTTCGGGATTGGAAGGTGGAAGG - Intergenic
1139356728 16:66371265-66371287 CTGTGGAATGGGAAAGCGGTGGG + Intronic
1140339979 16:74148317-74148339 CTGTGGGAGAGGCAGGTGGATGG - Intergenic
1140891820 16:79291280-79291302 CTGTAGGTTTGGACAGTGGGAGG + Intergenic
1141569099 16:84923342-84923364 CTATGGGATTAGACTGTGGATGG - Intergenic
1142475601 17:187258-187280 CTGTGGGATTGGAAAGAGGCCGG + Intergenic
1142764216 17:2056575-2056597 CTGAGGGAAGGGGAAGTGGAGGG + Intronic
1143035208 17:3991245-3991267 CTTTGGGATTACAAAGTGGGCGG - Intergenic
1143614652 17:8042620-8042642 CTGTGGGATTGGTAGTGGGAAGG - Intronic
1143832001 17:9659999-9660021 CTTTGGGATGGGAATGGGGATGG + Intronic
1143854509 17:9838830-9838852 CTGTGAGATGGGAGAGAGGAAGG + Intronic
1144037709 17:11382320-11382342 CTTTGGGAGGGGAAGGTGGAAGG - Intronic
1144286208 17:13777302-13777324 CTGTGCGGTTGGAAAAGGGACGG - Intergenic
1144601967 17:16624386-16624408 CTGTGGGATTCCAGAATGGAAGG - Exonic
1146265320 17:31449098-31449120 CTTTGGGAATGGGAAGGGGAGGG - Intronic
1146595978 17:34169003-34169025 TTGGGGCATTGGAAAATGGAAGG + Intronic
1146635692 17:34502691-34502713 CTGCGGGGGTGGAAAGAGGAGGG + Intergenic
1146986030 17:37219076-37219098 CTGTGTGATTAGAAGGTTGAGGG + Intronic
1148460954 17:47838720-47838742 CTGTGGGAGGGGAGAGTGGCTGG + Intronic
1148622467 17:49044725-49044747 CTGGGAGATTGGTAGGTGGAGGG + Intronic
1148703058 17:49602930-49602952 TTGAGGGATAGGAAAGAGGAAGG + Intronic
1148744060 17:49908657-49908679 CTGTGGGAATGGGGAGTGGGCGG + Intergenic
1148791487 17:50175689-50175711 CTGTGGGAAGAGAGAGTGGAGGG - Intronic
1149626629 17:58084256-58084278 CTGGAGGATGGGATAGTGGAGGG + Intronic
1149774861 17:59349324-59349346 CTGTGGGCTGAGAAAGGGGAGGG - Intronic
1149955865 17:61049053-61049075 CTTTGGGATGCCAAAGTGGAAGG + Intronic
1149978270 17:61288201-61288223 CTGTGGGGAGGGAAAGTGTAAGG + Intronic
1152102671 17:78311784-78311806 TTGTGGGATTGGAAAGTGGAAGG - Intergenic
1152555172 17:81049503-81049525 CTGTGGGCTTTAAAAGGGGAAGG - Intronic
1152574742 17:81135070-81135092 CAGTGGGTTTGGCAAGGGGACGG - Intronic
1154321362 18:13356028-13356050 GTGTGGGATTGGGCAGTGGAGGG + Intronic
1155293634 18:24365654-24365676 CTGGGGCATGGGAAAGGGGAAGG + Intronic
1156336072 18:36172675-36172697 CTGTGGGCAGGCAAAGTGGAAGG - Intronic
1157482017 18:48061010-48061032 GGGTGGGATTGGACAGTGGTAGG + Intronic
1157498138 18:48170945-48170967 TTGTGGGATCAGAAAGTGAAGGG - Intronic
1157773422 18:50371169-50371191 CTGTGAACTTGGAAAGTGGATGG - Intergenic
1158721826 18:59931960-59931982 CTGGGGGATTGGACTGTGGGGGG + Intergenic
1159344266 18:67178865-67178887 CTGTGGGATTGGGAAGTGTGGGG + Intergenic
