ID: 920516306

View in Genome Browser
Species Human (GRCh38)
Location 1:206586942-206586964
Sequence GGAGGCCTTAAGAGAATCCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920516301_920516306 22 Left 920516301 1:206586897-206586919 CCAACAAGTGCAAAAGAAGTATG 0: 1
1: 0
2: 0
3: 7
4: 196
Right 920516306 1:206586942-206586964 GGAGGCCTTAAGAGAATCCCAGG 0: 1
1: 0
2: 1
3: 13
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920516306 Original CRISPR GGAGGCCTTAAGAGAATCCC AGG Exonic
901186593 1:7377366-7377388 GGAGGCATTGAAAGAATCGCAGG - Intronic
901423078 1:9163776-9163798 AAAGGCCTTAAGAAAATCCCCGG + Intergenic
901939730 1:12652806-12652828 GGAGGTCCTAGGAGAAGCCCAGG + Intronic
902634340 1:17725445-17725467 GGAGGCTGCTAGAGAATCCCTGG - Intergenic
902772248 1:18652070-18652092 GGAGGCAGCAAGAGAATCCCGGG + Intronic
903577926 1:24350739-24350761 GGAGGCCTGTGGAGCATCCCTGG - Intronic
904212292 1:28893912-28893934 GGAGGCGTAAAGAGAGGCCCGGG + Intronic
907590146 1:55658793-55658815 AGAGGCCTTAAGTCTATCCCAGG + Intergenic
912225402 1:107727807-107727829 TGATGCTTTAAGAGAATCCTTGG - Intronic
913194753 1:116446484-116446506 GTAGGCCTTAACAGATGCCCAGG + Intergenic
917196475 1:172471337-172471359 GAAGGGCTTCAGAGACTCCCAGG + Intergenic
920516306 1:206586942-206586964 GGAGGCCTTAAGAGAATCCCAGG + Exonic
920668992 1:207988692-207988714 GGAGGCCAAAAGAGACTCCAAGG - Intergenic
924479301 1:244413315-244413337 GGAGGAATTAAGAGAATCAGTGG + Intronic
1069867503 10:71512758-71512780 ACAGGCCTTTGGAGAATCCCAGG - Intronic
1077671537 11:4162162-4162184 GGAAGCCTTAAAAAAATACCAGG + Intergenic
1081146843 11:39571702-39571724 GGAGTCAGTAAGAGAATCCCTGG + Intergenic
1083125998 11:60566119-60566141 AGAGGCCTTAAGATAACTCCTGG - Intergenic
1083942385 11:65903397-65903419 GGAGGCCAGGAGAGAACCCCAGG + Intergenic
1084557624 11:69884291-69884313 GGAGGCACTAAAAGAATTCCTGG + Intergenic
1084690189 11:70720574-70720596 GGAGGCCCTAAGAGGTCCCCAGG + Intronic
1085288945 11:75383525-75383547 GGAGGATTTCAGAGCATCCCTGG - Intergenic
1088474460 11:110220798-110220820 ACAGGCATTAAGAGAATCTCTGG - Intronic
1090562054 11:127943018-127943040 GGAGGTCTTAAGAAAAGCGCAGG - Intergenic
1092054408 12:5496969-5496991 GGAGGGCTTACTAGAAGCCCAGG - Intronic
1092507258 12:9116067-9116089 GGCGGGCTAAATAGAATCCCTGG + Exonic
1094020091 12:25904763-25904785 GGAGGCCTTAGCAGATCCCCTGG - Intergenic
1096862543 12:54540237-54540259 GGAGACCTGGAGGGAATCCCAGG - Intronic
1097599051 12:61669558-61669580 GGAGGCTTTCAGAGAAAGCCTGG + Intergenic
1100883953 12:99048804-99048826 GGAAGCTTCAAGAGAATCCCTGG + Intronic
1102428273 12:112861711-112861733 GGAGTCATTAAGAATATCCCCGG + Intronic
1102469569 12:113152229-113152251 GGAGGTCTTACGATAGTCCCTGG + Intronic
1102789320 12:115631204-115631226 GGAGAGCCCAAGAGAATCCCAGG + Intergenic
1104454646 12:128901021-128901043 GGAGGCCCTGAAAGAGTCCCAGG - Intronic
1110561540 13:76915312-76915334 TGAGACCTTCAGAGAACCCCTGG + Intergenic
1112296412 13:98191096-98191118 GGAGGCATTAAGGGAACTCCCGG + Intronic
1115743130 14:36409250-36409272 GGAGGCCTTCAGAGATTCCATGG + Intergenic
1119178492 14:72587581-72587603 GGAGGCCTGAAGAGTCTCCTTGG + Intergenic
