ID: 920516990

View in Genome Browser
Species Human (GRCh38)
Location 1:206592491-206592513
Sequence CACCCACATGTGCTTCCGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 130}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920516990_920516993 9 Left 920516990 1:206592491-206592513 CCAGGCGGAAGCACATGTGGGTG 0: 1
1: 0
2: 0
3: 7
4: 130
Right 920516993 1:206592523-206592545 GGAGAATCTGGAGAACTGCAAGG 0: 1
1: 0
2: 1
3: 25
4: 288
920516990_920516995 25 Left 920516990 1:206592491-206592513 CCAGGCGGAAGCACATGTGGGTG 0: 1
1: 0
2: 0
3: 7
4: 130
Right 920516995 1:206592539-206592561 TGCAAGGAGACCAGGACAGCTGG 0: 1
1: 1
2: 2
3: 34
4: 326
920516990_920516992 -3 Left 920516990 1:206592491-206592513 CCAGGCGGAAGCACATGTGGGTG 0: 1
1: 0
2: 0
3: 7
4: 130
Right 920516992 1:206592511-206592533 GTGAACATGCAAGGAGAATCTGG 0: 1
1: 0
2: 2
3: 14
4: 212
920516990_920516994 17 Left 920516990 1:206592491-206592513 CCAGGCGGAAGCACATGTGGGTG 0: 1
1: 0
2: 0
3: 7
4: 130
Right 920516994 1:206592531-206592553 TGGAGAACTGCAAGGAGACCAGG 0: 1
1: 0
2: 3
3: 33
4: 373

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920516990 Original CRISPR CACCCACATGTGCTTCCGCC TGG (reversed) Intronic
902303330 1:15518704-15518726 CAGCCCCATGTGCTTCCCTCTGG - Intronic
906211283 1:44013581-44013603 CACCCACTTCTGCTTGGGCCTGG + Intronic
912593826 1:110854115-110854137 CACCCCTATGTACTTCCTCCTGG + Intergenic
915547875 1:156612584-156612606 CACCCATTTGTGCTTCCTCCGGG - Intergenic
920516990 1:206592491-206592513 CACCCACATGTGCTTCCGCCTGG - Intronic
920660526 1:207910853-207910875 CGCCCACAGCTGCTTCCCCCCGG - Intronic
923585692 1:235268076-235268098 CACCTCCATGTGGTTCCCCCAGG - Intronic
924408427 1:243777037-243777059 CAACCACAATTGCTTCCTCCTGG - Intronic
1062787485 10:277752-277774 CACCGACAGGTGCTGTCGCCAGG - Intronic
1063498940 10:6536057-6536079 CACGCACATCTGCTTCCCCAGGG - Intronic
1064428848 10:15254266-15254288 CACCCACCTATGCTGCAGCCAGG - Intronic
1075604939 10:123797946-123797968 CACCCTCCTGTGCTTCCTGCAGG - Intronic
1075711001 10:124530436-124530458 CATCCACATGTGCGCACGCCAGG + Intronic
1077152205 11:1077432-1077454 GACCCCGATGTGCCTCCGCCAGG + Intergenic
1077317318 11:1925320-1925342 CCCCCACATGGGCTCCAGCCAGG - Intronic
1089905791 11:122036989-122037011 CACCCTATTGTGCTTCCACCAGG + Intergenic
1102256398 12:111418101-111418123 CACCCACGTGTCTTTCAGCCCGG + Exonic
1103224677 12:119276566-119276588 CAGCCACATGTGCCTACTCCAGG - Intergenic
1103403467 12:120658988-120659010 CACCAACCTGAGCTTCCTCCAGG + Intronic
1104614086 12:130254152-130254174 CACCCACCTGTTCATCCACCAGG + Intergenic
1104880770 12:132068858-132068880 CACCCACCTGTGCATCAGCATGG - Intronic