1159447392 18:68557524-68557546 GTGGGGAATTGGAAAGGGGATGG + Intergenic
1162499338 19:11042581-11042603 CTGTTGGAGGGGAAAGTGAAGGG + Intronic
1165038913 19:33055014-33055036 CTGTGGCCTTGGAGAGGGGAGGG - Intronic
1165288846 19:34866894-34866916 ATGTGGGATTAAAAAGTCGATGG + Intergenic
1165956277 19:39503785-39503807 CTGTGCTCTTGGAAAGAGGATGG - Intronic
1166197724 19:41218020-41218042 CTGTGTGTTTGGCACGTGGAGGG - Intergenic
1166401282 19:42482404-42482426 CTTTGGGATGCTAAAGTGGAAGG - Intergenic
1167956541 19:53069842-53069864 CTGTGGGTTTGGACACTAGAAGG + Exonic
1168095157 19:54110245-54110267 CGGAGGGATGGGAAGGTGGAAGG - Intronic
924981124 2:222542-222564 CTATGGGATGGGTAAGAGGACGG + Intronic
924993866 2:339772-339794 GTGAGAGTTTGGAAAGTGGATGG - Intergenic
926558901 2:14393512-14393534 CCATGGGTTTGGAAAGTGGGAGG - Intergenic
927465523 2:23333640-23333662 CTCTGGGATTGCACAGTGGGTGG - Intergenic
928809445 2:35204811-35204833 CTGTGTGATTGTAAATTGTATGG - Intergenic
929144726 2:38696713-38696735 CTTTGGGATGCTAAAGTGGAAGG - Intronic
929337615 2:40769255-40769277 TTGTGGGGTAGGTAAGTGGATGG - Intergenic
929926501 2:46216805-46216827 CTCTGGCTTTGGAAAGGGGAGGG - Intergenic
929956123 2:46460060-46460082 CTGTGGGCCTGGAAGGTGGAAGG - Intronic
930430847 2:51274104-51274126 CTATGGGATGGGAAGGTGTAAGG + Intergenic
930735168 2:54770989-54771011 ATGTGGGGTGGGGAAGTGGAAGG + Intronic
932958992 2:76390039-76390061 CTGTGGGTTAGAAAATTGGAAGG + Intergenic
933301309 2:80544314-80544336 CTGTTGGCTTTGAAAATGGAAGG + Intronic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
934898306 2:98138096-98138118 ATGTGGAAGAGGAAAGTGGATGG - Intronic
935327307 2:101948547-101948569 CTGTGGAGGTGGAGAGTGGATGG + Intergenic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
937873469 2:126803028-126803050 CTGTGGGGTTGTAAACTGTAGGG + Intergenic
939443146 2:142275664-142275686 CTGTGCCTTTGGAAAGGGGAAGG - Intergenic
939563927 2:143764636-143764658 CTATGGGAGTGGAAGCTGGAAGG - Intronic
940451355 2:153842119-153842141 CTGTGGGATGGGGAGGTGGGGGG + Intergenic
941617291 2:167735159-167735181 GTGTGGTTTTGGAAATTGGAAGG - Intergenic
942209469 2:173655879-173655901 CTCTGGGAAAGGAAACTGGATGG - Intergenic
1168792708 20:590622-590644 CAGTGTGATTGGAGAGAGGATGG + Intergenic
1169219732 20:3815076-3815098 CTATGTGAATAGAAAGTGGAAGG + Intergenic
1169417678 20:5431873-5431895 CTGAGGCATGGGACAGTGGAGGG - Intergenic
1169667978 20:8060271-8060293 CTGTGTAATAGGTAAGTGGAGGG + Intergenic
1170428486 20:16258068-16258090 GTGTGTGTTTGGGAAGTGGAAGG - Intergenic
1171054571 20:21893854-21893876 GTGGGGGAGAGGAAAGTGGAAGG - Intergenic
1171839960 20:30197452-30197474 CTGTGGGATAGAGAGGTGGAAGG - Intergenic