1120056244 14:79927467-79927489 GAAGGCCTTAAGAAAATAACTGG - Intergenic
1121798147 14:96752713-96752735 GTAGGACCTAAGAGAATGCCTGG - Intergenic
1123191808 14:106578975-106578997 GGAGATCTTCAGAGACTCCCCGG + Intergenic
1125572458 15:40731242-40731264 AGAGGCCTGTAGAGAACCCCAGG - Exonic
1126510266 15:49463448-49463470 GGAGGCCGCAGGAGAATCACTGG + Intronic
1128472010 15:67962309-67962331 GGTGGCCTTTGGAAAATCCCTGG + Intergenic
1128775852 15:70319789-70319811 GGAGGACTGAAGAGGGTCCCAGG - Intergenic
1129612276 15:77070655-77070677 GGAGGCCTTCAGGGACTCCACGG - Intronic
1136997165 16:35198505-35198527 GAAGGCTTTCACAGAATCCCTGG + Intergenic
1140057468 16:71537648-71537670 GGAGACATTAAGGGCATCCCTGG - Exonic
1140065674 16:71609353-71609375 GGAGGGCTTCAGAGAAAGCCTGG - Intergenic
1140646538 16:77037822-77037844 GGAGGCCTTAAGTGAAACCCAGG - Intergenic
1141040761 16:80670624-80670646 GGAGGCCCTCAGAGAACCCCGGG + Intronic
1141473086 16:84252625-84252647 GGAGGCCTGGAGGGAAACCCGGG + Intergenic
1141565232 16:84897096-84897118 GGAGCTCTTCAGAGAGTCCCTGG + Intronic
1146393691 17:32444797-32444819 GGAGGGCTTGAGGCAATCCCCGG + Intronic
1147616558 17:41832176-41832198 GGAGACCCTCAGAGAATCCTTGG - Intronic
1149696691 17:58621717-58621739 GGAGGTCGTAAGAGAAGCCCTGG + Exonic
1156689894 18:39695102-39695124 TGAGGCCTTCAGAGAAAGCCTGG - Intergenic
1157324209 18:46657321-46657343 TGAGGCCCAAAGAGAAGCCCCGG - Intergenic
1162770903 19:12948839-12948861 GGAGGCCTTGAGGGAGTACCCGG + Intronic
1163790661 19:19304353-19304375 GGAGGCCATCAGAGACTCCTGGG - Intronic
1164375020 19:27676785-27676807 GGAGTCTCTAAGAGAATGCCTGG + Intergenic
1165394855 19:35558544-35558566 GGGGGCCTCCAGGGAATCCCGGG - Intronic
1167268007 19:48493087-48493109 GGAGGCCTGGAGAAAATCCAAGG - Intronic
1167349451 19:48965368-48965390 GGAGGCTGGAAGAGAGTCCCCGG - Exonic
1168013475 19:53553753-53553775 GGCGGCCTGCAGAGAATTCCAGG + Intronic
925099334 2:1232011-1232033 GGAGGCCTTCAGGGAGTCCCTGG + Intronic
934663899 2:96157288-96157310 GAAGGGCTGATGAGAATCCCTGG - Intergenic
935091683 2:99900707-99900729 TGTGACCTTCAGAGAATCCCAGG - Intronic
938143902 2:128818547-128818569 GGAGGCCTTAATGGATTTCCTGG + Intergenic
938149965 2:128874310-128874332 GGAGACCGTGACAGAATCCCAGG - Intergenic
939358362 2:141134228-141134250 GGAGACCTTACTAGAATCCGTGG - Intronic
941748415 2:169111011-169111033 CGAGGCCTTCAGGAAATCCCGGG + Intergenic
942051886 2:172147721-172147743 GAAGGCCTTAGGAGAAAGCCTGG + Intergenic
947935070 2:233997592-233997614 GGGGTCCTTCAGAGAGTCCCTGG + Intronic
948720550 2:239897604-239897626 GGAGGGCCGAAGAGAGTCCCAGG + Intronic
948801844 2:240436597-240436619 GGAGACCCTACGAGAATCCCCGG - Intronic
1169008423 20:2229091-2229113 TGAGGCCTAAACAGAATCTCAGG + Intergenic
1175044316 20:56090071-56090093 GGTGGTCTCCAGAGAATCCCAGG - Intergenic
1175077006 20:56383803-56383825 GGAGGCTTTTAGAAAAGCCCTGG + Intronic
1176522372 21:7834047-7834069 GGAAGTCTTAGGAGAATGCCAGG - Intergenic
1178656392 21:34464059-34464081 GGAAGTCTTAGGAGAATGCCAGG - Intergenic
1178698356 21:34813476-34813498 GGAGCCCTTGTGAGAATCCTGGG + Intronic
1182116171 22:27757763-27757785 GGGGGGCCTAAGAGACTCCCAGG - Intronic
953902713 3:46852234-46852256 GGAGGCCTTAAGAGAGGTCGGGG - Intergenic