1113692283 13:112319456-112319478 CTCCCACATCAGCTTCTGCCAGG + Intergenic
1114527476 14:23375796-23375818 CACCCACAAGGGCTACTGCCTGG + Exonic
1114969275 14:28005491-28005513 CCCACACATGTGCTTCAGCAGGG + Intergenic
1116396753 14:44455740-44455762 CTCCCACATGTGCCCCCGTCAGG + Intergenic
1123944954 15:25234512-25234534 CACCCACGTGTCCTGCCCCCAGG - Intergenic
1126371301 15:47950060-47950082 CTCACAGCTGTGCTTCCGCCTGG + Intergenic
1126659973 15:51023530-51023552 CACCCACATATGCTTCCCAGGGG - Intergenic
1128526471 15:68415562-68415584 CACCCACTGCTGCTTCCGGCAGG + Intronic
1131020193 15:89090953-89090975 CACACACTTTTGCTTCTGCCAGG - Intronic
1131067110 15:89441574-89441596 CACCCACAGGTGCTCCCCTCAGG - Intergenic
1134035928 16:11031452-11031474 CACTCACCTGTGTTCCCGCCTGG + Intronic
1134040449 16:11064354-11064376 CTCACCCATGTGCTGCCGCCCGG + Intronic
1134442526 16:14307786-14307808 CACCAACATGTGCCTGCTCCAGG + Intergenic
1134504055 16:14791049-14791071 CACCCACCTGTTCTTCACCCAGG + Intronic
1134576517 16:15337859-15337881 CACCCACCTGTTCTTCACCCAGG - Intergenic
1134725926 16:16418640-16418662 CACCCACCTGTTCTTCACCCAGG + Intergenic
1134941508 16:18293219-18293241 CACCCACCTGTTCTTCACCCAGG - Intergenic
1136995893 16:35187907-35187929 CACCCAGCTGGGCTTCCCCCTGG + Intergenic
1140509999 16:75500233-75500255 CTCCCACATGTGTTTCTGCTGGG + Intergenic
1141201263 16:81900238-81900260 CACCCATGTGTGCTTCACCCAGG - Intronic
1142214659 16:88824672-88824694 CACCCTCCTGTGCCTCCCCCAGG + Intronic
1142273249 16:89102019-89102041 CATGCACATGTGCTTCTCCCTGG + Intronic
1142908289 17:3063418-3063440 CACCCCCATGTACTTCTTCCTGG - Exonic
1142926277 17:3240843-3240865 CACCCCCATGTACTTCTTCCTGG + Intergenic
1142928873 17:3265778-3265800 CACCCCCATGTACTTCTTCCTGG + Intergenic
1142931912 17:3292384-3292406 CACCCCCATGTACTTCTTCCTGG - Exonic
1143995568 17:11003616-11003638 CACCCACATGTGGCTCAGCTTGG + Intergenic
1145289360 17:21530989-21531011 CACCCTCATGTGCCTCAGGCGGG + Exonic
1146333797 17:31952109-31952131 CAGCCACTTGTGCTCCAGCCTGG - Intronic
1147567671 17:41547644-41547666 CAGCCACATCTGCATCCACCAGG - Intergenic
1152604765 17:81283549-81283571 CACACACCTGGGCTGCCGCCAGG + Intronic
1153678662 18:7479090-7479112 CATCCACATTAGCTTCCACCAGG + Intergenic
1160400835 18:78610368-78610390 CACCCAGCTGTGCTTCCGTGGGG - Intergenic
1162209944 19:9083210-9083232 CACCCCCATGTACTTCTTCCTGG - Intergenic
1162211165 19:9093412-9093434 CACCCCCATGTACTTCTTCCTGG + Exonic
1162219120 19:9161108-9161130 AACGCTCATGTGCCTCCGCCGGG - Exonic
1162548513 19:11345533-11345555 CACCCACATTTGCATGCCCCAGG + Exonic
1163157916 19:15449361-15449383 CAACCGCAGGTGCTTCCTCCGGG - Intronic
1166317923 19:41999011-41999033 CACCCACGTGCGCGTCTGCCAGG - Exonic