1171960866 20:31493124-31493146 CAGTGGGACTGGGAAGAGGATGG - Intergenic
1172134800 20:32679731-32679753 CTGAGGGAGAGGAAACTGGAGGG + Intergenic
1172231689 20:33340963-33340985 CAGGGTGATTGGAAGGTGGAGGG - Intergenic
1172845880 20:37929789-37929811 ATGTGGGAAGGGAGAGTGGAGGG + Intronic
1173748670 20:45458472-45458494 CTGTAGCATGGGAAAATGGAGGG - Intergenic
1175226063 20:57444657-57444679 GTGTGGGAGCGGAAAGAGGATGG + Intergenic
1175284340 20:57827837-57827859 CTGGGGGATGGGGAAGGGGATGG + Intergenic
1175991221 20:62790478-62790500 CTGTGGGATGGGACAGTAGGAGG - Intergenic
1176175705 20:63722990-63723012 CTGTGCTATAGGAAAATGGAGGG - Intronic
1179145950 21:38767577-38767599 CTGTGGAGTCTGAAAGTGGAGGG - Intergenic
1181895478 22:26103918-26103940 CTGTCGGAATAAAAAGTGGAGGG - Intergenic
1183038961 22:35161866-35161888 CTGTGGGAGTAGAAGGTGTAGGG - Intergenic
1183159407 22:36101776-36101798 CTTTGGGAGGGCAAAGTGGATGG - Intergenic
1183479942 22:38057907-38057929 CTGTGGGACTGGGAAGTCCAGGG - Intronic
1183597154 22:38819437-38819459 CTGTGGGCTGGGAAAGGGGTCGG + Exonic
1183751098 22:39720938-39720960 CTTTGGGAATGGAAAATGCAGGG + Intergenic
1183945726 22:41324738-41324760 ATGTGGGATTGGGCAGGGGAGGG + Intronic
1184406734 22:44304737-44304759 CTGTGGGAGTGGAGAGTGACGGG + Intronic
1184610471 22:45600006-45600028 GTGTGGGCTTTGAAACTGGATGG - Intronic
1184942316 22:47778041-47778063 CCGTGGGACTGCAAAGTGAAGGG - Intergenic
949119352 3:366918-366940 ATGTGAGATTGAAAAGTAGAAGG - Intronic
949570219 3:5285378-5285400 CTGTGATATTGGCAACTGGATGG + Intergenic
949689667 3:6621295-6621317 ATGGGGAATTGGAAAGGGGATGG - Intergenic
950236966 3:11330834-11330856 GAGTGGGATGGGAAAGGGGAGGG + Intronic
951102370 3:18703660-18703682 CTCTGCCTTTGGAAAGTGGAGGG + Intergenic
952865154 3:37850296-37850318 CTGTGGGATAGGAAATTCCAAGG + Intergenic
952869510 3:37886004-37886026 CTGTGGCAGTGGGAAATGGAGGG - Intronic
953808470 3:46091956-46091978 CTGTGTCATTGCAAAGTAGAAGG + Intergenic
954040135 3:47879792-47879814 TTTAGGGATTGGAAAGGGGATGG - Intronic
955517241 3:59738437-59738459 GAGTGGGGTGGGAAAGTGGAAGG - Intergenic
955964401 3:64373462-64373484 CTGTGGGAGACCAAAGTGGAAGG + Intronic
957525599 3:81375123-81375145 CTCTGGGACAGAAAAGTGGAAGG - Intergenic
959659104 3:108845373-108845395 ATGTGGGCTAGGAAAATGGATGG + Intronic
960692078 3:120357080-120357102 CTGTGGGGTTGGAGAGAGAAGGG + Intergenic
961503235 3:127352117-127352139 TTGTGGGAGTGGCAAGAGGAGGG + Intergenic
962159392 3:132982868-132982890 CTGAGGCATGGGAAAATGGAAGG + Intergenic
963921509 3:150910175-150910197 TTGGGGGATTGGAAACTGGTTGG + Intronic
964082891 3:152782122-152782144 CTGTTGGCTTGGCAAGTGGCTGG + Intergenic