957019508 3:75109296-75109318 GGAGGCATAAAAAAAATCCCAGG - Intergenic
960456762 3:117881975-117881997 GGAGGCCTTTAGAATAGCCCAGG - Intergenic
962308651 3:134310793-134310815 GGAGGCCATAAGTGAGGCCCAGG - Intergenic
966135409 3:176692653-176692675 GGAAGCATTAAGTGAACCCCAGG + Intergenic
966322519 3:178716753-178716775 ACAGGCCTTGAGAGAATCTCAGG + Intronic
973572038 4:52250500-52250522 TGGGGCCTTAAGAAAAACCCTGG - Intergenic
973764873 4:54153827-54153849 GGAGGCCTGAAGAGAATAAAAGG + Intronic
980547397 4:134285364-134285386 GGAGCACTTAACAGAATACCTGG - Intergenic
981748801 4:148074242-148074264 GGAGGCTTTAACAGAATCATGGG - Intergenic
985478086 5:91114-91136 GGAGGCCTCGAGGGGATCCCAGG + Intergenic
986306279 5:6519280-6519302 TGAGGCCTCATCAGAATCCCCGG - Intergenic
987112577 5:14701334-14701356 GCAGGCCTTAAGATGACCCCAGG + Intergenic
990343578 5:54849343-54849365 GGAGGCATTAAGTGCATCCTAGG + Intergenic
992072357 5:73159628-73159650 GGAAGCCTTCTGAGAAACCCAGG - Intergenic
992379681 5:76224992-76225014 GAAGGTCTCAAGAGAATCCAAGG + Intronic
993654511 5:90561067-90561089 AAAGGGCTTAAGAGAATTCCTGG - Intronic
998942638 5:147301255-147301277 GGAGGTCCTCAGAGAATGCCTGG + Intronic
1000034174 5:157430681-157430703 GGTGCCATTAAGAAAATCCCTGG + Intronic
1001732331 5:173969510-173969532 GGAGGGCTTCAGAGAGACCCAGG - Intergenic
1005215082 6:23516882-23516904 GGAGGGCATAAGAGAATCTCTGG - Intergenic
1005649457 6:27873365-27873387 GGAGGCGTTAAGCGCATCTCAGG - Exonic
1007541965 6:42654619-42654641 GGAGGGCTCAGGAGAATCACTGG + Intronic
1009270429 6:61606757-61606779 GGAGGGCTTCAGAGAAGGCCTGG + Intergenic
1010479863 6:76338093-76338115 GCAGGCCTTACGAGAGTCCTTGG + Intergenic
1011670501 6:89678772-89678794 GGAGACAATAAGAAAATCCCAGG + Intronic
1012581978 6:100880941-100880963 GGAGGCAGGAAGAGAATCTCTGG + Intronic
1016363347 6:143291046-143291068 TGAGGCTCTAAGAGAATCCCTGG + Intronic
1018394765 6:163369835-163369857 GGAGGCCTTGAGAGAGTGCGTGG - Intergenic
1023366077 7:39464650-39464672 GGAGCCCTTAACAGACTCTCTGG + Exonic
1026740329 7:72975145-72975167 GGACTCCTTGAGACAATCCCAGG + Intergenic
1027103402 7:75389925-75389947 GGACTCCTTGAGACAATCCCAGG - Intergenic
1028808146 7:95052967-95052989 AGAGGCATGCAGAGAATCCCAGG - Intronic
1030397088 7:108999648-108999670 GGAGGCCCAAGGAGAATCCAAGG - Intergenic
1033550725 7:142445265-142445287 GGAAGGCTGAAGAGAATGCCTGG + Intergenic
1034982822 7:155489622-155489644 GTCGGCCTCAAGAGCATCCCCGG - Intronic
1038885250 8:31656031-31656053 GGAGGTCAGAAGAGAATTCCAGG + Intronic
1039477796 8:37849807-37849829 GGAAGCCTTCAGAGACTCCTGGG + Exonic
1040786163 8:51165944-51165966 GGAGGCCATAAGAAAATCCAGGG + Intergenic
1050121891 9:2316688-2316710 GAAGGCCTTGAGAGAGACCCAGG - Intergenic
1051181141 9:14413054-14413076 GGAGGCTTTCAAAGAACCCCTGG + Intergenic
1051296774 9:15604701-15604723 ATAGGCCTTAAGACAATCCAGGG + Intronic
1056492280 9:87119745-87119767 GGAGGCCTGAAGTGCAGCCCTGG + Intergenic
1057028663 9:91756676-91756698 GGAGCCCAGAAGACAATCCCAGG - Intronic
1060401278 9:123350926-123350948 GGGGGCCTTACGGGAAGCCCAGG + Intergenic
1185446020 X:258389-258411 GGAGCCCTTGAGGGACTCCCAGG + Intergenic
1186218163 X:7322352-7322374 GGAGGCCTTCAGAGAAAGCCTGG + Intronic