926846601 2:17147843-17147865 GACCCACAAGTGCTGCTGCCCGG + Intergenic
928854431 2:35787883-35787905 CACCCACATGAGCTTGTGCTTGG + Intergenic
931095931 2:58941194-58941216 CACCCAACTGTACTTCAGCCTGG - Intergenic
931606260 2:64055740-64055762 AACCCTCATGTGCTGCTGCCGGG - Intergenic
939057710 2:137383622-137383644 CACCCACATGAGCTTGTGCTTGG + Intronic
941831216 2:169962119-169962141 CACTCACATGGGCCTCCGCAGGG - Intronic
943712719 2:191115461-191115483 CACCCACTTGTCCTTCTGTCTGG + Intronic
943714355 2:191134164-191134186 CACCCACATGTGCTACCTATAGG + Intronic
946050193 2:216855871-216855893 CACCCACATGTGGGTCCCCTGGG + Intergenic
948377167 2:237528914-237528936 CACCCATATGTGCTACAGCATGG - Intronic
948691157 2:239706030-239706052 CACCCAGATGTGAATCCCCCAGG - Intergenic
1170967159 20:21083838-21083860 CACCCACTTGTACTCCAGCCTGG + Intergenic
1173159546 20:40642138-40642160 CACCCACACTTCCTTCCGTCAGG + Intergenic
1175696016 20:61103194-61103216 CACCTGCATGGGCTTCCTCCAGG + Intergenic
1175806419 20:61831688-61831710 CACCCTCATGTGGTCCCTCCAGG + Intronic
1180055308 21:45355770-45355792 CGACCAAACGTGCTTCCGCCGGG + Intergenic
1181025883 22:20127435-20127457 CACCCACCTGTGCTGCGGACAGG - Intergenic
1181773832 22:25145500-25145522 CCCCAACCTGTGCTTCCTCCAGG + Intronic
1181903679 22:26175981-26176003 CACCCCCATGTGTTTCTTCCTGG + Intronic
1184697658 22:46149269-46149291 CACCCACATATCCTTCCCACTGG - Intergenic
953666789 3:44931244-44931266 CACCCCCATGTGCTCCTGCCAGG - Intronic
954873192 3:53783615-53783637 CACTCACATGAGATTCAGCCCGG - Intronic
963548519 3:146692520-146692542 CAGCCACATGTTCTTGCACCTGG - Intergenic
967494611 3:190128872-190128894 CATCTACATGTGCTTCCCCCAGG + Intergenic
968941445 4:3640798-3640820 CACCCACACGTGGCTCCCCCAGG + Intergenic
971250771 4:24971496-24971518 CACCCACATGAGCTTGTGCTTGG + Intronic
975181057 4:71345586-71345608 CACCCACTTGTGTTTCTGCTTGG + Intronic
975281887 4:72570038-72570060 CACCCACAGGTGTCTACGCCTGG - Intergenic
982049588 4:151487387-151487409 CACCCACATGTTCTTCCCTCAGG + Intronic
985203133 4:187505326-187505348 CACCCAGAAGCGCTTCCTCCAGG + Intergenic
985577448 5:680071-680093 CACGCACATTCTCTTCCGCCAGG - Intronic
985592380 5:772167-772189 CACGCACATTCTCTTCCGCCAGG - Intergenic
985708731 5:1416162-1416184 CACCCAGGTGTGCTTCTCCCTGG - Exonic
987132311 5:14871470-14871492 CACACACATCTGCTGCCGCGAGG + Exonic
989111035 5:37906862-37906884 AAGCCTCATGTGCTTCCCCCAGG - Intergenic
990334258 5:54756601-54756623 TGCCCACATGTACTTCCTCCAGG - Intergenic
994490827 5:100441075-100441097 CACCAACATCTGCTTCTGGCAGG - Intergenic
999372964 5:151067425-151067447 CACCCTCCTGTGCTCCCGACAGG - Intronic
999450111 5:151671614-151671636 CACCCCCATGTGCGTGTGCCAGG - Exonic