964135891 3:153344509-153344531 CTGTGGGATTGAAACATGGCAGG - Intergenic
964245029 3:154642058-154642080 TTGGGGGATTGCACAGTGGATGG - Intergenic
966413438 3:179666136-179666158 CTGTGGGATGTGAAAGAGGTTGG + Intronic
969016749 4:4108381-4108403 CTGTGGGGCTGGAGCGTGGAGGG + Intergenic
969228675 4:5815150-5815172 CTGTGGCATTGTAAACTGTAAGG + Intronic
969703031 4:8778056-8778078 CAGTGTGATTGGAAAGTGAATGG + Intergenic
972165632 4:36280790-36280812 CAGTGGGATTGGAGAGAGGGAGG + Intergenic
973590698 4:52437604-52437626 CAGTGGGATAGGAAAGTGGGAGG + Intergenic
973737256 4:53884885-53884907 CTTTGGGATGCCAAAGTGGAAGG + Intronic
974084198 4:57242179-57242201 CAGTGTGATTGGAATGGGGAAGG + Intergenic
975707065 4:77121887-77121909 ATGGGGAATTGGAAAGGGGATGG + Intergenic
976202962 4:82598012-82598034 CTGTGGGAAGGCAAAGTCGAAGG - Intergenic
977308416 4:95354359-95354381 CTGTGTTTTTGGAATGTGGAGGG - Intronic
977782589 4:100996260-100996282 AGGTAGGAATGGAAAGTGGAAGG + Intergenic
978154915 4:105478404-105478426 CTTTGAGAGTGGAGAGTGGATGG + Intergenic
978342558 4:107733979-107734001 CTGTTGGATTGGAAACAGTATGG + Intergenic
980323299 4:131307353-131307375 CAGAAGGATTGGAGAGTGGAAGG + Intergenic
980566132 4:134545263-134545285 CTGTGGGAATAGAAATTGGAAGG - Intergenic
981042951 4:140239721-140239743 CTGTGAGATCAGTAAGTGGAGGG + Intergenic
981117608 4:141010448-141010470 CTGGAGGACTGCAAAGTGGATGG - Intronic
981539148 4:145831066-145831088 CTGTGGTATTGAAAAGGGAAGGG - Intronic
982104123 4:151997100-151997122 CATTGGGAATGGAAAGAGGAAGG + Intergenic
982683319 4:158458903-158458925 CTCTGTCTTTGGAAAGTGGAGGG - Intronic
983740153 4:171120771-171120793 CTGTGGAATTGGGAAGACGATGG - Intergenic
984011837 4:174380981-174381003 CGGTGAGATTGGAAACTGAAGGG - Intergenic
984447233 4:179852130-179852152 CTGTGGGAGATGAAAGTGGTGGG - Intergenic
986454228 5:7899552-7899574 CTGTGTGCTTTGAGAGTGGAGGG + Intronic
986563257 5:9085037-9085059 CTGTGGGATTTTGAAGTTGAGGG + Intronic
986756376 5:10840130-10840152 CTCTGCCTTTGGAAAGTGGAGGG + Intergenic
988062488 5:26190398-26190420 TTGGGGGATTGGAGGGTGGAGGG + Intergenic
989504781 5:42215236-42215258 CTCTGCCTTTGGAAAGTGGAGGG - Intergenic
989523476 5:42427001-42427023 CTGAAGGATAGGCAAGTGGATGG - Intronic
990468960 5:56095734-56095756 CTGTGAGATTGGAAGGTGGGAGG - Intergenic
991339874 5:65596875-65596897 CTATGGGATTGAAATGTGGATGG - Intronic
992386701 5:76291515-76291537 CTGTGGGAAGGGAAAGTGTTAGG + Intronic
993042767 5:82834453-82834475 CTGAGGTATTGGAAAGCAGAGGG + Intergenic
995867363 5:116706055-116706077 TTGAGGGAAAGGAAAGTGGAAGG - Intergenic
996705791 5:126497162-126497184 ATGTGGTAATGAAAAGTGGAAGG + Intergenic
997656834 5:135561448-135561470 CTGTGGGGTGGGGAAGTGGGGGG + Intergenic
997824239 5:137092074-137092096 CTTGGGTATTGGAAGGTGGATGG - Intronic
998034657 5:138904711-138904733 CTTTGGGATCCCAAAGTGGATGG + Intronic
998480372 5:142458289-142458311 CTGTGACAGTGGAAAGGGGAGGG - Intergenic
998997577 5:147882402-147882424 ATGGGGGATAGGAAAGTGAAGGG - Intronic
999134415 5:149308673-149308695 GGGTAGGATTGGAAAGAGGATGG - Intronic
999270364 5:150293325-150293347 CTGGGGGATGGGCAAGTTGAGGG + Intergenic
999284178 5:150384201-150384223 CTGTGCCATTGGAAAGTGAGAGG - Intronic
999586018 5:153090429-153090451 CTTTGGGTTTGGAAACTGAATGG - Intergenic
1000151743 5:158509092-158509114 CTGTGGGAATTGAAACTGTAAGG + Intergenic
1002105702 5:176878577-176878599 CTGTGGGTGTGGCAGGTGGAGGG + Exonic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1003194015 6:3899011-3899033 ATGGGGAATTGGAAAGGGGATGG + Intergenic
1003530099 6:6929953-6929975 CTACGGGCTTGGAAAGTGGCTGG - Intergenic
1003579284 6:7325080-7325102 CTGTGGGAGTGGAGAGAGAAGGG - Intronic
1003672773 6:8174787-8174809 CTGTGGGAGTGAAAGGTGGTGGG + Intergenic
1004044226 6:12011139-12011161 GTGTTGGTTTGGAGAGTGGAAGG - Intronic
1004055673 6:12135952-12135974 CAGTGGGAATGGAAAGGGTATGG - Intronic
1005845981 6:29778973-29778995 CTGTGGGCTTTGAAATTGAAGGG + Intergenic
1005848077 6:29798153-29798175 CTTTGGGCTTTGAAAATGGAGGG + Intergenic
1005851389 6:29825548-29825570 CTGTGGGCTTTGAAAATGAAGGG + Intergenic
1005863908 6:29924009-29924031 CTGTGGGCTTTGAAAATGAAGGG + Intergenic
1005874993 6:30004230-30004252 CTGTGGGCTTTGAAAATGAAGGG + Intergenic
1006430584 6:33993324-33993346 CTGAGTGAGTGGGAAGTGGAAGG + Intergenic
1006854946 6:37126149-37126171 CTGGGGGAATGCTAAGTGGAAGG - Intergenic
1007783749 6:44268755-44268777 CTGTGGGTTTGGAAAGGCCAAGG + Intergenic
1009283751 6:61785593-61785615 CTATGGGATTGGATAGTGAGAGG + Intronic
1011344500 6:86354069-86354091 CTGGCAGATTGAAAAGTGGAGGG - Intergenic
1013722413 6:113046416-113046438 GAATGGGATTGTAAAGTGGAGGG + Intergenic
1014305133 6:119731328-119731350 CTCTGGGGTTGGAAAGTGATGGG + Intergenic
1014865194 6:126520994-126521016 CTCTGCCTTTGGAAAGTGGATGG - Intergenic
1016190688 6:141261173-141261195 CTGCGGGACTGGGAAGTAGAGGG - Intergenic
1017316441 6:153036899-153036921 CTGAGGGAATGGAAAATGTATGG - Intronic
1017557728 6:155590170-155590192 CTGTTAGAATGGAAAATGGATGG - Intergenic
1019486035 7:1289576-1289598 CTGTGGGTTTGGAGGGTGGAAGG - Intergenic
1020787097 7:12587289-12587311 CTGAGGGATGGAAAAGAGGATGG - Intronic
1020830704 7:13091263-13091285 CTGTTGGAATGGGAAGTGGAAGG + Intergenic
1021622556 7:22563101-22563123 CTGTGATATTGGAATATGGAAGG + Intronic