999827937 5:155292053-155292075 CACCCTCAAGTGGTTCCTCCAGG + Intergenic
1000027044 5:157368390-157368412 CACCCACCTGTGCTTGATCCAGG + Intronic
1001054407 5:168437082-168437104 CACCAACATGTGCTCCCCTCCGG + Intronic
1009681445 6:66897846-66897868 CACCCACATGAGCTTGTGCTTGG + Intergenic
1011237222 6:85230769-85230791 CACCCACAAGTGCTTTGGCAGGG + Intergenic
1015596398 6:134871598-134871620 CACCCACATGAGCTTGTGCTTGG - Intergenic
1018535630 6:164816018-164816040 CACTCACTTGTGTTTCTGCCTGG - Intergenic
1021053749 7:16021107-16021129 CACCCCCATCTGCTTCCCCTAGG - Intergenic
1025943976 7:66092550-66092572 CACCCAGATGCCATTCCGCCAGG + Exonic
1033484911 7:141779148-141779170 CACCTACATGAGCTTCCGTCTGG - Exonic
1035559795 8:595627-595649 CAGCCACATGTGCTTCCAATGGG - Intergenic
1035576886 8:713933-713955 CGCCCACATGTGCTGCACCCAGG + Intronic
1035983115 8:4395086-4395108 CACCCACATGAACCTCCGCTGGG + Intronic
1038500137 8:28036965-28036987 CACCCACATGAGCTTGTGCTTGG + Intronic
1039843661 8:41310481-41310503 CACACAGATGTGCTGTCGCCCGG - Intergenic
1041451700 8:58013007-58013029 CCCCAACTTGTGCTTCCCCCCGG + Intronic
1041840247 8:62261615-62261637 CACCCACATCTGGTTCTTCCAGG + Intronic
1042443253 8:68852407-68852429 CACCCACATGTCTTTCCAACTGG + Intergenic
1043844944 8:85152898-85152920 CACCCCCATGGGCTCCCGCGTGG + Intergenic
1045368502 8:101498013-101498035 CACCCACATGGGCCTCCATCAGG + Intronic
1048931802 8:139321222-139321244 CACCCATATCTGCTTCCTCTTGG - Intergenic
1049019494 8:139945704-139945726 GACCCACATGAGCTTCATCCTGG - Intronic
1053484982 9:38445565-38445587 CTCCCACACTTGCTTCCTCCTGG + Intergenic
1053524003 9:38810427-38810449 CCTCCACATGTGCCTCCACCAGG - Intergenic
1054196236 9:62034835-62034857 CCTCCACATGTGCCTCCACCAGG - Intergenic
1054642169 9:67553854-67553876 CCTCCACATGTGCCTCCACCAGG + Intergenic
1056024478 9:82478985-82479007 CACCTGCATGTGCTTAGGCCGGG + Intergenic
1061451783 9:130670844-130670866 CCCCCACATCTGCCTCAGCCTGG - Intronic
1061671881 9:132193421-132193443 CTCCCACATGTGCCTCCTCCAGG - Intronic
1062499161 9:136844957-136844979 CCCCCACGTGCGCTGCCGCCTGG + Exonic
1203563465 Un_KI270744v1:75563-75585 CACCTACATGTCCTCCGGCCTGG + Intergenic
1185547951 X:960948-960970 CATCCACATGTGCACCTGCCAGG + Intergenic
1189633538 X:42980190-42980212 CCCCTATATGTGCTTCAGCCAGG - Intergenic
1190234320 X:48604356-48604378 TCCCCTCATGTCCTTCCGCCAGG + Exonic
1190302969 X:49067218-49067240 CTCCCAGATGGGCTTCCCCCGGG + Exonic
1193865485 X:86725826-86725848 CACCCACATGTGCTACCAGCAGG - Intronic
1195129786 X:101840701-101840723 CACCCACAGGTGCCACTGCCTGG + Intronic
1195176450 X:102319122-102319144 CACCCACAGGTGCCACTGCCTGG - Intronic
1195182414 X:102367971-102367993 CACCCACAGGTGCCACTGCCTGG + Intronic