1023196923 7:37651258-37651280 CTGTGGGGTTGGAGCGGGGAGGG - Intergenic
1023980639 7:45068073-45068095 CTGAGGCATGGGAAAGTGAAAGG - Intronic
1025034512 7:55585258-55585280 GTGGGGGATGGGACAGTGGAGGG + Intergenic
1025996236 7:66529251-66529273 CTGTGGGAGAGGAAGGAGGATGG + Intergenic
1026028366 7:66766681-66766703 CAGTGGGAATGGAAAGACGACGG - Intronic
1026146958 7:67754790-67754812 CTGTGGGATTGGAATGTCTCTGG + Intergenic
1026988200 7:74568157-74568179 CTGTGGGAGAGGAAGGAGGATGG + Intronic
1027592114 7:80130737-80130759 CTGTGGGACTGGAGAATTGATGG + Intergenic
1028622096 7:92836368-92836390 CTGTGGGTGGGGTAAGTGGAGGG - Intronic
1028625381 7:92871348-92871370 CTGTGAGATGTGCAAGTGGAAGG + Intergenic
1032395106 7:131583764-131583786 CTCTGGGAGGCGAAAGTGGAAGG + Intergenic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1033029526 7:137812104-137812126 CCGAGGGAATGGAAAGTGAAGGG - Intronic
1034175879 7:149099395-149099417 CTGTGAATTTGGAAAGGGGAGGG + Intergenic
1034278388 7:149834590-149834612 CTGTGGGATTTACAAGAGGATGG - Intergenic
1034936715 7:155204703-155204725 CTTTGGGATGGGATGGTGGAGGG - Intergenic
1038201187 8:25414302-25414324 CTGTAGGATTGGAAAGGGAGTGG + Exonic
1041134829 8:54747005-54747027 CTGAGGGATTGGATTTTGGAGGG - Intergenic
1042129036 8:65568347-65568369 CTGTGGGAATGGAAGTGGGAAGG - Intergenic
1042305411 8:67325930-67325952 CTTTGGGATTCCAAAGTGGTGGG - Intronic
1042491499 8:69404082-69404104 GTCTGGGATAGGAAAGTGTAAGG - Intergenic
1042672811 8:71283125-71283147 CTCTGGGAAAGGAAAGTGGGAGG - Intronic
1043627045 8:82274093-82274115 CTGTGCCTTTGGAAAGGGGAGGG + Intergenic
1044424851 8:92039041-92039063 GTGGTGGATTGCAAAGTGGATGG - Intronic
1044897245 8:96905409-96905431 CAATAGGATAGGAAAGTGGATGG + Intronic
1045681268 8:104662965-104662987 CTGAGGGATTGGCAAGGGCAAGG + Intronic
1045734132 8:105275392-105275414 ATGTAGGAGTGGAAAGTGGGTGG - Intronic
1046642242 8:116745230-116745252 CTGTTGGATTCCAAACTGGATGG - Intronic
1046773437 8:118138942-118138964 TAATGAGATTGGAAAGTGGAAGG - Intergenic
1046902753 8:119540673-119540695 GGGTGGGATTGGTAAGGGGAAGG - Intergenic
1047078254 8:121429947-121429969 CAGTGGGAATGGGAAGTGAAGGG + Intergenic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1048426979 8:134332154-134332176 CTTTGGCAGTGGAAAGTGGGTGG - Intergenic
1049247746 8:141571769-141571791 GTGTGGGAAAGGATAGTGGAAGG - Intergenic
1050733926 9:8741509-8741531 CTGTTTGAGTGGAAAGTGGCTGG - Intronic
1052386702 9:27831258-27831280 CTGTGGGAGTGGCAGGGGGAGGG - Intergenic
1056448500 9:86690339-86690361 ATGTGGGGTTAGGAAGTGGAAGG + Intergenic
1057101398 9:92364091-92364113 CTTTGGGATGCCAAAGTGGATGG - Intronic
1057171974 9:92968472-92968494 CTGTGGGAGTGGATGGAGGAGGG - Intronic
1057205068 9:93166926-93166948 CTGTGGGATGGGAAGGTACAGGG - Intergenic
1057545937 9:96020757-96020779 CTGTGGGGATGGGGAGTGGACGG + Intergenic
1057998026 9:99837895-99837917 TTGTGGGAATGGGAGGTGGAGGG + Intronic
1058103106 9:100938225-100938247 CAGTGGGTATGGGAAGTGGATGG + Intergenic
1058698927 9:107585102-107585124 CTGTGGTCTTGGAAAGTTTAAGG + Intergenic
1059443751 9:114325411-114325433 TTGGGGGATTGGCAATTGGAGGG + Intronic
1059444952 9:114332188-114332210 TTGGGGGATTGGCAATTGGAGGG + Intronic
1059807960 9:117825059-117825081 TTGTGGGCTTGGAAAGAGGGAGG + Intergenic
1060462304 9:123868541-123868563 CTCTGAGATTGGCATGTGGAGGG + Intronic
1061207602 9:129173891-129173913 CTGTGGTAAAGGAGAGTGGATGG - Intergenic
1061465821 9:130778651-130778673 CTGGGGGATCTGAAAGTGGATGG - Intronic
1062699544 9:137891738-137891760 CTGTGGGGCTGTAGAGTGGAGGG + Intronic
1203666387 Un_KI270754v1:22845-22867 CTGTGGGATTGGCCAGTGCCAGG - Intergenic
1203667537 Un_KI270754v1:28484-28506 CTGTGGGATTGGCCAGTGCCAGG - Intergenic
1203668685 Un_KI270754v1:34123-34145 CTGTGGGATTGGCCAGTGCCAGG - Intergenic
1185656587 X:1690446-1690468 CTGTGGGAGGGGAATGAGGAGGG - Intergenic
1186720733 X:12300903-12300925 CTGTAGGATGGCAAGGTGGAAGG - Intronic
1186799979 X:13083194-13083216 CTGTGAAATGGGAAAGAGGAAGG - Intergenic
1187770615 X:22691814-22691836 TAGTGGCATTGGAAAGGGGAAGG - Intergenic
1188996044 X:36887375-36887397 CTGTGTGACTGGAAAAGGGAGGG + Intergenic
1190727213 X:53197473-53197495 TGTTGGGCTTGGAAAGTGGAGGG - Intronic
1192089723 X:68140920-68140942 ATGGGGAATTGGAAAGGGGATGG - Intronic
1192190576 X:68988964-68988986 CTGTCTGATTGCACAGTGGATGG + Intergenic
1192220602 X:69195145-69195167 ATGTGGGACTGGAAGGTGGAGGG + Intergenic
1192432962 X:71125124-71125146 CTGGGGGATGGGAAAATGGGTGG - Exonic
1192609509 X:72553669-72553691 CTGTGGGATTTGAGTGTGCATGG - Intronic
1192800128 X:74457762-74457784 GTGTGGGAATGGCAAGTAGATGG - Intronic
1193280460 X:79642276-79642298 CTGAAGGATTGGAAAGGGGTGGG + Intergenic
1193664645 X:84300490-84300512 CTGTGCCTTTGGAAAGGGGAGGG + Intergenic
1194598518 X:95889908-95889930 CTGTGGCACTGGAAAGAGAATGG + Intergenic
1196002028 X:110796163-110796185 CTGTGTGATGGGAAAGTAGCCGG - Intergenic
1197433794 X:126400317-126400339 CTGTGACATTGGAAACTGCATGG + Intergenic
1197524420 X:127544892-127544914 CTCTGCCATTGGAAAGAGGAGGG - Intergenic
1198639388 X:138740458-138740480 GTGTTGGATGGAAAAGTGGAGGG - Intronic
1201229757 Y:11852773-11852795 CTGTGGGAATGGACTGTTGAAGG - Intergenic
1201289793 Y:12412177-12412199 CTGTGTAATTGCAAAGTAGATGG + Intergenic